Plant anti-lepidoptera pest related gene MIW1 and application thereof

Abstract

The invention discloses a plant anti-lepidoptera pest related gene MIW1 and application thereof, and relates to the technical field of gene engineering, the MIW1 gene is derived from arabidopsis thaliana, the nucleotide sequence of the MIW1 gene is as shown in SEQ ID NO.1, and the amino acid sequence of an encoding protein of the MIW1 gene is as shown in SEQ ID NO.2. The invention proves that the arabidopsis thaliana MIW1 gene can mediate RPX1 to resist plutella xylostella for the first time, and participates in pest resistance by promoting RPX1 protein degradation, so that the plant anti-lepidoptera pest related gene MIW1 can be used for preventing pests. As a new insect-resistant gene of a model plant, the arabidopsis MIW1 gene has high reference value and significance, and provides a new research thought for insect-resistant breeding of economic crops such as oilseed rape, corn, rice, sorghum and the like.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a plant resistance to lepidopteran pests related gene MIW1 and an application thereof. Background Art

[0002] The diamondback moth is a migratory lepidopteran pest that is widely distributed around the world. It poses an extremely serious threat to cruciferous vegetables. It has a strong migration ability, a wide distribution area, and is extremely destructive to vegetable crops, often causing serious economic losses. What is more troublesome is that the diamondback moth's resistance to pesticides is becoming increasingly prominent, becoming an important problem that needs to be urgently solved in the current field of pest management.

[0003] With the continuous advancement of agricultural chemistry and biotechnology, various chemical pesticides and new biological pesticides have been widely used in pest control. However, this widespread application has also accelerated the evolution of diamondback moth's resistance. Under the long-term pressure of natural selection and artificial selection, diamondback moth has gradually developed varying degrees of resistance to almost all insecticides. The emergence of this resistance not only reduces the control effect of insecticides, but also increases the difficulty and cost of pest management. It is worth noting that the diamondback moth's resistance not only comes from its own genetic variation, but is also closely related to the mediation of its intestinal flora. Studies have shown that the intestinal flora of the diamondback moth can participate in regulating its sensitivity to insecticides, thereby enhancing its resistance. In addition, the detoxification of the diamondback moth to insecticides is also one of the important mechanisms of its resistance.

[0004] In view of the various problems with the current pest management methods that rely on pesticides, such as increased pest resistance and ecological environmental damage, exploring and utilizing the natural insect-resistant genes of plants has become a new direction in the field of crop breeding. By in-depth research on the resistance mechanism of the diamondback moth and combining it with modern biotechnology, it is expected to cultivate new crop varieties with excellent insect resistance, providing safer, more efficient and environmentally friendly pest management solutions for agricultural production. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide a plant resistance to lepidopteran pests related gene MIW1 and its application.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0007] The invention provides a plant resistance to lepidopteran pests related gene MIW1, the MIW1 gene is derived from Arabidopsis thaliana, and the nucleotide sequence thereof is shown in SEQ ID NO.1.

[0008] The present invention also provides a protein encoded by the MIW1 gene, and the amino acid sequence of the protein encoded is shown in SEQ ID NO.2.

[0009] The present invention also provides an application of the MIW1 gene in regulating the resistance of plants to Lepidoptera pests.

[0010] As a further optimized scheme of the present invention, overexpression of the MIW1 gene can improve the resistance of plants to Lepidoptera pests, and loss of function of the MIW1 gene can reduce the resistance of plants to Lepidoptera pests.

[0011] As a further optimized scheme of the present invention, the plant is Arabidopsis thaliana, rapeseed, corn, rice or sorghum.

[0012] As a further optimized scheme of the present invention, the Lepidoptera pest is Plutella xylostella.

[0013] The present invention also provides an application of the MIW1 gene and its encoded protein in the preparation of drugs for controlling Lepidoptera pests.

[0014] As a further optimized scheme of the present invention, the Lepidoptera pest is Plutella xylostella.

