Application of 3-aminophenylboronic acid functionalized magnetic beads in enrichment and / or detection of influenza A virus and / or mycoplasma pneumoniae products

Abstract

The invention provides application of 3-aminophenylboronic acid functionalized magnetic beads in enrichment and / or detection of influenza A virus and / or mycoplasma pneumoniae products, and belongs to the technical field of biological detection. According to the invention, 3-aminophenylboronic acid functionalized magnetic beads are used for broad-spectrum enrichment and / or detection of influenza A virus and / or mycoplasma pneumoniae for sample pretreatment, so that the problems that the existing column chromatography method and magnetic bead method for extracting nucleic acid are tedious in operation, are not beneficial to field application and need assistance of large-scale equipment such as a centrifugal machine and the like; and the problem that pollution is easily caused by repeated uncapping and pipetting depending on professional technicians is solved, and support is provided for on-site rapid detection. The kit disclosed by the invention can specifically detect the influenza A virus and / or the mycoplasma pneumoniae, and the sensitivity of detecting the influenza A virus and / or the mycoplasma pneumoniae is high.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to the application of 3-aminophenylboronic acid-functionalized magnetic beads in the enrichment and / or detection of products for influenza A virus and / or Mycoplasma pneumoniae. Background Art

[0002] Respiratory pathogen infections are common and highly harmful health problems worldwide, posing a serious threat to the health of children in particular. According to the surveillance data of respiratory infectious diseases, influenza virus and Mycoplasma pneumoniae infections have the highest prevalence among school-age children. The immune system of children is not yet fully developed, with weak resistance to pathogens and high susceptibility. Once infected, the symptoms are often more severe than those in adults and the course of the disease is longer. Secondly, the school-age child population has intensive contact, such as in nurseries, kindergartens and schools, which is extremely likely to cause the rapid spread of pathogens and may very likely lead to collective outbreaks in a short time, increasing the public health burden. At present, most respiratory pathogen infections are mainly treated symptomatically or empirically. It is a very important clinical practical problem that needs to be solved for pediatric medical staff to timely and accurately identify the type of pathogen and formulate a reasonable treatment plan to avoid the abuse of antibiotics and over-treatment. In fact, a clear pathogen diagnosis is crucial for the rational treatment of mixed infections and infections complicated with other diseases (such as encephalopathy). Molecular diagnosis based on nucleic acid analysis has the advantages of excellent sensitivity and specificity and can identify pathogens with slow growth or difficult cultivation, such as real-time quantitative polymerase chain reaction (qPCR), which has been widely used in the detection of respiratory pathogens. However, it relies on central laboratories and professional technicians, and usually takes a long time to obtain the results. Making multiple trips to the hospital further increases the possibility of cross-infection among children. Therefore, in the peak season of children's respiratory infections, realizing the on-site rapid nucleic acid detection of common respiratory pathogens is of great significance for the effective control of infections and the precise treatment of diseases. Recombinase polymerase isothermal amplification technology has received extensive attention due to its mild reaction temperature and fast speed. However, there has been no report on the simultaneous detection of influenza A (H1N1) virus and Mycoplasma pneumoniae using this technology.

[0003] The currently developed RPA detection technology has certain advantages over the PCR technology in terms of amplification detection speed, operation, etc., but there are still certain difficulties in on-site detection, and sample pretreatment (nucleic acid extraction) has become the main limiting factor. Some studies only explored the rapidity of amplification itself but did not consider the sample processing time. Many studies used nucleic acid extraction kits for sample pretreatment, and this process usually requires professional technicians and large centrifugal equipment, which is not conducive to on-site application. Currently, the most commonly used commercial nucleic acid extraction method is solid-phase purification method, which is specifically divided into silica column method and micro-nano magnetic bead method. The two commonly used nucleic acid extraction methods can obtain high-purity nucleic acid molecules, but they require repeated pipetting and centrifugation, and the operation is still not convenient. At the same time, during the nucleic acid extraction process, the lid needs to be opened repeatedly, which is prone to cross-contamination. 3-Aminophenylboronic acid (APBA) is an important chemical sensor material, which has shown great potential in pathogen detection and other fields. APBA can form reversible borate ester bonds with the vicinal dihydroxy groups of sugar molecules, and this property has been used to develop a variety of rapid and sensitive pathogen detection methods. The existing reports are mostly used for the immunoassay of bacteria or viruses, but rarely used for the pretreatment of sample nucleic acid detection. Whether APBA and magnetic beads are suitable for the next-step nucleic acid extraction and nucleic acid amplification is a problem that needs to be further explored. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide an application of 3-aminophenylboronic acid-functionalized magnetic beads in the products for enriching and / or detecting influenza A virus and / or Mycoplasma pneumoniae, and the 3-aminophenylboronic acid-functionalized magnetic beads can effectively enrich influenza A virus and / or Mycoplasma pneumoniae, overcoming the problems of long operation time of the pretreatment technology of the sample to be tested, the need for large equipment such as centrifuges for assistance, dependence on professional technicians, and easy contamination caused by repeated opening of the lid and pipetting.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides an application of 3-aminophenylboronic acid-functionalized magnetic beads in the following a and / or b:

