New gene participating in DNA methylation pathway and application thereof in plant epigenetic regulation

The targeted editing of Arabidopsis AtRmu1 gene through the CRISPR/Cas9 system solved the problem of low DNA methylation breeding efficiency in the existing technology, achieved precise regulation of Arabidopsis DNA methylation, and created plant varieties with stable DNA methylation phenotype, improving stress resistance, yield and fertility.

CN120290589APending Publication Date: 2025-07-11QINGDAO AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510456095.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing CRISPR/dCas9 system has low efficiency, poor tissue specificity and lacks self-regulation ability in plant DNA methylation breeding. The functional association of the Arabidopsis gene AT4G25330 (AtRmu1) has not been revealed.

Method used

The nucleotide sequence and amino acid sequence of the Arabidopsis gene AtRmu1 are provided, and targeted editing is carried out through the CRISPR/Cas9 system to regulate the DNA methylation level, and construct a DNA methylation regulation kit, which includes specific inhibitors and CRISPR/Cas9 vectors, targets nucleotide sequences such as sgRNA, siRNA or antisense oligonucleotides to improve the methylation level of CHG and CHH sites.

Benefits of technology

Accurate regulation of DNA methylation of Arabidopsis thaliana has been achieved, and stable DNA methylation phenotype was created through AtRmu1 mutants, and applied to crop breeding, which has improved the expression of stress resistance, yield and breeding-related genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290589A_ABST
    Figure CN120290589A_ABST
Patent Text Reader

Abstract

The invention discloses a novel gene participating in a DNA methylation pathway and application of the novel gene in plant epigenetic regulation. Experiments show that a hypermethylation site exists in an arabidopsis thaliana RMU1 gene promoter region, the methylation level of the arabidopsis thaliana RMU1 gene promoter region is obviously reduced under the background of an RdDM defective mutant, the transcriptional level of the arabidopsis thaliana RMU1 gene promoter region is obviously improved, and it is proved that expression of the arabidopsis thaliana RMU1 gene promoter region is regulated by After the RMU1 gene is mutated, the methylation level of the whole gene is obviously changed, the methylation levels of CHG and CHH sites of the rmu1 mutant in gene upstream and downstream 2kb regions, transposon upstream and downstream 2kb regions and transposon body regions are obviously higher than those of wild arabidopsis thaliana, and the phenomenon is not observed in a gene body region, so that the RMU1 participates in regulating and controlling the DNA methylation level. The arabidopsis thaliana RMU1 gene has important effects and application prospects in epigenetic editing tool development, epigenetic breeding and transposon domestication.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a novel gene involved in the DNA methylation pathway and its application in plant epigenetic regulation. Background Art

[0002] DNA methylation is a core mechanism of epigenetic regulation and is involved in plant development and environmental responses by influencing gene silencing, transposon suppression, and genome stability. It has been widely applied in DNA methylation breeding. For example, the decrease in DNA methylation 1 (ddm1) mutant screened by EMS mutagenesis can stably inherit the hypomethylated phenotype and generate agronomic trait variations (Kawanabe et al, 2016). Seed germination is a crucial stage in the plant life cycle, and DNA methylation plays an important regulatory role in this process. For example, hypermethylation of the promoter of the Arabidopsis DOG1 (DELAY OF GERMINATION 1) gene inhibits its expression and releases the dormancy signal (Bentsink et al, 2006; Chen et al, 2020). The organ formation and morphogenesis of plants are complex processes involving the coordinated expression of multiple genes. DNA methylation ensures the normal growth and development of organs by regulating the expression patterns of these genes. For example, in the shoot apical meristem (SAM), the hypomethylated state of the WUSCHEL (WUS) gene maintains stem cell pluripotency, and abnormal methylation leads to premature differentiation of the SAM (Karim et al, 2018); the formation of leaf margin serrations is regulated by the methylation of the CUC2 (CUP-SHAPED COTYLEDON 2) gene, and the deletion of the demethylase ROS1 results in abnormal leaf morphology (Rajabhoj et al, 2024). Flowering time is one of the important characteristics for plants to adapt to the environment, and this process is affected by various internal and external factors, among which DNA methylation plays a key role in regulating flowering time. Hypermethylation of the FLC (FLOWERING LOCUS C) gene (through the FRI-FLC complex) inhibits flowering, and vernalization activates the flowering signal through demethylation (Song et al, 2012); the RdDM pathway indirectly regulates the expression of the florigen gene FT (FLOWERING LOCUS T) by silencing transposons (Heo and Sung 2011). Methylation changes induced by drought or salt stress can be transmitted through meiosis to form transgenerational adaptation. For example, the stress memory of the Arabidopsis RD29A (RESPONSIVE TO DESSICATION 29A) gene (Sani et al, 2013). DNA methylation is also utilized in epi-heterosis. For example, the CHH methylation level in maize hybrids is positively correlated with biomass, opening up a new way for non-transgenic breeding (Liu et al, 2024). Temperature and light are important environmental factors affecting plant growth and development, and these factors also affect plant physiological processes by changing DNA methylation patterns.In summary, plants need to adapt to various environmental stresses during growth, such as drought, salinity, and temperature changes. DNA methylation and demethylation, as a dynamic regulatory mechanism, can respond to environmental changes, regulate gene expression, and help plants better adapt to the environment.

