DsRNA for killing termites and method for controlling termites by combining dsRNA with metarhizium anisopliae

By inhibiting the expression of termite Gr14 gene, dsGr14 double-stranded RNA combined with cystellae, the environmental pollution problem caused by chemical control of termites is solved, and efficient and environmentally friendly termite control effects are achieved.

CN120290574AActive Publication Date: 2025-07-11INST OF ZOOLOGY GUANGDONG ACAD OF SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510478571.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-07-11
Estimated Expiration
2045-04-16

AI Technical Summary

Technical Problem

Existing chemical control methods for termites cause environmental pollution and are harmful to beneficial biological hazards, making it difficult to effectively control termite hazards.

Method used

The dsGr14 double-stranded RNA sequence was used to inhibit termite Gr14 gene expression, and the use of cystoscara lemoniae was used for prevention and treatment, and the feeding method and spraying were combined.

Benefits of technology

The mortality rate of termites has been significantly improved, especially after the combined use of dsGr14 and chlorophyllium, the mortality rate of termites can reach 75%, providing an efficient and environmentally friendly prevention and control plan.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290574A_ABST
    Figure CN120290574A_ABST
Patent Text Reader

Abstract

The invention discloses dsRNA for killing termites and a method for controlling the termites by combining the dsRNA with metarhizium anisopliae. The nucleotide sequence of the dsR NA of the termites is as shown in SEQ ID NO. 2. The expression of the termite taste receptor 14 gene (Gr14 gene) is inhibited by using an RNAi method, so that the death rate of termites can be obviously increased. After the expression of the Gr14 gene is inhibited by an RNAi method, the Gr14 gene is sprayed to the termites, and the death rate of the termites can be about 75%, so that the method can be used as a method for effectively preventing and controlling the termites.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of termite control, and specifically relates to a dsGr14 for killing termites and a method for controlling termites by combining it with Metarhizium anisopliae. Background Art

[0002] Termites are one of the world's five major pests, and most regions of the world are affected by termites. According to statistics, the affected area of termites in China is close to 40% of the total national area, and the economic losses caused by the damage of termites to housing construction in China alone reach as high as 2.5 billion yuan every year. At present, chemical control methods are mainly used to control termites, but this not only easily causes environmental pollution but also easily harms other beneficial organisms.

[0003] The gustatory receptor Gr is a receptor protein present on the surface of gustatory receptor cells. When these receptor proteins bind to corresponding gustatory molecules, excitatory impulses are generated, enabling organisms to perceive different tastes. Gustatory receptor 14 (Gr14) is one of the gustatory receptor genes of termites. Metarhizium anisopliae is a type of fungus widely present in nature, which can infect insects and is pathogenic to insects. Summary of the Invention

[0004] The first object of the present invention is to provide dsGr14 for killing termites.

[0005] The dsGr14 for killing termites is a double-stranded RNA sequence targeting the termite Gr14 gene and inhibiting its expression, and the termite Gr14 gene is as shown by the 289th base to the 1716th base of SEQ ID NO.1.

[0006] The nucleotide sequence of the dsGr14 for killing termites is: AAAACCGCATCAGAGATGTACGTAGTATAAA CCACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGTGATGAGTTTCTTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTTGAGGTTCAGCTGGTGTTCTTGGCGGGTTGGTTACTGCGTTGTCATGATGACCGGAATGATGGCCGGGTTTGGGTTTACCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTCATGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGT。

[0007] The second object of the present invention is to provide the application of the above-mentioned dsGr14 for killing termites in the prevention and control of termites.

[0008] Preferably, it is the application of the above-mentioned dsGr14 for killing termites in combination with Metarhizium anisopliae in the prevention and control of termites.

[0009] The third object of the present invention is to provide a medicament for preventing and controlling termites, which contains the above-mentioned dsGr14 for killing termites as an active ingredient.

[0010] Preferably, it further contains Metarhizium anisopliae.

[0011] More preferably, the Metarhizium anisopliae is Metarhizium anisopliae var. anisopliae.

[0012] The fourth object of the present invention is to provide a method for preventing and controlling termites, which is to feed the above-mentioned dsGr14 for killing termites to termites to make them feed, so as to prevent and control termites.

[0013] Preferably, it can be added to termite food or attractant.

[0014] Preferably, it is to feed the above-mentioned dsGr14 for killing termites to termites to make them feed, and then spray Metarhizium anisopliae on the termites to prevent and control termites.