[0007] a. In the preparation of products for enriching influenza A virus and / or Mycoplasma pneumoniae;

[0008] b. In the preparation of products for detecting influenza A virus and / or Mycoplasma pneumoniae;

[0009] The preparation method of the 3-aminophenylboronic acid-functionalized magnetic beads includes the following steps:

[0010] The carboxylated coated magnetic beads were washed with MEST solution, and the washed magnetic beads were resuspended in MEST solution containing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide for the first incubation and activation. The activated magnetic beads were resuspended in PBS solution containing 3-aminophenylboronic acid for the second incubation reaction to obtain 3-aminophenylboronic acid-functionalized magnetic beads.

[0011] Preferably, the time for the first incubation is 25-35 min; the time for the second incubation is 1.5-2.5 h.

[0012] Preferably, the concentration of EDC in the MEST solution containing EDC and NHS is 8-12 mg / mL, and the concentration of NHS is 8-12 mg / mL; the concentration of 3-aminophenylboronic acid in the PBS solution containing 3-aminophenylboronic acid is 0.05-0.15 mg / mL.

[0013] The present invention provides a kit for detecting influenza A virus and / or Mycoplasma pneumoniae, comprising the above-mentioned 3-aminophenylboronic acid-functionalized magnetic beads.

[0014] Preferably, the kit comprises a primer-probe set for detecting influenza A virus and / or Mycoplasma pneumoniae, and the primer-probe set is a primer-probe for detecting influenza A virus and a primer-probe for Mycoplasma pneumoniae;

[0015] The primer-probe for detecting influenza A virus comprises HA-F1, HA-R1 and probe 1;

[0016] The sequence of HA-F1 is shown as SEQ ID NO.1; the sequence of HA-R1 is shown as SEQ ID NO.2; probe 1 is ATGTAACAGTAACACACTCTGTTAACCTT / i6FAMdT / / idSp / / iBHQ1dT / GAAGACAAGCATAACG-C3 Space;

[0017] The primer-probe for detecting Mycoplasma pneumoniae comprises MP-F2, MP-R2 and probe 2;

[0018] The sequence of MP-F2 is shown as SEQ ID NO.5; the sequence of MP-R2 is shown as SEQ ID NO.6; probe 2 is TGTTACTATGCGTGCAGCTAGCACCTTCTT / iHEXdT / / idSp / / iBHQ1dT / TGATGTTCAGCTAG-C3 spacer.

[0019] Preferably, the kit comprises an amplification reaction system; the amplification reaction system comprises 8 - 12 μM HA-F1 2 μL, 8 - 12 μM HA-R1 2 μL, 8 - 12 μM probe 1 0.6 μL, 8 - 12 μM MP-F2 2 μL, 8 - 12 μM MP-R2 2 μL, 8 - 12 μM probe 2 0.6 μL, 280 nM magnesium acetate 2.5 μL, and template 10 μL.

[0020] The present invention provides a method for detecting influenza A virus and / or Mycoplasma pneumoniae for non-diagnostic purposes, the method comprising the following steps:

[0021] Incubating the 3-aminophenylboronic acid-functionalized magnetic beads in the above-mentioned kit with the sample to be tested to obtain an incubated mixture, subjecting the incubated mixture to magnetic separation, discarding the supernatant to obtain a magnetically separated complex, and heating the magnetically separated complex to obtain a lysed product.

[0022] Preferably, it further comprises the following step: after obtaining the lysed product, performing an amplification reaction on the lysed product in the above-mentioned amplification reaction system using the above-mentioned primer-probe set.

[0023] Preferably, the dosage of the 3-aminophenylboronic acid-functionalized magnetic beads is greater than 30 μg; the incubation time is 3 - 9 min.