[0003] DNA methylation is a core mechanism of epigenetic regulation and participates in plant development and environmental response by affecting gene silencing, transposon inhibition, and genome stability. In the prior art, fusion tools of the CRISPR / dCas9 system and demethylases (such as ROS1, DME) have been used for targeted demethylation, but there are still problems such as low efficiency, poor tissue specificity, and lack of self-regulatory ability.

[0004] The nucleotide sequence of the Arabidopsis gene AT4G25330 (named AtRmu1) has been recorded in public databases (such as TAIR), but its functional association with DNA demethylation has not been revealed. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a new gene involved in the DNA methylation pathway and its application in plant epigenetic regulation. This gene is AtRmu1, a gene involved in DNA methylation regulation in Arabidopsis thaliana, providing new ideas for its application in epigenetic breeding and transposon domestication. The present invention first verified the DNA demethylation activity of AtRmu1 by whole-genome methylation sequencing, providing a new target for precise epigenetic editing.

[0006] The first object of the present invention is to provide the application of a gene with the nucleotide sequence shown in SEQ ID NO.1 or a protein with the amino acid sequence shown in SEQ ID NO.2 in DNA methylation regulation.

[0007] The AtRmu1 gene encodes a protein with DNA methylation regulation function, and this protein contains a SAWADEE domain that can regulate the whole-genome DNA methylation level.

[0008] The second object of the present invention is to provide a DNA methylation regulation kit, which contains a gene with the nucleotide sequence shown in SEQ ID NO.1, a protein with the amino acid sequence shown in SEQ ID NO.2, or a specific inhibitor of a gene with the nucleotide sequence shown in SEQ ID NO.1 and a protein with the amino acid sequence shown in SEQ ID NO.2.

[0009] Preferably, the specific inhibitor of the gene with the nucleotide sequence shown in SEQ ID NO.1 is an sgRNA, siRNA, or antisense oligonucleotide targeting the gene with the nucleotide sequence shown in SEQ ID NO.1.

[0010] Preferably, the targeting nucleotide sequence is sgRNA1 or sgRNA2 of the gene shown in SEQ ID NO.1. The sense strand of sgRNA1 is ATTGAACTCGCCGGAGAAAACCGT (SEQ ID NO.3), and the antisense strand is AAACACGGTTTTCTCCGGCGAGTT (SEQ ID NO.4); the sense strand of sgRNA2 is ATTGGAGTGGGGCTACTAGTCCGA (SEQ ID NO.5), and the antisense strand is AAACTCGGACTAGTAGCCCCACTC (SEQ ID NO.6).

[0011] Preferably, the DNA methylation regulation kit further includes a CRISPR / Cas9 vector and a plant transformation reagent.

[0012] The third object of the present invention is to provide a method for regulating plant DNA methylation, which improves the methylation levels of CHG and CHH sites in the promoter region or transposon region of a target gene by inhibiting the expression of the gene shown in SEQ ID NO.1 or inhibiting the activity of the protein shown in SEQ ID NO.2.

[0013] Preferably, the target gene is a stress resistance-related gene, a yield-related gene or a fertility-related gene.

[0014] Preferably, the stress resistance-related gene is the DREB2A gene, the yield-related gene is the OsTB1 gene, and the fertility-related gene is the CMS gene.

[0015] Preferably, the method includes the following steps:

[0016] S1. Construct a knockout or knockdown vector for the gene shown in SEQ ID NO.1.

[0017] S2. Transform the constructed vector into plant cells through Agrobacterium-mediated transformation.

