Gene mutant related to growth retardation and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a gene mutant related to growth retardation and application thereof. The invention provides a TRIO gene mutant related to growth and development retardation, and compared with a wild type TRIO gene, the TRIO gene mutant has c.7043delA mutation; and the login number of the wild type TRIO gene is NM007118.4. The invention also discloses a method for preparing the TRIO gene. The invention provides a new mutant gene for the existing gene field, and further researches the application of the mutant gene. The relationship between the mutation and the growth retardation is determined, a new scheme is provided for diagnosis and treatment of the growth retardation, and particularly, a diagnosis and treatment means is provided for the growth retardation.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to gene mutants related to growth retardation and applications thereof. Background Art

[0002] Growth and development are basic physiological characteristics of human beings, including the development of body morphology and organ function, which are mainly manifested in bone growth, psychomotor development and sexual development. The whole growth process is affected by genetic genes, endocrine, nutrition, diseases and living environment. Therefore, growth and development is a mirror reflecting human health, and growth and development monitoring is the most basic work content in child health care. With the substantial decline in infectious diseases and common nutritional diseases in children, various endocrine diseases, genetic and metabolic diseases, birth defects, low birth weight and allergic diseases have gradually become common causes affecting the normal growth and development of children. Faced with changes in the disease spectrum, child health doctors need to improve their understanding of growth and development retardation-related diseases in child health care practice in order to achieve early detection, early diagnosis or referral, effective intervention and scientific management.

[0003] Growth and development is a complex biological process based on the regulation of gene expression and cell division and proliferation. The development and differentiation of the human body is the result of the genetic information carried by the DNA molecules in the cells interacting with the environment in accordance with precise time and space programs and gradually expressing. When the genetic information changes the expression program and errors occur, it will lead to abnormal structures and functions of certain organs of the human body, causing diseases and even death.

[0004] There are more than 6,500 known genetic diseases, which are divided into single-gene genetic diseases, multi-gene genetic diseases, chromosomal diseases, mitochondrial genetic diseases, somatic genetic diseases and epigenetic diseases. Most genetic diseases develop in infancy and childhood, and therefore usually manifest as growth retardation, such as poor weight gain or rapid growth, growth retardation / short stature or rapid growth / tall stature, small or large head circumference, mental retardation and mental retardation, motor development disorders, abnormal body proportions, skeletal deformities and abnormal sexual development. With the rapid development of molecular genetics and molecular biology, new detection technologies continue to emerge and are used to explore the causes and pathogenesis of many difficult diseases, opening up new ways for the early detection, diagnosis and effective prevention and treatment of more and more genetic diseases, and providing a theoretical and practical scientific basis for the development of eugenics. Summary of the invention

[0005] In order to overcome the above-mentioned shortcomings and deficiencies of the prior art, the primary purpose of the present invention is to provide a gene mutant related to growth retardation. The gene mutant is specifically a mutation on the TRIO gene.

[0006] This application conducted an in-depth study on patients with growth retardation through a high-throughput whole-exome sequencing combined with Sanger verification of candidate mutation sites, and discovered a new type of mutation in the TRIO gene on chromosome 5. The candidate gene locus information is as follows: TRIO, chromosome position chr5:14487780, transcript NM_007118.4, exon Exon48, nucleotide and protein c.7043delA:p.H2348Pfs*65. Abbreviation: TRIO:NM_007118.4:Exon48 / 57(CDS):c.7043delA:p.H2348Pfs*65; 5:14487780(A / -).

[0007] Another object of the present invention is to provide the application of the gene mutation related to the above growth retardation.

[0008] The object of the present invention is achieved through the following scheme:

[0009] A TRIO gene mutant related to growth retardation. Compared with the wild-type TRIO gene, the TRIO gene mutant has a c.7043delA mutation; the accession number of the wild-type TRIO gene is NM_007118.4. Specifically, compared with the wild-type TRIO gene, the TRIO gene mutant has the following mutation: deletion of the base at position c.7043 of NM_007118.4. That is, compared with the wild-type TRIO gene, the base at position c.7043 of the NM_007118.4 of the TRIO gene of the present invention has a mutation, and the base A is deleted.