[0015] The present invention uses the feeding method of RNAi technology to feed termites with double-stranded RNA sequences (dsGr14) of the Gr14 gene to inhibit the gene expression of Gr14, and then observes the survival rate of termites. In addition, after feeding termites with dsGr14, Metarhizium anisopliae is sprayed on the termites to observe the survival rate of termites. Through these two methods, it is confirmed that the combined use of dsGr14 and Metarhizium anisopliae can effectively control termites.

[0016] The present invention can effectively increase the mortality rate of termites by feeding termites with dsGr14 and spraying Metarhizium anisopliae on termites after feeding them with dsGr14. Moreover, the latter causes a higher mortality rate, which can be used as a method for controlling termites.

[0017] Inhibiting the expression of the gustatory receptor 14 gene (Gr14 gene) in termites by the RNAi method can significantly increase the mortality rate of termites. After inhibiting the expression of the Gr14 gene by the RNAi method and then spraying on termites, a termite mortality rate of about 75% can be achieved. Therefore, it can be used as an effective method for controlling termites. Brief Description of the Drawings

[0018] Figure 1 It is a diagram showing the effect of feeding termites with dsGr14 on the survival rate of termites;

[0019] Figure 2 It is a diagram showing the effect of simultaneously feeding termites with dsGr14 and Gram-negative bacteria on the survival rate of termites. Detailed Embodiments

[0020] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0021] Example 1:

[0022] 1. Implementation method:

[0023] The nucleotide sequence of the gustatory receptor gene (Gr14 gene) of termites is shown as the 289th base to the 1716th base of SEQ ID NO.1 (underlined part).

[0024] SEQ ID NO.1

[0025] AATGGTAGTCCATAATTTATAATTGAATTGAAATAGAAGTAGTAAACTATTTTCAAAGTATT

[0026] TAGAGACATGTATGGTTTAATAGACCTCATTATGTAGCAAACTGCGCTCAGTTTCGGACTA

[0027] ATATGTTCAACATGGCATTTCCAGTTTATTGTATCATTGATGTATATTCCAAGAAACTTAATA

[0028] TTGGATATGGTTGTGATTTGTTTATTGTCATAAGCAATCTTGATATTAGTTACTGGTTTGTTT

[0029] TTAGTTGTATACTGGATAAAATGTGTTTTATTAAAATTG ATGGAAAGTAAGTTTCCTACTTA

[0030] TGAGCATCTTCACCGCTCACAAATTTTTACTTTTTCTGGAAATCCCACTGAAGGAGCTGTT

[0031] GAAGAGTCTGAACGGATGTCTGTGGTTTCTCTGAAATATCTTACTCCGACTCCCACAGTA

[0032] AAGGCAAATGTCATAAAGCTGTACACCAAAAACCGCATCAGAGATGTACGTAGTATAAAC

[0033] CACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGTGATGAGTTTCTTTATGTTAATAGCA