[0024] Preferably, the heating method is heating at 95 - 100 °C for 3 - 7 min.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides an application of 3-aminophenylboronic acid-functionalized magnetic beads in products for enriching and / or detecting influenza A virus and / or Mycoplasma pneumoniae. The present invention uses 3-aminophenylboronic acid-functionalized magnetic beads for sample pretreatment for broad-spectrum enrichment and / or detection of influenza A virus and / or Mycoplasma pneumoniae, solving the problems of the existing column method and magnetic bead method for nucleic acid extraction, which are cumbersome and not conducive to on-site application, require large equipment such as centrifuges for assistance, rely on professional technicians, and are prone to contamination due to repeated opening and pipetting, providing support for on-site rapid detection. The kit of the present invention can specifically detect influenza A virus and / or Mycoplasma pneumoniae, and has high sensitivity for detecting influenza A virus and / or Mycoplasma pneumoniae. Description of the Drawings

[0027] Figure 1 Shows the hydrodynamic test results of APBA-MBs and MBs;

[0028] Figure 2 Shows the zeta potential test results of APBA-MBs and MBs;

[0029] Figure 3 Fourier transform infrared spectroscopy measurement results of APBA-MBs and MBs;

[0030] Figure 4 Flow chart of sample pretreatment for influenza A (H1N1) virus and Mycoplasma pneumoniae based on APBA-MBs;

[0031] Figure 5 Sensitivity test results of the dual RPA detection method;

[0032] Figure 6 Specificity test results of the dual RPA detection method;

[0033] Figure 7 Detection results of influenza A (H1N1) virus positive infection samples, where the number is the sample number;

[0034] Figure 8 Detection results of Mycoplasma pneumoniae positive infection samples, where the number is the sample number;

[0035] Figure 9 Detection results of co-infected samples, where the number is the sample number;

[0036] Figure 10 Optimization results of magnetic bead dosage and incubation time;

[0037] Figure 11 Capture efficiency of APBA-MBs for influenza A (H1N1) virus and Mycoplasma pneumoniae in different clinical sample matrices. Detailed implementation mode

[0038] The present invention provides an application of 3-aminophenylboronic acid-functionalized magnetic beads in the following a and / or b:

[0039] a. In the preparation of products for enriching influenza A virus and / or Mycoplasma pneumoniae;

[0040] b. In the preparation of products for detecting influenza A virus and / or Mycoplasma pneumoniae;

[0041] Preparation method of 3-aminophenylboronic acid-functionalized magnetic beads, including the following steps:

[0042] Wash the carboxylated coated magnetic beads with MEST solution, resuspend the washed magnetic beads in MEST solution containing EDC and NHS for the first incubation activation, and then resuspend the activated magnetic beads in PBS solution containing 3-aminophenylisoboric acid for the second incubation reaction to obtain 3-aminophenylboronic acid-functionalized magnetic beads.

[0043] In the present invention, the carboxylated coated magnetic beads are washed with MEST solution, and the washed magnetic beads are resuspended in MEST solution containing EDC and NHS. The amount of the carboxylated coated magnetic beads is 0.8 - 1.2 mg; the number of washing times is preferably 2 times, and the amount used for each washing is preferably 150 - 250 μL, more preferably 170 - 220 μL, and even more preferably 200 μL. The concentration of EDC in the MEST solution containing EDC and NHS is preferably 8 - 12 mg / mL, more preferably 9 - 11 mg / mL, and even more preferably 10 mg / mL; the concentration of NHS in the MEST solution containing EDC and NHS is preferably 8 - 12 mg / mL, more preferably 9 - 11 mg / mL, and even more preferably 10 mg / mL. The MEST solution is a MES solution containing 0.05% Tween - 20, and the pH value of the MEST solution is preferably 4.5 - 5.5, more preferably 5.0.

[0044] In the present invention, after the washed magnetic beads are resuspended in the MEST solution containing EDC and NHS, the first incubation activation is carried out. The activated magnetic beads are resuspended in PBS solution containing 3 - aminophenylboronic acid for the second incubation reaction, and 3 - aminophenylboronic acid - functionalized magnetic beads are obtained. The time of the first incubation is preferably 25 - 35 min, more preferably 27 - 32 min, and even more preferably 30 min; the temperature of the first incubation is room temperature; the concentration of 3 - aminophenylboronic acid in the PBS solution containing 3 - aminophenylboronic acid is preferably 0.05 - 0.15 mg / mL, more preferably 0.07 - 0.12 mg / mL, and even more preferably 0.1 mg / mL; the time of the second incubation is preferably 1.5 - 2.5 h, more preferably 2 h; the temperature of the second incubation is room temperature. In the present invention, the room temperature refers to a temperature of 20 - 30 °C, such as 25 °C. In the present invention, the second incubation is to complete the coupling reaction of APBA and carboxylated coated magnetic beads.

[0045] The present invention provides a method for broad - spectrum pathogen enrichment based on 3 - aminophenylboronic acid (APBA) - functionalized magnetic beads and its application in downstream dual - RPA detection, which is simple, convenient and fast.

[0046] The present invention provides a kit for detecting influenza A virus and / or Mycoplasma pneumoniae, which includes the above - mentioned 3 - aminophenylboronic acid - functionalized magnetic beads.