[0010] Furthermore, the present invention proposes a nucleic acid encoding a TRIO gene mutant for screening or diagnosing growth retardation. Compared with the wild-type TRIO gene, its sequence has a c.7043delA mutation; the accession number of the wild-type TRIO gene is NM_007118.4.

[0011] Furthermore, the type of the nucleic acid includes DNA, RNA or cDNA, and the type of the nucleic acid is not specifically limited. As long as it has a specific mutation compared with the wild-type TRIO gene, it should be recognized as a nucleic acid within this scope.

[0012] The present invention also provides a TRIO gene mutant protein related to growth retardation, wherein the TRIO gene mutant protein has a mutation of p.H2348Pfs*65. That is, compared with the protein encoded by the wild-type TRIO gene, the 2348th amino acid of the TRIO gene mutant protein is mutated from the wild-type histidine (His) to proline (Pro), which results in the 64th amino acid becoming a stop codon subsequently, and its length is shortened from 3097 amino acids to 2411 amino acids.

[0013] The present invention also provides a reagent for detecting the TRIO gene mutant or the pathogenic gene described in the above technical solution.

[0014] Furthermore, the reagent includes a primer pair having a nucleotide sequence as shown in SEQ ID NO: 1-2.

[0015] The present invention also provides the application of the TRIO gene mutant, the TRIO gene mutant protein described in the above technical solution as a target, or the reagent described in the above technical solution in the preparation of a reagent or kit for diagnosing, assisting in diagnosing, or screening for growth retardation.

[0016] Screening for growth retardation is mainly for screening the risk of disease, facilitating early intervention; diagnosis is for assisting in diagnosing people who have already suffered from the disease. Of course, whether a person has the disease is based on the actual changes in the patient's body and corresponding standard specifications, without being intervened by people's subjective cognition.

[0017] The reagent for diagnosing, assisting in diagnosing, or screening for growth retardation includes at least one of an antibody, a probe, a primer, and a mass spectrometry detection reagent that specifically targets the nucleic acid. Specifically, it includes a product for specifically detecting nucleic acid, and the product can be at least any one of an antibody, a probe, a primer, and a mass spectrometry detection reagent, and can also be other reagents with similar functions. In addition, the form of the kit can be some kits similar to existing products, and the device can be some sequence detection devices. Either the primer or the probe can be selected, or they can be used in combination according to needs.

[0018] More specifically, the primer includes at least a primer pair having a nucleotide sequence as shown in SEQ ID NO: 1-2.

[0019] The present invention also provides a kit for screening biological samples for growth retardation, which contains a reagent capable of detecting a TRIO gene mutant.

[0020] Compared with the wild-type TRIO gene, the TRIO gene mutant has a c.7043delA mutation; the accession number of the wild-type TRIO gene is NM_007118.4.

[0021] In this case, as long as the corresponding product is applied to a reagent capable of detecting the aforementioned TRIO gene mutant, it shall be regarded as applying the technology of the present invention.

[0022] The reagent includes a nucleic acid probe or primer. The primer at least includes a primer pair having the nucleotide sequences shown in SEQ ID NO: 1-2.

[0023] The kit should also be interpreted broadly and also includes some test strips, devices, etc.

[0024] The present invention also provides the use of a reagent for specifically modifying nucleic acid in the preparation of a drug for treating growth retardation; wherein, the nucleic acid has a c.7043delA mutation compared with the wild-type TRIO gene; the accession number of the wild-type TRIO gene is NM_007118.4.

[0025] The present invention also provides a construct. The construct includes at least one of the aforementioned TRIO gene mutant, the TRIO gene mutant protein as a target, and the reagent.

[0026] It should be noted that the nucleic acid sequence has a c.7043delA mutation compared with the wild-type TRIO gene; the accession number of the wild-type TRIO gene is NM_007118.4. The construct can also be used as a test model for the drug effect during the pharmaceutical process. Thus, the recombinant cell obtained by transforming a recipient cell with the construct of the present invention can be effectively used as a model for research related to growth retardation.