[0018] S3. Screen and obtain transgenic plants with increased DNA methylation levels.

[0019] Preferably, the plant is Arabidopsis thaliana.

[0020] Experiments of the present invention show that there are hypermethylation sites in the promoter region of the Arabidopsis RMU1 gene, and its methylation level is significantly reduced in the background of RdDM-deficient mutants. The transcription level of RMU1 is significantly increased in the background of RdDM-deficient mutants, demonstrating that its expression is negatively regulated by DNA methylation. By using the CRISPR / Cas9 gene editing technology to target-mutate the Arabidopsis RMU1 gene, two Arabidopsis rmu1 mutants with different mutation types were obtained. After the RMU1 gene mutation, the global DNA methylation level changed significantly. The methylation levels of CHG and CHH sites in the 2 kb regions upstream and downstream of the gene, the 2 kb regions upstream and downstream of the transposon, and the transposon body region of the rmu1 mutants were significantly higher than those of wild-type Arabidopsis, while this phenomenon was not observed in the gene body region, and the methylation level of CpG sites did not change significantly, demonstrating that RMU1 participates in the regulation of DNA methylation level.

[0021] Therefore, the rmu1 mutants can be used to create plant varieties with stable DNA methylation phenotypes through hybridization or gene editing technology, and thus applied to crop breeding.

[0022] Based on the function of ATRMU1 in regulating DNA methylation, those skilled in the art can develop epigenetic editing tools through conventional means. For example: (1) Targeted editing system: Fuse ATRMU1 with targeted elements such as dCas9 and zinc finger proteins to construct a plant expression vector; (2) Crop improvement: Target the promoters of stress-resistant genes (such as DREB2A), yield genes (such as OsTB1), or fertility genes (such as CMS) to relieve methylation inhibition. The ATRMU1 gene plays an important role and has application prospects in the development of epigenetic editing tools, epigenetic breeding, and transposon domestication.

[0023] The present invention proves that the expression of the RMU1 gene is negatively regulated by DNA methylation through bisulfite PCR (BSP) and qRT-PCR. Through whole-genome bisulfite sequencing (WGBS), it is found that compared with wild-type Arabidopsis, the global DNA methylation level of Arabidopsis with mutated RMU1 gene changes significantly. Therefore, the RMU1 gene has a certain role in regulating the DNA methylation level, and RMU1 can be used for epigenetic editing. Description of the Drawings

[0024] Figure 1 It is a model diagram of the Arabidopsis rmu1 mutant.

[0025] Figure 2It is a diagram of the DNA methylation and expression level changes of the RMU1 promoter; among them, A is the transposon methylation and gene model; B is the schematic diagram of transposon methylation, the solid box is methylated cytosine, and the hollow is unmethylated cytosine; C is the quantitative expression of the RMU1 gene in the mutant, the error bar is the standard error of three technical replicates, T-test, **P<0.001; D is the methylation ratio statistics, and the statistical section starts from the red asterisk in B to the black asterisk.

[0026] Figure 3 It is a diagram of the changes in genome-wide DNA methylation in the rmu1 mutant.

[0027] Figure 4 It is the changes in DNA methylation in the gene body region, transposon body region and their upstream and downstream regions in the rmu1 mutant. Specific implementation mode

[0028] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0029] Experimental methods and material sources: Arabidopsis wild type (Col-0) and rdr2-2 mutant (SALK_059661); the Escherichia coli competent cells (DH5α) and Agrobacterium competent cells (GV3101) used are all from Shenzhen Kangti Life Science Co., Ltd.; the vector pKI1.1R used in the experiment is a commercially available vector.

[0030] Example 1: Construction of the CRISPR / Cas9 vector targeting the RMU1 gene

[0031] 1. Using the CRISPR / Cas9 genome editing technology, RMU1 was directionally edited in the model plant Arabidopsis thaliana Col-0 ecotype in order to obtain the Arabidopsis rmu1 mutant. According to the CRISPR-P website CRISPR-P (hzau.edu.cn), the nucleotide sequence of the Arabidopsis RMU1 (AtRmu1) gene obtained above (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2) was used as input for target site analysis. According to factors such as the specificity of the site, the distance from the gene promoter, and the predicted editing efficiency, two most suitable target sites were selected, and the corresponding oligonucleotide primers, namely P1, P2, P3 and P4, were designed. Through primer pairs P1, P2 and primer pairs P3, P4, double-stranded sgRNA oligonucleotides were synthesized respectively, and the double-stranded oligonucleotides were diluted 25 times for subsequent ligation reactions.