[0047] In the present invention, the kit includes a primer - probe set for detecting influenza A virus and / or Mycoplasma pneumoniae, and the primer - probe set is a primer - probe for detecting influenza A virus and a primer - probe for Mycoplasma pneumoniae;

[0048] The primer probes for detecting influenza A virus include HA-F1, HA-R1, and probe 1;

[0049] The sequence of HA-F1 is as shown in SEQ ID NO.1; the sequence of HA-R1 is as shown in SEQ ID NO.2; probe 1 is ATGTAACAGTAACACACTCTGTTAACCTT / i6FAMdT / / idSp / / iBHQ1dT / GAAGACAAGCATAACG-C3 Space;

[0050] The primer probes for detecting Mycoplasma pneumoniae include MP-F2, MP-R2, and probe 2;

[0051] The sequence of MP-F2 is as shown in SEQ ID NO.5; the sequence of MP-R2 is as shown in SEQ ID NO.6; probe 2 is TGTTACTATGCGTGCAGCTAGCACCTTCTT / iHEXdT / / idSp / / iBHQ1dT / TGATGTTCAGCTAG-C3 spacer.

[0052] In the present invention, the kit includes an amplification reaction system; the amplification reaction system includes 2 μL of 8 - 12 μM HA-F1, 2 μL of 8 - 12 μM HA-R1, 0.6 μL of 8 - 12 μM probe 1, 2 μL of 8 - 12 μM MP-F2, 2 μL of 8 - 12 μM MP-R2, 0.6 μL of 8 - 12 μM probe 2, 2.5 μL of 280 nM magnesium acetate, and 10 μL of template.

[0053] In the present invention, the kit can specifically and highly sensitively detect influenza A virus and / or Mycoplasma pneumoniae. The influenza A virus includes influenza A (H1N1) virus.

[0054] In the present invention, the kit further includes PCR-grade paraffin oil, and the dosage of the PCR-grade paraffin oil is 45 - 55 μL, more preferably 50 μL; the function of the PCR-grade paraffin oil is to form an oil seal to prevent aerosol contamination caused by the amplification process and the process of opening the lid after amplification. The present invention has no special limitation on the source of the PCR-grade paraffin oil, and products known in the art can be used.

[0055] The present invention provides a method for detecting influenza A virus and / or Mycoplasma pneumoniae, which is used for non-diagnostic purposes and includes the following steps:

[0056] Incubate the 3-aminophenylboronic acid-functionalized magnetic beads in the above-mentioned kit with the test sample to obtain an incubated mixture. Perform magnetic separation on the incubated mixture, discard the supernatant to obtain a magnetically separated complex, and heat the magnetically separated complex to obtain a lysed product.

[0057] In the present invention, after obtaining the lysed product, use the above primer-probe set to perform an amplification reaction on the lysed product in the amplification reaction system.

[0058] In the present invention, the amplification reaction system includes 8 - 12 μM HA-F1 2 μL, 8 - 12 μM HA-R1 2 μL, 8 - 12 μM probe 1 0.6 μL, 8 - 12 μM MP-F2 2 μL, 8 - 12 μM MP-R2 2 μL, 8 - 12 μM probe 2 0.6 μL, 280 nM magnesium acetate 2.5 μL, and template 10 μL. The amplification reaction system further includes PCR-grade paraffin oil, and the dosage of the PCR-grade paraffin oil is 45 - 55 μL, more preferably 50 μL. The heating method is heating at 95 - 100 °C for 3 - 7 min, more preferably heating at 98 °C for 5 min.

[0059] In the present invention, the dosage of the 3-aminophenylboronic acid-functionalized magnetic beads is greater than 30 μg, preferably 50 - 110 μg, more preferably 70 μg; the incubation time is 3 - 9 min, preferably 9 min. The present invention utilizes 3-aminophenylboronic acid-functionalized magnetic beads to rapidly and efficiently enrich influenza A virus and / or Mycoplasma pneumoniae.

[0060] In the present invention, the amplification reaction is incubated at 38 - 42 °C for 20 min, more preferably incubated at 40 °C for 20 min.

[0061] In the present invention, different fluorescence channels are set for the two primer-probes. The probe for influenza A is FAM, with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. The probe for Mycoplasma pneumoniae is HEX, with an excitation wavelength of 533 nm and an emission wavelength of 549 nm. At the same time, fluorescence signal collection is performed every 30 s. The determination method for the method of detecting influenza A virus and / or Mycoplasma pneumoniae is to first set the fluorescence threshold to be greater than three times the standard deviation of the background signal. The positive sample starts below the threshold line and then shows an exponential increase, while the negative sample has no fluorescence signal or is always below the threshold.