[0027] Regarding the nucleic acid described in the present invention, those skilled in the art should understand that it actually includes any one or both of the complementary double strands. For convenience, in the present invention, although only one strand is given in most cases, the other complementary strand is actually also disclosed.

[0028] The present invention also provides the use of a biological model in screening drugs, wherein the biological model carries at least one of the aforementioned TRIO gene mutant, the TRIO gene mutant protein as a target, and the reagent.

[0029] One form of the biological model described above is a cell model. One application of this cell model is to conduct large-scale drug screening. By exposing the cell model to a drug, it can be verified whether the drug has the effect of inhibiting the corresponding mutation, and further, it can be verified whether the drug can treat the corresponding disease by inhibiting the mutation. For example, through this cell model, a disease environment of growth retardation can be simulated, and then the effects of some drugs can be verified in vitro through this model. In this article, the main screening factor considered is the corresponding mutation, and the specific treatment target of the drug is not specifically limited for the time being. This application method is mainly used in the process of drug research and development. Among them, the drug is a drug for treating growth retardation; the limitation is mainly caused by the aforementioned mutation. Thus, through this biological model, some substances with unknown effects can be screened, facilitating further research on whether the substance has the expectation of being used to treat growth retardation.

[0030] The present invention has the following advantages and beneficial effects compared with the prior art:

[0031] The present invention provides a gene mutant for diagnosing growth retardation, provides a new mutant gene for the existing gene field, and further studies the application of this mutant gene. The connection between the mutation involved in the present invention and growth retardation is determined, and based on this, a new solution for the diagnosis and treatment of growth retardation is provided, especially providing means for the diagnosis and treatment of growth retardation. Brief Description of the Drawings

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention, and thus should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other relevant drawings can also be obtained based on these drawings.

[0033] Figure 1 It is a pedigree map of patients with growth retardation;

[0034] Figures 2 - 6 It is a Sanger sequencing result diagram of the base mutation site at NM_007118.4: Exon48 / 57(CDS): c.7043delA:p.H2348Pfs*65 of the TRIO gene of family members.

[0035] Figure 7 It is the result of the conservation analysis of the TRIO gene of 8 animals. Detailed Embodiments

[0036] The present invention will be further described in detail below in conjunction with embodiments, but the embodiments of the present invention are not limited thereto. The materials involved in the following embodiments can be obtained from commercial channels without special instructions. The methods are conventional methods without special instructions.

[0037] Example 1: Determination of the pathogenic gene and mutation site of growth retardation

[0038] 1. Sample collection

[0039] A three-generation pedigree of a patient with growth retardation was collected, and its pedigree chart is as Figure 1 shown, where □ represents a normal male, ○ represents a normal female, ■ represents a male patient, and ● represents a female patient; Ⅰ represents the first generation, Ⅱ represents the second generation, and Ⅲ represents the third generation; Ⅰ-1 and Ⅰ-2 respectively represent the first-generation family members, Ⅱ-1 and Ⅱ-2 respectively represent the second-generation family members, and Ⅲ-1 represents the third-generation family member; among them, Ⅰ-1 and Ⅱ-1 were found through developmental evaluation to be short in stature, have low intelligence, and poor language expression ability, and were suspected of having growth retardation. Ⅲ-1 represents a 7-year-old female child with several months of overall developmental delay and growth retardation; the remaining members are normal.

[0040] DNA extraction:

[0041] In this example, peripheral blood of five members of the growth retardation pedigree was collected, and DNA was extracted from the peripheral blood of the five samples respectively. The magnetic bead method blood DNA rapid extraction kit was used to extract the sample DNA, and NanoDrop was used to measure the concentration and purity of the extracted DNA. In terms of purity, the OD260 / OD280 ratio is required to be between 1.8 and 2.0, and the OD260 / OD230 ratio is between 1.8 and 2.2. If it exceeds the above range, it is considered that the purity of the extracted DNA does not meet the requirements and needs to be re-extracted or re-purified; in terms of concentration, it is necessary to ensure that it is higher than 25 ng / μL and the total amount is not less than 2000 ng, that is, it can meet the needs of subsequent research. The extracted DNA samples were routinely stored at -20 °C for standby and stored at -80 °C for long-term preservation.