[0032] Among them, the sgRNA oligonucleotide primer sequences (5'3') are as follows:

[0033] P1: ATTGAACTCGCCGGAGAAAACCGT (SEQ ID NO.3);

[0034] P2: AAACACGGTTTTCTCCGGCGAGTT (SEQ ID NO.4).

[0035] P3: ATTGGAGTGGGGCTACTAGTCCGA (SEQ ID NO.5);

[0036] P4: AAACTCGGACTAGTAGCCCCACTC (SEQ ID NO.6).

[0037] PCR reaction system (30 μL): 3 μL of 100 μmol / L sense sgRNA oligonucleotide, 3 μL of 100 μmol / L antisense sgRNA oligonucleotide, 3 μL of T4 DNA ligase buffer (10×), 2 μL of T4 polynucleotide kinase, 19 μL of sterile water.

[0038] PCR reaction procedure: React at 37°C for 1 hour for annealing and extension; denature at 95°C for 5 minutes; perform a gradient temperature drop from 85°C to 4°C to promote double-strand formation and stabilization.

[0039] 2. Digest the pKI1.1R vector (spectinomycin resistance) with AarI restriction endonuclease to obtain a linearized vector fragment. After the digestion reaction is completed, recover the linearized vector fragment by gel electrophoresis. Perform a ligation reaction (at 37°C for 1 h) between the diluted double-stranded sgRNA oligonucleotide and the linearized vector fragment.

[0040] Ligation reaction system (10 μL): 5 μL of linearized vector, 1 μL of double-stranded sgRNA oligonucleotide, 1 μL of T4 ligase, 1 μL of T4 ligase Buffer, 2 μL of sterile water.

[0041] 3. After the ligation reaction is completed, the obtained product needs to be transferred into Escherichia coli competent (DH5α) cells. Incubate on ice for about 30 min, heat shock at 42 °C for 90 s, and then quickly transfer to ice for cooling for 2 min. Then add 500 μL of liquid LB, place it in a shaker at 37 °C, and culture at 200 rpm for 1 h. After the culture is completed, centrifuge the centrifuge tube at 5000 rpm for 5 min, and then discard the supernatant. Resuspend the cell pellet with the remaining liquid LB, and use a sterile spreader to evenly spread it on a plate containing spectinomycin resistance. Finally, invert the plate and place it in an incubator at 37 °C for 12 - 16 h. After single colonies form, pick monoclonal colonies for colony PCR identification. The primers used for identification are the forward primer: TCCTTCCACATTTCAGTATG (SEQ ID NO.11), and the reverse primer: TTCTTGAATCTCGTCGGAGTTTTTG (SEQ ID NO.12).

[0042] PCR reaction system (20 μL): 10 μL of 2×Rapid Taq Master Mix, 0.8 μL each of 10 μmol / L forward and reverse primers, 1 μL of bacterial solution, 7.4 μL of sterile water.

[0043] PCR reaction procedure: Pre-denature at 95 °C for 3 min, then enter 32 cycles of reaction. In each cycle, denature at 95 °C for 15 s, anneal at 55 °C for 15 s, and extend at 72 °C for 30 s; after the cycles are completed, continue to extend for 10 min.

[0044] 4. Perform agarose gel electrophoresis on the colony identification PCR product, and compare whether there is a target gene amplification band according to the position indicated by the Marker. The colony corresponding to this band is the positive clone; add 4 mL of liquid LB medium containing spectinomycin, and culture overnight at 37 °C in a shaker at 220 rpm. Use the TIAN prep Rapid Mini PlasmidKit from TIANGEN company to extract the plasmid. Finally, send this plasmid for sequencing for further verification to obtain the recombinant plasmid.

[0045] Example 2: Construction of rmu1 mutant material

[0046] 1. Transformation of Agrobacterium (GV3101) competent cells with the recombinant plasmid: Add the recombinant plasmid to be transformed into the thawed GV3101 competent cells and let it stand on ice for 30 min. Quickly freeze it in liquid nitrogen for 3 min, then transfer it to a water bath at 37 °C for heat shock treatment for 5 min. Subsequently, place the centrifuge tube on ice again and let it stand for 2 min. Add 500 μL of LB liquid medium and incubate it in a shaker at 28 °C and 220 rpm for 3 h. Then, place the centrifuge tube in a high-speed centrifuge at room temperature and centrifuge at 5000 rpm for 3 min, and discard part of the supernatant. Resuspend the bacterial cell pellet at the bottom of the centrifuge tube with the remaining supernatant and evenly spread the bacterial solution on the LB solid medium containing rifampicin and spectinomycin. Place the spread plate in an incubator at 28 °C and incubate it upside down for 2 - 3 d until monoclonal colonies grow. Pick a single colony, inoculate it into liquid LB containing rifampicin and spectinomycin, and then culture it at 28 °C and 220 rpm for 24 h. Finally, store the bacterial solution for subsequent use.