[0062] The present invention discloses for the first time a method for detecting influenza A virus and / or Mycoplasma pneumoniae using the above-mentioned kit, which has strong specificity and high sensitivity. The sensitivity is 1 copy / μL, and the coincidence rate for the actual detection of 18 positive clinical samples is 94.44%.

[0063] In the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art.

[0064] The technical solutions provided by the present invention will be described in detail below in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0065] In the following embodiments, the experimental materials: the RPA isothermal amplification kit (WLRE8208KIT) was purchased from Amp Future; the carboxyl-coated magnetic beads (M-PVAC22 ， CMG-207) were purchased from Revvity; 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC, purchased from Sigma, catalog number 03449-5G), N-hydroxysuccinimide sodium salt (NHS, purchased from sigma, catalog number 56485), 3-aminophenylboronic acid (APBA, purchased from Sigma, catalog number 900988-250MG), MES (purchased from Sigma, catalog number M3671), Tween-20 (purchased from Sigma, catalog number 655206-50mL). Bovine serum albumin (BSA, purchased from Thermo Fisher, catalog number 37525). The characterization and detection instruments and equipment used include Fourier transform infrared spectrometer (Thermo Scientific Nicolet Summit X), scanning electron microscope (SEM) (SU8600, Tokyo, Japan), thermostatic mixer (MTH-100, Hangzhou Mio Instruments), vertical mixer (BE-1100) purchased from kylin-Bell, Zeta Sizer Nano 1000 (Mal Zhejivern Instruments Ltd., UK), magnetic stand (DynaMag TM -2) purchased from invitrogen, fluorescence quantitative PCR instrument (LightCycler 96, Roche)

[0066] The MEST solution is a MES solution containing 0.05% (v / v) Tween-20, and its preparation method is: mixing 50 μL of Tween-20 with 100 mL of 100 mM MES and adjusting the pH to 5.0 to obtain the MEST solution.

[0067] Mycoplasma pneumoniae were respectively from the purchased Daan Mycoplasma pneumoniae qPCR detection kit (ZYT0001), and the influenza A H1N1 virus was from the influenza A inactivated virus standard (purchased from the National Institute of Metrology of China, NIM-RM4054).

[0068] The recombinant plasmid of the influenza A H1N1 virus and the recombinant plasmid of Mycoplasma pneumoniae were prepared by Shanghai Sangon Biotech Co., Ltd.

[0069] Example 1

[0070] Preparation of 3-aminophenylboronic acid-functionalized magnetic beads (APBA-MBs):

[0071] First, take 1 mg of carboxylated magnetic beads (MBs) into a 1 mL centrifuge tube. After magnetic separation, remove the supernatant. Add 200 μL of MEST solution for washing twice. Subsequently, resuspend the washed magnetic beads in 200 μL of MEST solution containing 10 mg / mL of EDC and 10 mg / mL of NHS to obtain a mixture, which is placed in a vertical mixer at room temperature and incubated for 30 min for activation. Next, remove the supernatant by magnetic separation. The activated magnetic beads obtained are resuspended in 500 μL of sterile PBS solution containing 0.05 mg of APBA and continue to be incubated in a vertical mixer at room temperature for 2 hours to complete the coupling reaction of APBA with magnetic nanoparticles. After the coupling reaction is completed, wash the obtained APBA-MBs three times with 500 μL of PBS solution to obtain APBA-MBs.

[0072] Resuspend the APBA-MBs in 100 μL of sterile PBS, adjust the final concentration to 10 mg / mL, and store it at 4 °C for subsequent use.

[0073] To ensure the successful synthesis of APBA-MBs, APBA-MBs and MBs were characterized in detail by FT-IR, hydrodynamic particle size, and Zeta potential respectively.

[0074] Figure 1 The results show that the actual average diameter of MBs is 1.52 μm, while the actual average diameter of ABPA-MBs is 2.10 μm.

[0075] Figure 2 The results show that the surface potential of MBs is -59.83 mV. When successfully combined with APBA, the potential drops to -44.50 mV. Compared with MBs, due to the reaction between the amino group on the surface of APBA and the carboxyl group on the surface of MBs, the potential of APBA-MBs increases.

[0076] Figure 3 The results show that the infrared spectral characteristics of the magnetic bead samples are significantly changed after APBA modification. For example, a new C=O stretching vibration absorption peak appears at 1716 cm -1 ; an absorption peak appearing at 1549 cm -1 belongs to the stretching vibration mode of the benzene ring C=C bond; the enhancement of the absorption peak at 1313 cm -1 is mainly due to the introduction of the arylamine C-N structure; the absorption peak at 1433 cm -1The enhancement of the absorption peak at may be related to the introduction of the B-O structure in APBA; 3377 cm -1 The change in the O-H peak shape at also proves the existence of the B-OH structure in the polymer; at 878 cm -1 The weak absorption peak that appears at is related to the out-of-plane bending vibration mode of C-H in the meta-substituted benzene ring structure; the changes in the above absorption peaks indicate that the surface of the magnetic material is coated with APBA.