[0042] 2. Whole exome library construction, capture and sequencing

[0043] The extracted DNA was used to prepare a genomic DNA sample library using a gene sequencing library construction kit (random endonuclease method), and then adapters were added (specific name: VAHTS DNA Adapters Set 8 for MGl, batch number: 7E0460H4, manufacturer: Nanjing Novoprotein Biological Technology Co., Ltd.), followed by pre-capture LM-PCR amplification. A pre-capture LM-PCR system was configured with the adapter-added DNA fragment sample for amplification (the reaction system included 25 µL of 2 × KAPA HiFi Hot Start ReadyMix, 2.5 µL of Pre-LM-PCR Oligos 1 and 2 with a concentration of 5 µM, and 20 µL of the adapter-added DNA fragment sample; the reaction conditions were 98 °C for 45 seconds; 98 °C for 15 seconds, 60 °C for 30 seconds, 72 °C for 30 seconds, for a total of 9 cycles; 72 °C for 1 minute). After amplification, the pre-capture LM-PCR library product was obtained. Four to twelve library samples to be sequenced were mixed and hybrid enrichment was performed using a whole exome capture probe (Naangda-IDT2.0-20357-209803-20240827.amcare from Nuoannda). The product after hybrid enrichment was used as a template for post-capture LM-PCR amplification (the reaction system included 25 µL of KAPA HiFi Hot Start Ready Mix, 2.5 µL of Post-capture LM-PCR Oligos 1 and 2 with a concentration of 5 µM, and 20 µL of the bead-captured DNA sample; the reaction conditions were 98 °C for 45 seconds; 98 °C for 15 seconds, 60 °C for 30 seconds, 72 °C for 30 seconds, for a total of 14 cycles; 72 °C for 1 minute). After the amplified library passed the quality inspection, 2*150bp read length sequencing was performed using the MGISEQ-2000 sequencing platform to obtain the raw sequencing data.

[0044] 3. Library Alignment, Variant Detection and Annotation

[0045] After obtaining the raw sequencing data, quality control was first performed on the data to remove adapter sequences, low-quality sequences, and N bases. The remaining sequences were aligned to the UCSC human reference genome hg19 using BWA (Burrows Wheeler Aligner), and GATK (Genome Analysis ToolKit) was used to identify and analyze variants in the aligned sequences. The identified variants were annotated with databases such as gnomAD, ClinVar, VarCard, HGMD, PubMed, etc., filtering out known sites with an allele population frequency higher than 0.005 in the database or those already annotated as benign variants, etc. Then, the remaining non-synonymous mutations, splice acceptor / donor site mutations, and coding region insertion and deletion mutations, which are the three types of mutations most likely to be related to diseases, were analyzed.

[0046] Data analysis was performed on the filtered mutations, and it was found that the patient had a mutation of NM_007118.4:Exon48 / 57(CDS):c.7043delA:p.H2348Pfs*65 in the TRIO gene on chromosome 5.

[0047] Analysis of very strong evidence of pathogenicity (PVS1) (https: / / autopvs1.bgi.com / ) was performed on this frameshift mutation. The evaluation result of PVS1 was Very Strong, predicting that it might lead to the premature appearance of a stop codon in protein synthesis. It was predicted to cause nonsense-mediated mRNA decay (NMD), and the exon where this variation was located appeared on a biologically relevant transcript. At the same time, the association between the gene and the disease was Definitive, and the haploinsufficiency score was 3 points. Therefore, this very strong pathogenicity level evidence could be used.

