Male sterility gene OsNAC14 and application thereof

Abstract

The invention discloses a male sterility gene OsNAC14 and application thereof, and a protein sequence coded by the gene OsNAC14 is shown as SEQ ID NO.1. The application is as follows: the gene OsNAC14 is knocked out, changed or inhibited by using a CRISPR / Cas9 system, so that the expression level of the gene OsNAC14 in a conventional rice variety is reduced or lost, and then a rice male sterility line is obtained; the invention also relates to a method for recovering rice male sterility caused by OsNAC14 gene deletion, the OsNAC14 gene is amplified through a primer, and a mutant plant is transformed by using a genetic transformation means, so that the mutant can be recovered to a wild phenotype; the rice mutant obtained by the invention has no abnormal phenotype in the vegetative growth stage, but a homozygote plant is completely sterile.

Description

Technical Field

[0001] The invention belongs to a method for creating a rice strain in the technical field of bioengineering, and relates to a male sterile gene OsNAC14 and an application thereof. Technical Background

[0002] Rice is an important food crop in the world, and about 50% of the world's population relies on rice as their staple food. Since rice has a small genome and a very mature rice transformation system, it can be used as a model plant for studying monocotyledonous plants. People still need to understand the reproductive development mechanism of rice. The discovery and use of rice male sterile lines has ushered in a new era of rice hybrid breeding and played a huge role in increasing rice yields. Since the sterile lines currently used in the rice hybridization process have shortcomings such as unstable fertility and negative cytoplasmic effects, in-depth research on the regulatory mechanism of rice male sterility is of great significance for obtaining new rice sterile lines and increasing agricultural yields. It also has important theoretical significance for revealing the molecular regulatory mechanism of plant reproductive development.

[0003] CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeatsassociated Endonuclease 9) gene editing technology has been widely used in plant gene function research, crop genetic improvement and breeding due to its low cost, easy operation and high positive plant rate. It has a broad application prospect. Using CRISPR / Cas9 technology to mine and identify rice male sterility candidate genes and create male sterile materials can provide excellent seed sources for breeding and cultivate rice varieties with high yield, excellent quality, wide adaptability and strong stress resistance. Summary of the invention

[0004] The invention provides an OsNAC14 gene and an application thereof in cultivating rice male sterility, and provides a method for restoring rice male sterility caused by OsNAC14 gene deletion.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] In one aspect, the present invention provides a rice male sterility gene OsNAC14, the encoded protein sequence is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2 or SEQ ID NO.11.

[0007] The present invention also provides primers for inhibiting or silencing the gene OsNAC14. In one embodiment, the primers are shown as SEQ ID No.3 and SEQ ID No.4.

[0008] The present invention also provides target sites for inhibiting or silencing the gene OsNAC14. In one embodiment, the target sites are as shown in SEQ ID No.5 and SEQ ID No.6.

[0009] The present invention also provides the application of the gene OsNAC14, or the primer, or the target site in cultivating rice male sterile lines, specifically for inhibiting or silencing the expression of the gene OsNAC14 to obtain rice male sterile plant lines.

[0010] The present invention also provides a method for cultivating rice male sterile lines, specifically for inhibiting or silencing the expression of the rice gene OsNAC14.

[0011] The method for inhibiting or silencing the expression of the gene OsNAC14 in the present invention can be a conventional method in the art. For example, using conventional genetic engineering methods or based on the CRISPR / Cas9 system, the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.1 in rice is deleted, mutated or inhibited, thereby reducing the expression level or losing the activity of the polypeptide corresponding to the amino acid sequence. Among them, the CRISPR / Cas9 system specifically can include: using the CRISPR / Cas9 system to knockout the OsNAC14 gene at a specific site, and inhibiting the expression of the nucleotide sequence encoding the amino acid sequence shown in SEQ IDNo.1.

[0012] In a specific example, the method for site-directed knockout by the CRISPR / Cas9 system includes the following steps:

[0013] (1) Synthesize single nucleotide sequence primers as shown in SEQ ID No.3 and SEQ ID No.4;

[0014] (2) Through an annealing reaction, the synthesized single nucleotide sequences form a dimer structure and are ligated with the vector fragment to construct a plasmid containing the target sequences (T1 and T2) of the rice OsNAC14 gene; the target sequences are as shown in SEQ ID No.5 and SEQ ID No.6;

[0015] (3) Infect rice varieties with Agrobacterium tumefaciens EHA105 containing the plasmid with the OsNAC14 target sequence;

[0016] (4) Screen mutant plants by amplifying genomic fragments using specific primers of the OsNAC14 gene as shown in SEQ ID No.7 and SEQ ID No.8 and sequencing.

[0017] The present invention also provides a method for restoring male sterility in rice caused by the deletion of the OsNAC14 gene, which involves transforming the OsNAC14 gene into a plant lacking the OsNAC14 gene to restore it to the wild-type phenotype.

[0018] The present invention also provides primers for amplifying the OsNAC14 gene or its fragments. In a specific example, the primers are as shown in SEQ ID NO.9 and SEQ ID NO.10.