[0077] Figures 1 to 3 The results show that the magnetic bead particles modified with APBA were successfully prepared.

[0078] Example 2

[0079] A method for dual RPA detection of influenza A virus H1N1 and Mycoplasma pneumoniae, the steps are as follows:

[0080] (1) Use APBA-MBs for pretreatment of the sample to be tested:

[0081] 70 μg of APBA-MBs and 200 μL of the sample to be tested (throat swab preservation solution or bronchoalveolar lavage fluid) are incubated at room temperature for 9 min using a vertical mixer to obtain the incubated mixture. The enriched complex is magnetically selected from the incubated mixture for 1 min, the supernatant is discarded, and the enriched complex is resuspended in 15 μL of enzyme-free water and heated at 98 °C for 5 min to release nucleic acids, obtaining the lysed product, and the lysed product is used for subsequent amplification experiments.

[0082] Among them, the flowchart of the pretreatment of influenza A virus H1N1 and Mycoplasma pneumoniae samples based on APBA-MBs is shown in Figure 4 .

[0083] (2) Use a detection primer-probe set containing the HA gene of influenza A virus H1N1 and the P1 gene of Mycoplasma pneumoniae to detect the lysed product. Among them, the primer-probe sets for detecting influenza A virus H1N1 and Mycoplasma pneumoniae are shown in Table 1, and the detection steps are as follows:

[0084] Configure the premixed system according to Table 2 below. Take out the dry powder tube containing the enzyme freeze-dried powder, add the premixed system to a dry powder tube, then add the amplification template (the lysed product or plasmid sample in step (1)), invert and mix the mixed system and then centrifuge briefly, and put it into a fluorescence quantitative PCR instrument to collect real-time fluorescence, and the parameters are to incubate at 40 °C for 20 min.

[0085] Among them, the dry powder tube containing the enzyme freeze-dried powder is purchased from the RPA isothermal amplification kit (WLRE8208KIT) of Amp Future, and the buffer in Table 2 is the buffer that comes with the enzyme freeze-dried powder, that is, the buffer in the RPA isothermal amplification kit.

[0086] Table 1 Primer-probe set sequence information

[0087]

[0088] In Table 1, "6FAM" in i6FAMdT is a fluorophore, namely fluorescein carboxylic acid; "i" represents internal modification; "dT" indicates that this is a deoxythymidine nucleotide labeled. "HEX" in iHEXdT is a fluorophore; "i" represents internal modification; "dT" indicates that this is a deoxythymidine nucleotide labeled. "idSp" is an identifier for a spacer group. Among them, "BHQ1" in iBHQ1dT is a quencher (Black Hole Quencher 1), which can absorb the fluorescence emitted by the fluorophore, thus achieving fluorescence quenching; "i" is internal modification, and "dT" indicates that this quenching group is linked to the deoxythymidine nucleotide. "C3Spacer" indicates that there is a C3 spacer group at the 3' end.

[0089] Table 2 Premixed system

[0090]

[0091]

[0092] Example 3

[0093] Performance test

[0094] (1) Sensitivity test

[0095] The preparation of the recombinant plasmid of influenza A H1N1 virus and the recombinant plasmid of Mycoplasma pneumoniae was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The preparation steps include:

[0096] A 518bp fragment of the Mycoplasma pneumoniae P1 gene (nt445513 - 446031, GenBank accession: CP039773.1) and a 956bp fragment of the influenza A H1N1 virus HA gene (nt 1 - 956, GenBank accession: NC_026433.1) were respectively cloned into the pUC57 vector to construct recombinant plasmids (recombinant plasmid of influenza A H1N1 virus and recombinant plasmid of Mycoplasma pneumoniae). The DNA concentration was measured using nanodrop to obtain the copy number.

[0097] Then, the high-concentration plasmid was diluted ten-fold with enzyme-free water in a concentration gradient.

[0098] P1 gene sequence of Mycoplasma pneumoniae for preparing recombinant plasmid:

[0099]

[0100] Sequence of influenza A (H1N1) virus for preparing recombinant plasmid:

[0101]

[0102] CATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGT

[0103] GAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACATCTAGT

[0104] TCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTA

[0105] AGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCC

[0106] AAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGC

[0107] ATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTT

[0108] AAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAA

[0109] GGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCT

[0110] GACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGACA

[0111] TCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGT

[0112] GAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGG

[0113] GAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATG

[0114] CATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACC

[0115] AGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAA(SEQ ID NO.10).