[0047] 2. Cultivation of Arabidopsis thaliana: Select appropriate Col-0 Arabidopsis thaliana seeds, soak them in 75% ethanol for 10 min, rinse them once with absolute ethanol, air dry them, and then sow them on 1 / 2 MS medium. Treat them in the dark at 4 °C for 2 d. Then, take them out and transfer them to conditions of long-day with a temperature of 22 °C, 16 h light / 8 h dark, and a relative humidity of 60%, and continue to grow for 7 d, and then transplant them into the soil.

[0048] 3. Floral dip infection of Arabidopsis thaliana: Add 4 mL of liquid LB containing rifampicin and spectinomycin to a centrifuge tube, pipette a small amount of the stored bacterial solution from step 1 into the liquid LB, and incubate it overnight at 28 °C and 220 rpm. When the bacterial solution turns orange juice color, take out 1 mL of the bacterial solution and inoculate it into 250 mL of liquid LB containing rifampicin and spectinomycin. Incubate it at 28 °C and 220 rpm for about 7 h. After the cultivation is completed, evenly distribute the bacterial solution into 50 mL centrifuge tubes and centrifuge at 6000 rpm for 8 min. After centrifugation, discard the supernatant. Add 20 mL of infection solution to the centrifuge tube to resuspend the bacterial cells, obtain the infected bacterial solution and adjust its OD600 = 0.8 - 1.0 for transformation. Cut off the mature pods of Arabidopsis thaliana, leaving only the unopened flower buds. Soak the flower buds in the infected bacterial solution for 90 s. After 24 h of light avoidance treatment, the infected Arabidopsis thaliana plants resume normal growth and the mature seeds are harvested.

[0049] Formula of Arabidopsis thaliana infection solution (500 mL): 25 g of sucrose, 1 g of MgCl2·6H2O, 0.25 g of MES, 100 μL of Silwet-77, make up the volume to 500 mL with H2O, and adjust the pH to 5.7.

[0050] 4. Identification of transgenic plants: The transgenic Arabidopsis seeds were sown on 1 / 2 MS medium containing hygromycin resistance for screening, and the transgenic plants were purified to the T3 generation. The genomic DNA of the transgenic plants was extracted, and PCR amplification of the DNA was performed using primers P5 and P6. The reaction system (20 μL) and procedure were the same as before. After the reaction was completed, sequencing detection was carried out to screen and obtain homozygous transgenic plants.

[0051] Among them, the primer sequences of P5 and P6 (5' - 3') are as follows:

[0052] P5: TCCGAGCAGATGCAAGACATCG (SEQ ID NO.7);

[0053] P6: ATGCTTCGTCCTCTCCACCGTAAC (SEQ ID NO.8).

[0054] The results are as Figure 1 shown, and two homozygous mutants with single - base insertion, rmu1 - 6 and rmu1 - 39, were obtained.

[0055] Example 3: RMU1 gene expression analysis

[0056] To study whether the expression level of the RMU1 gene is regulated by DNA methylation, we detected the expression level of RMU1 in the background of a DNA methylation - defective mutant (Arabidopsis rdr2 - 2 mutant, SALK_059661).