[0034] CAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTTGAG

[0035] GTTCAGCTGGTGTTCTTGGCGGGTTGGTTACTGCGTTGTCATGATGACCGGAATGATGGC

[0036] CGGGTTTGGGTTTACCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCG

[0037] ACTGTCATGCTTTATAGTCTTGGCTTTTCATGTTGCGCCTGCTTCATGAACCTGGCTCGAC

[0038] ACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGTGAAATACGGA

[0039] TATCCAAAGAAACTTCACCTCAACATTAAAATTATATCTGCTGTAACGCTAGCAATAGCAC

[0040] TGGGAGAACATTTACTAAAGAAGTACACACATTTGTCTGTGGCTGCTCTGTGTGCAGAGA

[0041] ACAAGGTAGAACTCTTGAAGCTGTACTACCTCATGCATTACCGCTACGTATTTGAGTTCGT

[0042] CAAATTTTCACCGCCTGTAGCGTGTTTTTGTGAAATTGTGAATTTCTTTGCTGCATTCTATT

[0043] GGAACTTCGTGGACCTGTTTGTAATCGTCCTTAGCATGGCAATGGCAAGCCGTTTTCGGC

[0044] TGCTAAACAGCCATCTGAAACTGGAAAGAGGGAAGTTTAAGCCGGAAGAATTCTGGAGA

[0045] GAGACTCGAGTGAATTACAACAGCCTCTCGTCTCTGACGAAGTTCCTCGACTCCTGTATT

[0046] TCAAGCATTGTCCTCATATCATTCGCTACGAACATGTTCTACATCTGTCAACAACTCTATAA

[0047] TATCCTCAGAAAATCCGTCGCCACTGTGAAAGTGGTTTACTTCTTCGTCTCGTTTAGCTAC

[0048] TTGCTGTTCAGAACAATTGCTGTATCCCTGTGTGGAGCGAGCATACACGACGAAAGCCGA

[0049] GCTACAAAGAATTTCTTGTACGCTGTGCCTACACAGAGCTACAAAATCGAAGTACACCGA

[0050] TTCATTGTTCAGCTTTCTACAGATTCGGTTGCCCTTACCGGATTTAATTTCTTCACCGTTAA

[0051] CAGGACATTGCTACTTACGCTGGGTGGGACGGTTGTAACATACGTGGTGGTGATGGTGCA

[0052] ATTCAGCAACCCTTCAGCAAGTCAATCAAGCAATGACACGCAATTGTGCCTGAATATTTCT

[0053] CAGATGTTACAATAA AACTGGTACGTTAGGTGGTATTAACTTACAGCAGAAACAAAGGAA

[0054] AGATGGTAATGTTAGAAAAGATGTTCAATTCCACACTATTTTGACTTTCCTTTTACACTCAA

[0055] TACATGAACTACATTATTTTGTAAACTATATGGAAGTTCATTATTAATTTAAAATATGCCCAA

[0056] CAGACGAAACAAAAAAAAAA

[0057] According to the obtained sequence information of the Gr14 gene, specific double-stranded RNA primers (Gr14-dsRNA-F, Gr14-dsRNA-R, T7-Gr14-dsRNA-F and T7-Gr14-dsRNA-R, see Table 1) were designed and synthesized according to the instructions of the kit (T7RiboMAXTM Express RNAi System, Promega, catalog number P1700) to obtain double-stranded RNA (dsGr14) of Gr14.

[0058] The nucleotide sequence of the double-stranded RNA (dsGr14) is shown in SEQ ID NO.2:

[0059] SEQ ID NO.2

[0060] AAAACCGCATCAGAGATGTACGTAGTATAAACCACAAGAAAGAAGATAAAAATTCTCTG

[0061] CGCAGAGTGATGAGTTTCTTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGA

[0062] GGAATCACTGGCCTGACCGCTCAGCATTTGAGGTTCAGCTGGTGTTCTTGGCGGGTTGGT

[0063] TACTGCGTTGTCATGATGACCGGAATGATGGCCGGGTTTGGGTTTACCATTGCCTTTTACA

[0064] TGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTC

[0065] ATGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGT。

[0066] Forty worker termites of Coptotermes formosanus with the same body size were placed in a petri dish with a diameter of 3 cm, and a square filter paper with a side length of 1 cm was placed in it for the termites to feed on. 40 μL of dsGr14 was added dropwise to the filter paper as the experimental group, and the dosage of dsGr14 was 2 μg / cm 2 , and then the mortality of the termites was observed within ten days. In the control group, an equal volume of water was added dropwise. Three replicates were designed for both the experimental group and the control group.

[0067] In addition, two days after adding 2 μg / cm 2 of dsGr14 to the filter paper, 100 μL of Metarhizium anisopliae (3.0×107 CFU / mL, Guangdong Microbial Culture Collection Center (GDMCC), with the preservation number of GDMCC No. 3.528) was sprayed onto the body surface of the termites, and then the mortality of the termites was observed within ten days. In the control group, ddH2O was added dropwise to the filter paper, and 100 μL of Tween solution or Metarhizium anisopliae solution (3.0×107 CFU / mL) was sprayed onto the body surface of the termites. Three replicates were designed for both the experimental group and the control group.

[0068]

[0069] Results of implementation:

[0070] Through statistical analysis of the mortality data of termites after feeding on dsGr14, it was found that within the ten days of statistics, no worker termites died in the control group (fed with water), while 22.5% of the worker termites died in the treatment group (fed with dsGr14). This shows that feeding dsGr14 to termites has a significant impact on the survival rate of termites and can significantly increase the mortality of termites (as Figure 1 ). The specific impacts are as follows:

[0071] In the control group where termites were fed with water, no termites died; within ten days of feeding with dsGr14 at a concentration of 2 μg / cm 2 , 9 termites died, and the mortality rate was 22.5%, which was significantly higher than that of the control group.