[0116] In the premixed system of Table 2, recombinant plasmid templates of influenza A H1N1 virus or Mycoplasma pneumoniae recombinant plasmid with different concentrations (10 0 copies / μL, 10 1 copies / μL, 10 2 copies / μL and 10 3 copies / μL) were added respectively. In the control group, nuclease-free water was used to replace the template, and the sensitivity test was carried out respectively with reference to the detection method in step (2) of Example 2.

[0117] The results are as Figure 5 shown, indicating that the detection sensitivity of this method for Mycoplasma pneumoniae and influenza A H1N1 virus is both 1 copy / μL.

[0118] (2) Specificity test

[0119] In the premixed system of Table 2, influenza A H3N2 virus, influenza A H7N9 virus, influenza B virus, respiratory syncytial virus, novel coronavirus, influenza A virus H5N1 with a concentration of 10 5 copies / μL were added. At the same time, influenza A H1N1 virus and Mycoplasma pneumoniae with a concentration of 10 5 copies / μL were used as positive control groups, and nuclease-free water was used as the blank control group. The primer-probe for detecting influenza A H1N1 virus (SEQ ID NO.1 - 3) or the primer-probe for detecting Mycoplasma pneumoniae (SEQ ID NO.4 - 6) were used respectively to detect with reference to the detection method in step (2) of Example 2.

[0120] The results are as Figure 6 shown. Using the primer-probe group of Example 2 can specifically amplify influenza A H1N1 virus and Mycoplasma pneumoniae, indicating that the detection method based on dual RPA amplification using the probe-primer group of the present invention has good specificity.

[0121] (3) Clinical sample verification

[0122] The collected clinical throat swab samples were pretreated according to the method in step (1) of Example 2, and the sample detection was carried out according to the method described in step (2) of Example 2. Among them, a total of 18 clinically verified positive samples were collected (5 cases of positive samples infected with influenza A (H1N1) virus, 9 cases of positive samples infected with Mycoplasma pneumoniae, and 5 cases of co-infected samples).

[0123] The results are as Figures 7 to 9 shown. All 5 positive samples infected with influenza A (H1N1) virus and 9 positive samples infected with Mycoplasma pneumoniae were detected. Among the 5 co-infected samples, 1 sample was negative for influenza A (H1N1) virus detection, and the rest of the samples were detected as double positives. These results indicate the effectiveness of the 3-aminophenylboronic acid-functionalized magnetic beads and the detection method of the present invention in practical applications.

[0124] Example 4

[0125] In order to obtain the optimal enrichment conditions of APBA-MBs for pathogens, the amount of magnetic beads used and the incubation time were optimized. In this example, influenza A virus was used as the detection object. First, multiple throat swab dilutions containing equal concentrations of influenza virus were prepared. For the optimization of the amount of magnetic beads, 30 μg, 50 μg, 70 μg, 90 μg, and 110 μg of APBA-MBs were added successively to the equal dilutions. The lysed nucleic acids were generated according to the procedure shown in step (1) of Example 2 and analyzed using qPCR.

[0126] As Figure 10 shown in a of, as the amount of APBA-MB increased, the Ct value decreased, reached the maximum value at 70 μg, and then remained unchanged, indicating that in a 200 μL sample system, the addition amount of 70 μg of APBA-MB is the optimal concentration.

[0127] In addition, in order to ensure a relatively fast speed of pretreatment, the incubation time (3 min, 5 min, 7 min, 9 min, 11 min) was optimized. Similarly, multiple throat swab dilutions containing equal concentrations of influenza virus were prepared, and the experiment was carried out when the addition amount of APBA-MBs magnetic beads was 70 μg.

[0128] As Figure 10 shown in b of, the enrichment effect can be achieved only 3 min after adding magnetic beads to the sample solution. As the incubation time increased, the Ct value decreased slightly and reached equilibrium at 9 min. Therefore, 9 min was selected as the optimal incubation time.

[0129] Example 5

[0130] To verify the enrichment efficiency of APBA-MBs for pathogens in samples, inactivated pathogens were added as spiked samples to PBS, throat swab transport medium, and bronchoalveolar lavage fluid (BALF). The mixed spiked samples were divided into two 200 μL aliquots. One aliquot was directly extracted using a commercial nucleic acid extraction kit, and the extracted nucleic acid was quantified by fluorescence quantitative PCR. The copy number obtained was denoted as Q1. The other aliquot was magnetically enriched using APBA-MBs according to the specific steps in Example 2. Subsequently, the supernatant was removed and the pellet was resuspended in 200 μL of nuclease-free water. The extracted nucleic acid was also quantified by fluorescence quantitative PCR, and the copy number obtained was denoted as Q2. The copy number was calculated according to the standard curve provided by the kit. Finally, the enrichment efficiency (CE) was calculated according to the following formula: CE(%) = Q2 / Q1 × 100%.