[0015] The present invention has the following beneficial effects:

[0016] The present invention proves for the first time that the Arabidopsis thaliana MIW1 gene can mediate RPX1 resistance to Plutella xylostella and participates in insect resistance by promoting the degradation of RPX1 protein. As a new insect-resistant gene in model plants, the Arabidopsis thaliana MIW1 gene has high reference value and significance, providing a new research idea for insect-resistant breeding of economic crops such as rapeseed, corn, rice, and sorghum. Description of the Drawings

[0017] Figure 1 is the full-length amplification electrophoresis map of the MIW1 gene;

[0018] Figure 2 is the comparison chart of the expression levels of the MIW1 gene in wild-type Arabidopsis thaliana Col-0 and the mutant miw1;

[0019] Figure 3 is the weight change chart of Plutella xylostella after forced feeding with wild-type Arabidopsis thaliana Col-0, mutant miw1 (MIW1 gene mutant), mutant ncbp (rpx1; RPX1 gene mutant), and double mutant miw1 ncbp (MIW1 gene and RPX1 gene double mutant) for different times;

[0020] Figure 4 is the comparison chart of the pupation situation of Plutella xylostella after forced feeding with wild-type Arabidopsis thaliana Col-0, mutant miw1 (MIW1 gene mutant), mutant ncbp (rpx1; RPX1 gene mutant), and double mutant miw1 ncbp (MIW1 gene and RPX1 gene double mutant);

[0021] Figure 5 It is the experimental result graph of the RPX1 protein abundance. Specific implementation manners

[0022] The present application will be further described in detail below with reference to the accompanying drawings. It is necessary to point out here that the following specific implementation manners are only used to further illustrate the present application and cannot be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0023] 1. Materials

[0024] The methods used in this example are all conventional methods known to those skilled in the art unless otherwise specified. The reagents and other materials used are all commercially available products unless otherwise specified.

[0025] 2. Methods

[0026] 2.1 Cloning of the Arabidopsis thaliana MIW1 gene

[0027] Using the wild-type Col-0 variety of Arabidopsis thaliana as the material, total RNA was extracted, and the extracted total RNA was reverse transcribed to synthesize the first strand of cDNA as the template for PCR amplification. Specific primers designed were used for amplification. The nucleotide sequences of the specific primers are as follows:

[0028] SEQ ID NO.3: MIW1-F: 5'>ATGGAGAAGAAGAAGGTGAC<3';

[0029] SEQ ID NO.4: MIW1-R: 5'>TTAAGTATCAGATGGTTTCTCTG<3';

[0030] A 1032bp gene fragment was amplified (the electrophoresis result is as Figure 1 shown), ligated to the T cloning vector PEASY-T3 simple vector to obtain the recombinant plasmid T3-MIW1, which was then transformed into Escherichia coli. Positive clones were picked and sequenced. The sequencing result was consistent with the predicted result, obtaining the nucleotide sequence of the MIW1 gene as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein as shown in SEQ ID NO.2. This gene belongs to the members of the Cul4-RING E3 ubiquitin ligase complex.

[0031] 2.2 Functional identification of the Arabidopsis thaliana MIW1 gene

[0032] 2.2.1. According to the nucleotide sequence of the MIW1 gene, a homozygous mutant SALK_130999C (F345) of the Arabidopsis thaliana MIW1 gene was ordered through the Arashare website, denoted as the mutant miw1. The expression levels of the MIW1 gene in Arabidopsis wild-type Col-0 and the mutant miw1 were detected by qRT-PCR. Identification primers were synthesized according to the T-DNA primer identification method provided by the T-DNA Express website:

[0033] SALK_130999(F345):

[0034] SEQ ID NO.5: LP: 5'>AATCAACCGTTGGATTTCCAC<3';

[0035] SEQ ID NO.6: RP: 5'>ATATTGGGAGAAACAATCCCG<3';

[0036] SEQ ID NO.7: LBb1.3: 5'>ATTTTGCCGATTTCGGAAC<3'.

[0037] 2.2.2. Through the analysis of the flanking sequence sequencing results, the insertion of T-DNA into the 5' UTR of the MIW1 gene can lead to a decrease in the expression level of the MIW1 gene; the RT-PCR results showed (as Figure 2 shown) that the expression level of the MIW1 gene was significantly decreased in the mutant miw1 compared with the Arabidopsis wild-type Col-0.

[0038] 2.2.3. Arabidopsis mutants with inactivated RPX1 protein can significantly improve their resistance to Plutella xylostella (Inactivation of RPX1 in Arabidopsis confers resistance to Plutella xylostella through the accumulation of the homoterpene DMNT. Plant Cell Environ. 2023 Mar; 46(3): 946-961.). The feeding and mechanical damage of Plutella xylostella can induce the degradation of the RPX1 protein, thereby rapidly responding to pest invasion and enhancing the resistance of Arabidopsis to Lepidoptera pests.