[0019] The method used in the present invention to amplify the OsNAC14 gene can be a conventional method in the art.

[0020] In a specific example, the method for restoring male sterility in rice caused by the deletion of the OsNAC14 gene specifically includes the following steps:

[0021] a) Extract genomic DNA from fresh leaves of wild-type Ningjing 7 as a template, and amplify the genomic sequence fragment of the OsNAC14 gene shown in SEQ ID NO.11 using primers with base sequences as shown in SEQ ID NO.9 and SEQ ID NO.10;

[0022] b) Provide Agrobacterium tumefaciens EHA105 carrying a complementary vector expressing OsNAC14; wherein, the OsNAC14 complementary construct contains the nucleotide sequence shown in SEQ ID NO.11;

[0023] c) Infect the male sterile rice line in step (b) with the Agrobacterium and cultivate it to obtain the restored line.

[0024] The present invention also provides the application of the rice male sterile line obtained by the above method in cross-breeding and seed production. Specifically, the male sterile rice line can be used as the female parent for cross-breeding.

[0025] The rice described in the present invention can be any variety of rice, such as the japonica rice variety Ningjing 7.

[0026] The OsNAC14 gene described in the present invention is a transcription factor encoding an NAC domain in rice. By controlling this gene and its encoded protein, variant plants of rice male reproductive development are obtained to achieve control of the rice reproductive process: using transgenic technology to control rice male reproductive development, and generating new rice male sterile lines by mutating the gene sequence or inhibiting the expression of the gene; the rice mutants obtained in the present invention have no obvious difference from the source parent during the vegetative period, but show abnormal male reproductive development after entering the reproductive growth stage, with pollen abortion, resulting in completely sterile plants, which have very important applications in the construction of hybrid rice and agricultural production. Brief Description of the Drawings

[0027] Figure 1 Analysis of the gene structure and DNA sequence of wild-type OsNAC14 and its mutants;

[0028] Figure 2 Comparison of seed setting rates between wild-type OsNAC14 and its mutants;

[0029] Figure 3 Observation of the phenotype of OsNAC14 transgenic knockout (CRISPR / Cas9);

[0030] Figure 4 Complementary transgenic mutants result in wild-type phenotypes. Detailed Implementation Modes

[0031] The present invention will be further described below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Any simple improvement to the preparation method of the present invention under the premise of the concept of the present invention belongs to the protection scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to the well-known means in the art.

[0032] Example 1 Creation of Osnac14 rice male sterile lines by knocking out OsNAC14 in rice varieties through CRISPR-CAS9

[0033] The full-length CDS (1278 bp) sequence of the OsNAC14 gene in the rice variety is shown in SEQ ID NO.2, and the protein sequence (425 aa) encoded by this gene is shown in SEQ ID NO.1.

[0034] In order to apply the OsNAC14 protein, according to sequence alignment analysis and target site rules, two adjacent target sites were selected on the first exon of the OsNAC14 gene using a website, as shown in SEQ ID NO.5 and SEQ ID NO.6, and a CRISPR-CAS9 vector for the OsNAC14 gene was constructed (synthetic single nucleotide sequence primers are shown in SEQ ID No.3 and SEQ IDNo.4), and it was transformed into wild-type Ningjing 7 to knock out OsNAC14 or reduce the expression of OsNAC14, so as to achieve the purpose of changing rice fertility.

[0035] T0 generation positive plants were obtained, and the seeds of the positive plants were harvested and planted in the T1 generation. Total DNA of the leaves was extracted from the positive plants, and sequencing analysis was carried out using the identification primers for the target sites shown in SEQ ID NO.7 and SEQ ID NO.8 to obtain T1 generation target site homozygous mutant plants, and two rice male sterile lines, Osnac14-1 and Osnac14-2, were obtained.

[0036] Sequencing was performed on the Osnac14-1 and Osnac14-2 lines, and the sequencing results are as follows Figure 1 . The results showed that compared with the full-length CDS of the OsNAC14 gene of the wild-type Ningjing 7, there was a 55-bp base deletion between the target sites T1 and T2 in Osnac14-1, and its nucleotide sequence is shown in SEQ ID NO.12; there was an increase of 1 base at each of the T1 and T2 target sites in Osnac14-2, and its nucleotide sequence is shown in SEQ ID NO.13.

[0037] The amino acid sequence of the Osnac14-1 protein encoded by the mutant line Osnac14-1 is shown in SEQ ID NO.14. After a 55-bp deletion in Osnac14-1, the amino acids were frameshifted, and the stop codon was advanced, resulting in a translated protein of 112 aa; the amino acid sequence of the Osnac14-2 protein encoded by the mutant line Osnac14-2 is shown in SEQ ID NO.15. After a total increase of 2 bp in Osnac14-2, the amino acids were frameshifted, and the stop codon was advanced, resulting in a translated protein of 131 aa;

[0038] Both of these mutations caused a frameshift mutation in the OsNAC14 protein, premature termination of translation, and the inability to synthesize the normal protein, resulting in the loss of function and showing a phenotype of complete sterility in plant seed setting. The seed setting rates of the mutant lines were statistically analyzed as follows Figure 2 .