[0131] Figure 11 The results showed that the capture efficiencies of APBA-MBs for influenza A virus in PBS, throat swab transport medium, and BALF were 96.5%, 97.8%, and 92.9%, respectively (see Figure 11 a) in Figure 11 . For Mycoplasma pneumoniae, the capture efficiency was slightly lower, being 91.1%, 93.0%, and 87.4% in PBS, throat swab transport medium, and BALF, respectively (see

[0132] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Application of 3-aminophenylboronic acid-functionalized magnetic beads in the following a and / or b: a. In the preparation of products for enriching influenza A virus and / or Mycoplasma pneumoniae; b. In the preparation of products for detecting influenza A virus and / or Mycoplasma pneumoniae; The preparation method of the 3-aminophenylboronic acid-functionalized magnetic beads comprises the following steps: Washing the carboxylated coated magnetic beads with MEST solution, resuspending the washed magnetic beads in the MEST solution containing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide for the first incubation activation, and resuspending the activated magnetic beads in the PBS solution containing 3-aminophenylisoboric acid for the second incubation reaction to obtain 3-aminophenylboronic acid-functionalized magnetic beads.

2. The application according to claim 1, characterized in that The time of the first incubation is 25-35 min; the time of the second incubation is 1.5-2.5 h.

3. The application according to claim 1, wherein The concentration of EDC in the MEST solution containing EDC and NHS is 8-12 mg / mL, and the concentration of NHS is 8-12 mg / mL; the concentration of 3-aminophenylisoboric acid in the PBS solution containing 3-aminophenylisoboric acid is 0.05-0.15 mg / mL.

4. A kit for detecting influenza A virus and / or Mycoplasma pneumoniae, characterized in that, Comprising the 3-aminophenylboronic acid-functionalized magnetic beads described in any one of claims 1-3.

5. The kit according to claim 4, characterized in that, The kit comprises a primer-probe set for detecting influenza A virus and / or Mycoplasma pneumoniae, and the primer-probe set is a primer-probe for detecting influenza A virus and a primer-probe for Mycoplasma pneumoniae; The primer-probe for detecting influenza A virus comprises HA-F1, HA-R1 and probe 1; The sequence of HA-F1 is as shown in SEQ ID NO.1; the sequence of HA-R1 is as shown in SEQ ID NO.2; the probe 1 is ATGTAACAGTAACACACTCTGTTAACCTT / i6FAMdT / / idSp / / iBHQ1dT / GAAGA CAAGCATAACG-C3 Space; The primer-probe for detecting Mycoplasma pneumoniae comprises MP-F2, MP-R2 and probe 2; The sequence of MP-F2 is as shown in SEQ ID NO.5; the sequence of MP-R2 is as shown in SEQ ID NO.6; the probe 2 is TGTTACTATGCGTGCAGCTAGCACCTTCTT / iHEXdT / / idSp / / iBHQ1dT / TGATG TTCAGCTAG-C3spacer.

6. The kit according to claim 5, characterized in that, The kit comprises an amplification reaction system; the amplification reaction system comprises 2 μL of 8-12 μM HA-F1, 2 μL of 8-12 μM HA-R1, 0.6 μL of 8-12 μM probe 1, 2 μL of 8-12 μM MP-F2, 2 μL of 8-12 μM MP-R2, 0.6 μL of 8-12 μM probe 2, 2.5 μL of 280 nM magnesium acetate and 10 μL of template.

7. A method for detecting influenza A virus and / or Mycoplasma pneumoniae, characterized in that, The method is for non-diagnostic purposes and comprises the following steps: Incubate the 3-aminophenylboronic acid-functionalized magnetic beads in the kit according to any one of claims 4 to 6 with the sample to be tested to obtain an incubated mixture, perform magnetic separation on the incubated mixture, discard the supernatant to obtain a magnetically separated complex, and heat the magnetically separated complex to obtain a lysed product.

8. The method according to claim 7, wherein It further includes the following steps: After obtaining the lysed product, perform an amplification reaction on the lysed product in the amplification reaction system using the primer-probe set described in claim 5.

9. The method according to claim 7, characterized in that, The dosage of the 3-aminophenylboronic acid-functionalized magnetic beads is greater than 30 μg; the incubation time is 3 to 9 minutes.

10. The method according to claim 7, wherein The heating method is heating at 95 to 100 °C for 3 to 7 minutes.

Images