[0039] The present invention uses wild-type Col-0 grown under long-day conditions for two weeks, the ncbp (rpx1) mutant (a homozygous mutant SALK_131503 of the Arabidopsis thaliana RPX1 gene of the T-DNA insertion type ordered from the Arashare website), the miw1 mutant, and the miw1 ncbp double mutant (the miw1 ncbp double mutant was obtained by hybridization. The miw1 mutant was used as the female parent for hybridization. It was emasculated, and the ncbp mutant was used as the male parent for hybridization. Its pollen was smeared on the stigma of the female parent. After the produced fruit pods matured, they were used as the hybrid F1 generation. After harvesting the seeds, the seeds were used as the hybrid F2 generation. Among the F2 generation hybrid seedlings after sowing, homozygous double mutants of the two genes were selected using the primer identification method) to force-feed the diamondback moth at the early stage of the second instar, and the body weight and pupation of the diamondback moth were counted. The statistical results are as Figures 3 - 4 shown. From Figure 3 and Figure 4 of the forced feeding experiment results, it can be seen that the diamondback moths fed with the MIW1 gene mutant (mutant miw1) were significantly higher than the control group Col-0 in many indicators such as body weight and pupation. The phenotype of its double mutant (miw1 ncbp) was similar to that of the ncbp (rpx1) mutant. From this, it was judged that the MIW1 gene is located upstream of the RPX1 gene; the Arabidopsis thaliana MIW1 gene can significantly affect the growth and development of the diamondback moth. The Arabidopsis thaliana mutant miw1 plants showed a sensitive phenotype to the diamondback moth, and the Arabidopsis thaliana mutant ncbp (rpx1) had an obvious resistant phenotype to the diamondback moth. In summary, it shows that the MIW1 gene is a potential functional gene for Arabidopsis thaliana to resist the diamondback moth.

[0040] 2.3. Experiment on the abundance of RPX1 protein

[0041] Based on the overexpression vector pCAMBIA1300 containing the 35S promoter, the RPX1-GFP and OE-GSTF2 vectors were constructed. Using Western blot experiments, RPX1-GFP was co-transformed with EV (Empty Vector; empty vector) and OE-MIW1 into the protoplast cells of wild-type Col-0, and the protoplast system was used to observe the abundance of the RPX1-GFP protein. The results showed that the abundance of the RPX1-GFP protein in the protoplasts co-transformed with RPX1-GFP and OE-MIW1 was significantly lower than that of the RPX1-GFP protein in the protoplasts co-transformed with the empty vector (EV) and RPX1-GFP (as Figure 5 shown), indicating that the MIW1 protein can inhibit the abundance of the RPX1 protein, and its function is to degrade the RPX1 protein after responding to the defense signal triggered by insect feeding, thereby enhancing the resistance of Arabidopsis thaliana to the lepidopteran pest diamondback moth.

[0042] 3. Conclusion

[0043] After the diamondback moth fed on the mutant miw1 material, its body weight and pupation rate were significantly higher than those of the wild type Col-0, and the mutant miw1 plants showed a sensitive phenotype to the diamondback moth. Western blot experiments showed that overexpression of the MIW1 gene could inhibit the abundance of the RPX1 protein, indicating that the MIW1 gene could mediate RPX1 resistance to the diamondback moth and participate in insect resistance by promoting the degradation of the RPX1 protein. The above results demonstrated that the Arabidopsis MIW1 gene was a functional gene that inhibited the growth and development of the lepidopteran pest diamondback moth, and the overexpressed MIW1 material had a potential toxic effect on the diamondback moth.

[0044] The above-described embodiments merely represent several implementation manners of the present invention, and the description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. A plant gene MIW1 related to resistance against Lepidoptera pests, characterized in that, The MIW1 gene is derived from Arabidopsis thaliana, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The encoded protein of the MIW1 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. Use of the MIW1 gene as claimed in claim 1 in regulating the resistance of plants to Lepidoptera pests.

4. The application according to claim 3, wherein, Overexpression of the MIW1 gene can improve the resistance of plants to Lepidoptera pests, and loss of function of the MIW1 gene can reduce the resistance of plants to Lepidoptera pests.

5. The application according to claim 4, characterized in that The plants are Arabidopsis thaliana, rapeseed, corn, rice and sorghum.

6. The application according to claim 4, wherein The Lepidoptera pest is Plutella xylostella.

7. Use of the MIW1 gene or its encoded protein as claimed in claim 1 in the preparation of a drug for controlling Lepidoptera pests.

8. The application according to claim 7, wherein The Lepidoptera pest is Plutella xylostella.

Images