[0039] The phenotypes of the wild-type Ningjing 7 (WT) and the mutant line (Osnac14-1) were observed, as follows Figure 3 . Compared with the wild-type Ningjing 7 (WT), the mutant showed no obvious difference in the vegetative growth stage, but was completely sterile in the reproductive growth stage ( Figure 3 b), with pale anthers ( Figure 3 f), abnormal iodine-potassium iodide staining ( Figure 3 j), showing typical abortion. Osnac14-2 also had a similar phenotype.

[0040] Example 2 Method for Restoring the Male Sterility Trait of the Osnac14-1 Mutant

[0041] Transferring the genomic nucleotide sequence encoding the OsNAC14 gene into the mutant Osnac1-1 mutant plants can restore the mutant to the wild-type phenotype. Genomic DNA was extracted from the leaves of wild-type Ningjing 7 as a template to amplify a 7136 bp genomic sequence fragment of the OsNAC14 gene DNA as shown in SEQ ID NO.11, and a complementary vector was constructed (the amplification primer sequences are shown in SEQ ID NO.9 and SEQ ID NO.10); after correct sequencing verification, the OsNAC14 complementary constructed Agrobacterium tumefaciens EHA105 was obtained. Since Osnac14-1 showed complete sterility and there were not enough mature seeds for callus, genetic transformation was used to transform the OsNAC14 heterozygous seeds, so that the nucleotide encoding the amino acid as shown in SEQ ID NO.1 was transferred into rice cells and integrated into the chromosomes of rice cells; regeneration was carried out to obtain rice plants; genomic fragments were amplified using primers CE-NAC14aa-F (sequence: TTCACCCGCTACATCCACTG) and CE-NAC14aa-R1 (sequence: AGCAGCCACCGTCACTAACT), the mutant background was identified by sequencing using the primer as shown in SEQ ID NO.7, and positive plants were identified using primers CE-nac14gDNA-F (sequence: GGTCTTGCGAAGGATAGTGGG) and CE-nac14gDNA-R (sequence: AGCAGCCACCGTCACTAACTCT), and it was observed whether the obtained positive plants with the mutant background would return to the wild-type phenotype.

[0042] Nine positive complementary plants with the identified mutant background were obtained in the T0 generation, Figure 4 showing that the vegetative growth stage of the T0 generation complementary plants was consistent with the wild-type phenotype, and the seed setting was normal during the reproductive growth stage ( Figure 4 b), observing the floral organs found that the anthers were normal ( Figure 4 e), producing pollen with normal morphology, and the pollen iodine-potassium iodide staining was normal ( Figure 4 h), and the seed setting rate was not significantly different from that of the wild type ( Figure 4 i).

[0043] In summary, the present invention obtains variant plants with abnormal male reproductive development in rice by controlling the transcription factor OsNAC14 gene of the NAC domain in rice and its encoded protein, realizing the control of male reproductive development in rice; the obtained rice mutants in the present invention have no obvious difference from the parents during the vegetative growth period. After entering the reproductive growth stage, the male reproductive organs develop abnormally, and pollen abortion causes plant sterility, which has very important applications in agricultural production.

Claims

1. A male sterility gene OsNAC14, characterized in that, The amino acid sequence encoded by the male sterility gene OsNAC14 is shown in SEQ ID NO.

1.

2. The male sterility gene OsNAC14 according to claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.2 or SEQ ID NO.

11.

3. Primers for inhibiting or silencing the gene OsNAC14 according to claim 1 or 2.

4. The primer according to claim 3, wherein The primers are shown in SEQ ID No.3 and SEQ ID No.

4.

5. Target sites for inhibiting or silencing the gene OsNAC14 according to claim 1 or 2; preferably, the target sites are shown in SEQ ID No.5 and SEQ ID No.

6.

6. Use of the gene OsNAC14 according to claim 1 or 2, the primers according to claim 3 or 4, or the target sites according to claim 5 in cultivating rice male sterile lines, specifically for inhibiting or silencing the expression of the gene OsNAC14 to obtain rice male sterile plant lines; preferably, the rice variety is the japonica rice variety Ningjing 7.

7. A method for cultivating rice male sterile lines, specifically for inhibiting or silencing the expression of the gene OsNAC14 according to claim 1 or 2; preferably, the rice variety is the japonica rice variety Ningjing 7.

8. Use of the rice male sterile line obtained by the method according to claim 7 in cross-breeding and seed production.

9. A method for restoring rice male sterility caused by the deletion of the OsNAC14 gene, by transforming the gene OsNAC14 according to claim 1 or 2 into a plant with a deletion of the OsNAC14 gene to restore it to the wild-type phenotype; preferably, the rice variety is the japonica rice variety Ningjing 7.

10. Primers for amplifying the gene OsNAC14 according to claim 1 or 2 or its fragment; preferably, the primers are shown in SEQ ID NO.9 and SEQ ID NO.10.

Images