[0057] 1. Extraction of total RNA from Arabidopsis thaliana: Use the Vazyme RNA extraction kit (FastPure Plant Total RNA Isolation Kit) to extract total RNA. The specific steps can be referred to the instruction manual. After quick freezing in liquid nitrogen, grind the plant material into a powdery state. Weigh 50 - 100 mg of the powdered sample, add 600 μL of Buffer EL, vortex for 30 s, and centrifuge at 12,000 rpm for 5 min. Pipette 500 μL of the supernatant and transfer it to the FastPure gDNA-Filter Columns III placed in the collection tube. Centrifuge at 12,000 rpm for 30 s, then discard the FastPure gDNA-Filter Columns III and collect the filtrate. Add anhydrous ethanol with a volume 0.5 times that of the filtrate to the collection tube and gently mix by inversion for 15 s. Transfer the above mixture to the FastPure RNA Columns V placed in the collection tube and centrifuge at 12,000 rpm for 30 s. Add 700 μL of Buffer RWA to the FastPure RNA Columns V and centrifuge at 12,000 rpm for 30 s, then discard the filtrate. Add 500 μL of Buffer RWB to the FastPure RNA Columns V and centrifuge at 12,000 rpm for 30 s, then discard the filtrate. This step needs to be repeated once. Place the FastPure RNA Columns V back into the collection tube and centrifuge at 12,000 rpm for 2 min. Transfer the FastPure RNA Columns V to a new 1.5 mL RNase-free collection tube, and suspend and drip 50 μL of RNase-free ddH2O onto the center of the adsorption column membrane. Centrifuge at 12,000 rpm for 1 min to elute the RNA.

[0058] 2. RNA reverse transcription: Use NanoDrop Eight to measure the concentration of the RNA sample, and perform reverse transcription to obtain cDNA using the PlusAll-in-one 1st Strand cDNA Synthesis SuperMix (gDNA Purge).

[0059] Reverse transcription system (20 μL): 10 μL Plus 1st Strand cDNA Synthesis SuperMix, 1 μg of total RNA, 10 μL of gDNA Purge, add RNase Free Water to 20 μL.

[0060] Reverse transcription program: Incubate at 50°C for 15 min and react at 85°C for 5 s.

[0061] 3. Real-time fluorescence quantitative PCR: Use the TB Premix ExTaq TM II (Tli RNaseHPlus) kit and P5, P6 primer pairs for real-time fluorescence quantitative PCR analysis. First, prepare the PCR reaction solution according to the specified components on ice, ensuring that all operations are carried out in a low-temperature environment to maintain the activity of the reagents. After diluting the cDNA obtained in the previous step by 15 times, accurately pipette 3 μL and add it to the reaction system. To ensure the stability and reliability of the experimental results, three technical replicates are set for each experiment. Use an Applied Biosystems StepOnePlus Real-Time PCR System (ThermoFisher Scientific) fluorescence quantitative PCR instrument for quantification.

[0062] qRT-PCR system (20 μL): 10 μL of TB Green Premix Ex TaqII (Tli RNaseH Plus) (2X), 0.8 μL of each forward and reverse primer at 10 μmol / L, 0.4 μL of ROX Reference Dye II (50X), 3 μL of template DNA, and 5 μL of sterile water.

[0063] qRT-PCR program: Pre-denature at 95°C for 30 s, then enter 40 cycles of reaction, with 95°C for 5 s and 60°C for 30 s in each cycle; after the cycle ends, 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s.

[0064] The results are as shown Figure 2 in C, and the transcriptional level of RMU1 is significantly increased in the Arabidopsis rdr2-2 mutant background.

[0065] Example 4: Analysis of the DNA methylation level of the RMU1 promoter

[0066] 1. Genomic DNA extraction: The CTAB method was used to extract genomic DNA. Two 4-mm small steel beads were added to a 2-mL centrifuge tube, along with an appropriate amount of plant tissue. The mixture was snap-frozen in liquid nitrogen and ground into a powder at 60 Hz for 45 s using a grinder. 750 μL of CTAB solution preheated to 65 °C was added to the centrifuge tube, and the tube was incubated in a water bath at 65 °C for 30 min. After removal, it was cooled to room temperature. An equal volume of chloroform:isoamyl alcohol (24:1) was added to the centrifuge tube, and the mixture was centrifuged at 13,000 rpm for 15 min. Approximately 450 μL of the supernatant was taken, and an equal volume of isopropanol pre-cooled to -20 °C was added. The mixture was placed at -20 °C for 30 min. It was centrifuged at 13,000 rpm for 15 min, the supernatant was discarded, and the DNA pellet was retained and blotted dry on absorbent paper. 500 μL of 75% ethanol pre-cooled to -20 °C was added to the centrifuge tube, and the tube was inverted for rinsing. It was centrifuged at 13,000 rpm for 3 min. After drying, 50 μL of dH2O was added to the centrifuge tube.