[0072] Statistical analysis of the mortality data of termites fed with dsGr14 and sprayed with Metarhizium anisopliae showed that within the ten days of statistics, only a few worker ants died in the control group fed with water and sprayed with Tween, about 1 / 3 of the worker ants died in the control group fed with water and sprayed with Metarhizium anisopliae, while more than half of the worker ants died in the treatment group (fed with dsGr14 and sprayed with Metarhizium anisopliae). This indicates that spraying Metarhizium anisopliae after feeding termites with dsGr14 has a very significant impact on the survival rate of termites (such as Figure 2 ), and can significantly increase the mortality rate of termites. The specific impacts are as follows:

[0073] In the control group of termites fed with water and sprayed with Tween, only 1 termite died within ten days, and the mortality rate was about 2.5%. In the control group of termites fed with water and sprayed with Metarhizium anisopliae, only 13 termites died within ten days, and the mortality rate was about 32.5%. After feeding termites with dsGr14 and spraying Metarhizium anisopliae for ten days, 30 termites died, and the mortality rate was 75%, which was significantly higher than that of the two control groups ( Figure 2 ).

[0074] Conclusion:

[0075] The above implementation results show that RNAi feeding to inhibit the expression of the Gr14 gene in termites by the feeding method can significantly increase the mortality rate of termites, and spraying Metarhizium anisopliae on termites while feeding them with dsGr14 can obtain a higher mortality rate. Therefore, termites can be controlled by the combined use of dsGr14 and Metarhizium anisopliae.

Claims

1. Termite gustatory receptor gene, characterized in that, The nucleotide sequence is shown as the 289th base to the 1716th base of SEQ ID NO.

1.

2. A dsGr14 for killing termites, characterized in that, The nucleotide sequence is: AAAACCGCATCAGAGATGTACGTAGTATAAACCACAAGAAAGAAGATAAAAATTCTCTGCGCAGAGTGATGAGTTTCTTTATGTTAATAGCACAGTGCTTCGGCCTGTGCCCGGTGGGAGGAATCACTGGCCTGACCGCTCAGCATTTGAGGTTCAGCTGGTGTTCTTGGCGGGTTGGTTACTGCGTTGTCATGATGACCGGAATGATGGCCGGGTTTGGGTTTACCATTGCCTTTTACATGAAAGGCTTCTTTAGTTTTGAAACGTCTTCGACTGTCATGCTTTATAGTCTTGGCTTTTCATGTTGCGCCTGCTTCATGAACCTGGCTCGACACTGGCCTCGTCTTGAGGAGCTGTGGCAAAGAACTGAACACGAACAAGT.

3. Use of the termite-killing dsGr14 as claimed in claim 2 in the control of termites.

4. The application according to claim 3, characterized in that It is the use of the termite-killing dsGr14 in combination with Metarhizium anisopliae in the control of termites.

5. An agent for preventing and controlling termites, characterized in that, Contains the termite-killing dsGr14 as claimed in claim 2 as the active ingredient.

6. The termite control agent according to claim 5, characterized in that, It also contains Metarhizium anisopliae.

7. The termiticide according to claim 5, characterized in that, The Metarhizium anisopliae mentioned is Metarhizium anisopliae var. anisopliae.

8. A method for controlling termites, characterized in that, Feed the termite-killing dsGr14 as claimed in claim 2 to termites to allow them to feed, and control the termites.

9. The method according to claim 8, wherein It is to add the termite-killing dsGr14 to termite food or attractant.

10. The method according to claim 8, wherein It is to feed the termite-killing dsGr14 to termites to allow them to feed, and then spray Metarhizium anisopliae on the termites to control the termites.

Citation Information

Patent Citations

  • IDH gene dsRNA capable of improving termite control effect of metarhizium anisopliae

    CN111849984A

  • Reticulitermes chinensis Snyder SeBP gene and application of combination of dsRNA of Reticulitermes chinensis Snyder SeBP gene and metarhizium anisopliae in termite control

    CN113122546A

  • Application of SOD siRNA in combination with metarhizium anisopliae, beauveria bassiana or paecilomyces varioti in termite control

    CN116254280A

  • MiRNA for killing termites and method for controlling termites by combining miRNA with metarhizium anisopliae

    CN118006611A

  • Use of RNA interference to validate new termiticide target sites and a method of termite control

    US7968525B1