[0048] This variation has not been reported in the existing population database and public literature. According to its population frequency, sequence information, PVS1 algorithm prediction, and the patient's clinical symptoms, referring to the genetic variant classification criteria and guidelines of the American College of Medical Genetics and Genomics (ACMG), the rating of this variation indicates that the mutation of NM_007118.4:Exon48 / 57(CDS):c.7043delA:p.H2348Pfs*65 in the TRIO gene is the pathogenic mutation site of this child with growth retardation. That is, a new gene mutation site related to growth retardation was identified. According to the sequencing results, compared with the wild-type TRIO gene, a base at position 7043 was deleted, and the base of the wild-type TRIO gene was A. This deletion led to a frameshift mutation, causing the 2348th amino acid of the encoded polypeptide to mutate from the wild-type histidine (His) to proline (Pro), and at the same time, because of this frameshift mutation, a stop codon appeared prematurely.

[0049] Meanwhile, the present invention analyzed the conservation of this locus of the TRIO gene. High conservation of a gene or locus indicates that its changes in different species are very small, generally predicting that it has important functions or plays an important role in the growth and development of individuals. Its mutation is very likely to cause abnormalities in individuals, and this locus will not spread within the population. In this case, the TRIO genes of 8 animals were selected for analysis, including Rhesus, Mouse, Dog, Elephant, Chicken, X_tropicalis, Zebrafish, and Human. The amino acid sequences of the TRIO of these 8 animals were downloaded from the NCBI database and aligned using UCSC (https: / / genome.ucsc.edu / ). The results showed that this locus was N (representing ambiguous bases) in Rhesus and valine (Val, abbreviated as V) in Zebrafish, respectively, and histidine (His) in the other 6 animals, indicating that this locus is highly conserved ( Figure 7 ). These data indicate that the mutation of the TRIO gene transcript NM_007118.4:Exon48 / 57(CDS): c.7043delA: p.H2348Pfs*65 is very likely the pathogenic locus of patients with growth retardation.

[0050] Example 2: Verification by Sanger sequencing

[0051] In this example, Sanger sequencing was used to verify the obtained gene mutations. Specifically, for the candidate mutation site NM_007118.4:Exon48 / 57(CDS):c.7043delA:p.H2348Pfs*65 of the TRIO gene, primers were designed, and then the TRIO genes of the first-generation family members I-1, I-2, the second-generation family members II-1 and II-2, and the third-generation family member III-1 in the growth retardation family were detected by PCR amplification, product purification, and Sanger sequencing; according to the sequence determination results, it was judged whether it was a mutant type or a wild type, and combined with their own disease conditions, the correlation between the mutation of the TRIO gene transcript NM_007118.4:Exon48 / 57(CDS):c.7043delA:p.H2348Pfs*65 and the growth retardation disease was verified.

[0052] The specific method steps are as follows:

[0053] 1. DNA extraction: According to the method of extracting DNA in Example 1, genomic DNA in the peripheral blood of the target object was extracted for detection.

[0054] 2. Primer Design and PCR Reaction

[0055] Referring to the human genome sequence database hg19 / GRCh37, specific primers for exon 48 of the TRIO gene were designed, and the length of the amplified region was 559 bp. The details are shown in the following table. These primer pairs were used to perform PCR amplification on the genomic DNA of the target subjects respectively.

[0056] Primer sequences:

[0057]

[0058] The following is the PCR amplification system:

[0059]

[0060] The following is the PCR amplification program:

[0061]

[0062] The sequences of the amplified products are as follows:

[0063] >chr5:14487589+14488147

[0064] CGAGTACCAGAGGAACCACAgcgggggcggcggcggcggcggcagcgggg

[0065] gcagcggcgggggtgggggcagcggcggcggcggggcccccagtggcggc

[0066] agcggccacagtggcggccccagcagctgcggcggcgcccccagcacgag

[0067] caggagccggccctcccggatcccccagcctgtccgacaccacccccccg

[0068] tgctggtctcctctgcagcctcgagccaggcagaggcagacaagatgtca

[0069] ggtacgtccacccccgggccctccctgcctccccctggcgcggcccccga

[0070] ggccggccccagcgcgcccagcaggcggccccccggcgcggacgccgagg

[0071] ggtccgagcgagaagcggagccgatccccaagatgaaggtgctggagagc

[0072] cccaggaaaggcgccgcgaacgcctcggggtcgagcccagacgcccccgc

[0073] caaggacgcgcgcgctagcctgggcaccctgccgcttgggaagccccggg

[0074] ccggggccgcttcgccgctgaactcgccgctctccagcgcGGTCCCTTCT

[0075] CTCGGCAAG

[0076] 3. Sanger Sequencing

[0077] The PCR amplification products obtained in step 2 were subjected to Sanger sequencing to clarify the carriage of candidate sites of the TRIO gene in family members in the family. The Sanger sequencing results showed that at the position of NM_007118.4 c.7043delA(p.H2348Pfs*65) of the TRIO gene in I-1, II-1, and III-1, one A base was deleted (the region indicated by the arrow). As Figures 2 - 4 , it was a mutant type. According to the sequencing results, they were judged to be patients with growth and development retardation, which were all consistent with their clinical symptoms; at the position of NM_007118.4 c.7043delA(p.H2348Pfs*65) of the TRIO gene in I-2 and II-2, the base was A. As Figures 5 - 6 showed, they were all wild-type. According to the sequencing results, they were judged to be normal, and this result was consistent with their clinical phenotypes. According to the sanger verification results: that is, the three patients with growth and development retardation, I-1, II-1, and III-1, all had the mutation of NM_007118.4 c.7043delA of the TRIO gene detected, while the phenotypically normal I-2 and II-2 did not detect this mutation; it can be seen that the c.7043delA variation of the TRIO gene NM_007118.4 on chromosome 5 in patients belongs to AD inheritance and is consistent with family co-segregation in this family. These data indicate that this locus is likely to be the pathogenic locus of this growth and development retardation family.

[0078] The above embodiments are the preferred embodiments of the present invention. However, the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A TRIO gene mutant related to growth and development retardation, characterized in that The TRIO gene mutant has a c.7043delA mutation compared with the wild-type TRIO gene; the accession number of the wild-type TRIO gene is NM_007118.

4.

2. A TRIO gene mutant protein related to growth retardation, characterized in that The TRIO gene mutant protein has a p.H2348Pfs*65 mutation; compared with the protein encoded by the wild-type TRIO gene, the 2348th amino acid of the TRIO gene mutant protein is mutated from the wild-type histidine (His) to proline (Pro), which results in the 64th subsequent amino acid becoming a stop codon, and its length is shortened from 3097 amino acids to 2411 amino acids.

3. A reagent for detecting the TRIO gene mutant according to claim 1.

4. The reagent according to claim 3, wherein Comprising a primer pair having a nucleotide sequence shown in SEQ ID NO: 1-2.

5. Use of the TRIO gene mutant according to claim 1, the TRIO gene mutant protein according to claim 2 as a target, or the reagent according to any one of claims 3-4 in the preparation of a reagent or kit for diagnosing, assisting in diagnosing or screening growth retardation.

6. The application according to claim 5, wherein: The reagent for diagnosing, assisting in diagnosing or screening growth retardation includes at least one of an antibody, a probe, a primer, and a mass spectrometry detection reagent specific for the nucleic acid; the primer includes at least the primer pair according to claim 4.

7. A kit for screening biological samples with growth and development retardation, characterized in that Containing a reagent capable of detecting a TRIO gene mutant; the TRIO gene mutant has a c.7043delA mutation compared with the wild-type TRIO gene; the accession number of the wild-type TRIO gene is NM_007118.4; the reagent includes a nucleic acid probe or a primer; the primer includes at least a primer pair having a nucleotide sequence shown in SEQ ID NO: 1-2.

8. Use of a reagent for specifically modifying nucleic acids in the preparation of a medicament, characterized in that The drug is used for treating growth retardation; the nucleic acid has a c.7043delA mutation compared with the wild-type TRIO gene; the accession number of the wild-type TRIO gene is NM_007118.

4.

9. A construct, characterized in that The construct contains at least one of the TRIO gene mutant according to claim 1, the TRIO gene mutant protein according to claim 2 as a target, and the reagent according to any one of claims 3-4.

10. Use of a biological model in screening drugs, characterized in that The biological model carries at least one of the TRIO gene mutant according to claim 1, the TRIO gene mutant protein according to claim 2 as a target, and the reagent according to any one of claims 3-4.

Images