[0067] 2. DNA bisulfite conversion: A DNA bisulfite conversion kit from Beyotime was used. The specific operation steps are as follows: 1 tube of conversion solution powder was added to 100 μL of Solution I (protective solution) and 1.4 mL of Solution II (reaction solution), and the mixture was vortexed at room temperature or inverted up and down until the conversion solution powder was completely dissolved to prepare the conversion solution. 1 μg of sample DNA was taken and added to a PCR tube, and sterile water was added to make the volume up to 20 μL. 130 μL of the prepared conversion solution was added to the PCR tube / well of the PCR plate, and the mixture was shaken well. The PCR tube was placed in a PCR instrument for reaction. 600 μL of Solution III (binding solution) was added to the purification column. 150 μL of the conversion reaction product was transferred to the purification column, and the column was inverted and mixed well. It was centrifuged at 12,000 rpm for 1 min, and the liquid in the collection tube was discarded. 500 μL of Solution IV (washing solution) was added to the purification column, and it was centrifuged at 12,000 rpm for 1 min, and the liquid in the collection tube was discarded. A desulfonation reaction solution was prepared by mixing Solution II (reaction solution) and absolute ethanol at a ratio of 20 μL of Solution II to 180 μL of absolute ethanol. 200 μL of the desulfonation reaction solution was added to the purification column, and it was allowed to stand at room temperature for 20 min. It was centrifuged at 12,000 rpm for 1 min, and the liquid in the collection tube was discarded. 500 μL of Solution IV (washing solution) was added to the purification column, and it was centrifuged at 12,000 rpm for 1 min, and the liquid in the collection tube was discarded. This step was repeated once. It was centrifuged at 12,000 rpm again for 1 min, and the liquid in the collection tube was discarded. The purification column was transferred to a 1.5-mL centrifuge tube, and the cap was opened and dried at room temperature for 2 min. 20 μL of Solution V (elution solution) was added to the center of the purification column membrane, and it was allowed to stand at room temperature for 2 min. It was centrifuged at 12,000 rpm for 1 min, and the DNA solution in the centrifuge tube was collected.

[0068] DNA bisulfite reaction program: Pre-denaturation at 95 °C for 3 min, followed by 12 cycles of reaction. In each cycle, denaturation at 95 °C for 30 s and conversion at 70 °C for 10 min; after the cycles ended, incubation at 4 °C for 1 min.

[0069] 3. Bisulfite PCR: Different from ordinary PCR, the primers for bisulfite PCR need to be very long (usually between 26 - 30 bases), and the size of the amplicon should be relatively short. Ideally, the primers should not contain CpG sites. According to this principle, the primer pair P7 and P8 was designed for PCR amplification.

[0070] Among them, the primer sequences of P7 and P8 (5' - 3') are:

[0071] P7: GTAGTATAGATTTATATGGTAATTGTTGG (SEQ ID NO.9);

[0072] P8: CCATATTTACAAATATAACATATTAAC (SEQ ID NO.10).

[0073] PCR reaction system (30 μL): 15 μL KOD OneTM PCR Master Mix, 1 μL each of 10 μmol / L forward and reverse primers, 1 μL of transformed DNA, 12 μL of sterile water.

[0074] PCR reaction procedure: Pre - denature at 98°C for 3 min, then enter 34 cycles of reaction. In each cycle, denature at 98°C for 10 s, anneal at 50°C for 15 s, and extend at 68°C for 5 s; after the cycle ends, continue at 12°C.

[0075] 4. Cloning of bisulfite PCR products: Use the Novoprotein 5 - minute TA / Blunt - Zero cloning kit. Cloning is carried out according to the following reaction system and conditions. Directly pick monoclonal colonies for sequencing identification, and the sequencing primer is the universal primer (M13Forward Primer).

[0076] Ligation reaction system (10 μL): 2 μL of 5×TA / Blunt - Zero Cloning Mix, 3 μL of PCR amplification product, 5 μL of sterile water.

[0077] Ligation reaction conditions: React at 25°C for 5 min. After the reaction ends, place the centrifuge tube on ice.

[0078] The results are as Figure 2 shown. First, we queried through the epigenetic database (http: / / neomorph.salk.edu / epigenome / epigenome.html) whether the Helitron transposon located upstream of RMU1 was silenced by Arabidopsis epigenetic modifications, and found that there were a large number of DNA methylation modifications on the transposon ( Figure 2A) in it. Next, to verify whether the activity of RMU1 would be affected when Arabidopsis thaliana inhibits transposon activity through DNA methylation. We used the rdr2-2 mutant that plays a key role in the RNA-mediated DNA methylation (RdDM) pathway in Arabidopsis thaliana. First, we detected by BS-PCR whether the DNA methylation on the upstream transposon of RMU1 was removed in the rdr2-2 mutant. The results showed that in the rdr2-2 mutant, the CG, CHG, and CHH methylations in the Helitron transposon region decreased to 15.63%, 0%, and 0% respectively ( Figure 2 B and D) in it. With this discovery, we can use the rdr2-2 mutant to study whether Arabidopsis thaliana will inhibit the transcriptional level of the RMU1 gene while inhibiting transposons through DNA methylation. The qPCR results showed that the expression level of RMU1 in rdr2-2 was upregulated nearly 60-fold compared with Col-0 ( Figure 2 C) in it. These results indicate that the expression level of RMU1 is inhibited by DNA methylation, and once the RdDM pathway is defective, the expression level of RMU1 increases significantly.

[0079] Example 5: Analysis of the genome-wide DNA methylation level in the rmu1 mutant background

[0080] 1. Genomic DNA extraction: The genomic DNA was extracted by the CTAB method. The specific method was the same as the genomic DNA extraction method in Example 4.

[0081] 2. WGBS: WGBS (Whole Genome Bisulfite Sequencing) was completed by Annoroad Gene Technology Co., Ltd. in Beijing. High-throughput sequencing was performed using the Illumina sequencing platform. The sequencing read length was PE150, and the average Q30 was 94.14%. The sequencing data was filtered using the fastp software, and the -l 25 and --detect_adapter_for_pe parameters were used to complete it. The Bismark software was used for alignment and methylation level analysis. Visualization was completed by ggplot2 in R language.

[0082] The results are as Figure 3 shown. The genome-wide methylation level changed in the rmu1 mutant background. The changes in the methylation level mainly occurred at the CHG and CHH sites, and were significantly increased upstream and downstream of genes, upstream and downstream of transposons, and in the transposon body region, while this phenomenon was not observed in the gene body region ( Figure 4 ), proving that RMU1 can regulate the DNA methylation level.

Claims

Use of a gene having a nucleotide sequence as shown in SEQ ID NO.1 or a protein having an amino acid sequence as shown in SEQ ID NO.2 in DNA methylation regulation.

2. A DNA methylation regulation kit, characterized in that, A gene containing a nucleotide sequence as shown in SEQ ID NO.1, a protein having an amino acid sequence as shown in SEQ ID NO.2, or a specific inhibitor of a gene having a nucleotide sequence as shown in SEQ ID NO.1 and a protein having an amino acid sequence as shown in SEQ ID NO.

2.

3. The kit according to claim 2, wherein The specific inhibitor of the gene having a nucleotide sequence as shown in SEQ ID NO.1 is an sgRNA, siRNA or antisense oligonucleotide targeting the gene having a nucleotide sequence as shown in SEQ ID NO.

1.

4. The kit according to claim 3, wherein The sgRNA targeting the gene having a nucleotide sequence as shown in SEQ ID NO.1 is sgRNA1 or sgRNA2. The sense strand of sgRNA1 is ATTGAACTCGCCGGAGAAAACCGT, and the antisense strand is AAACACGGTTTTCTCCGGCGAGTT; the sense strand of sgRNA2 is ATTGGAGTGGGGCTACTAGTCCGA, and the antisense strand is AAACTCGGACTAGTAGCCCCACTC.

5. The kit according to claim 4, characterized in that, Also included are a CRISPR / Cas9 vector and a plant transformation reagent.

6. A method for regulating plant DNA methylation, characterized in that, By inhibiting the expression of the gene having a nucleotide sequence as shown in SEQ ID NO.1 or inhibiting the activity of the protein having an amino acid sequence as shown in SEQ ID NO.2, the methylation levels of CHG and CHH sites in the promoter region or transposon region of the target gene are increased.

7. The method according to claim 6, characterized in that, The target gene is a stress resistance-related gene, a yield-related gene or a fertility-related gene.

8. The method according to claim 7, characterized in that, The stress resistance-related gene is the DREB2A gene, the yield-related gene is the OsTB1 gene, and the fertility-related gene is the CMS gene.

9. The method according to claim 6, characterized in that Comprises the following steps: S1. Construct a knockout or knockdown vector for the gene having a nucleotide sequence as shown in SEQ ID NO.1; S2. Transform the constructed vector into plant cells via Agrobacterium-mediated transformation; S3. Screen to obtain transgenic plants with increased DNA methylation levels.

10. The method according to claim 6, wherein The plant is Arabidopsis thaliana.