Anti-freezing regulatory gene for rape and application of anti-freezing regulatory gene
The homologous gene mutants of rape BnRLCK1, BnRLCK2 and BnRLCK3 were obtained through gene editing technology, solving the problems of the complex mechanism of rape anti-freeze regulation and genome complexity, achieving the enhancement of low-temperature resistance and growth regulation of rape, and promoting the breeding of new varieties of frozen rape.
Patent Information
- Application Number
- CN202510458182.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-07-11
AI Technical Summary
In the prior art, the anti-freeze regulation mechanism of rapeseed is complex, and conventional hybrid breeding is difficult to select and breed high-quality varieties that are cold-resistant and early flowering in a short period of time. The complex genome of rapeseed leads to slow progress in the anti-freeze molecular mechanism.
The three homologous knockout mutants of cabbage-type rape BnRLCK1, BnRLCK2 and BnRLCK3 were obtained through gene editing technology. The mutants were generated by gene editing, which enhanced the low-temperature resistance of rape and regulated growth and development.
It provides new germplasm resources for the anti-freeze regulation gene of rapeseed, enhances the low-temperature resistance and root elongation ability of rapeseed, and provides a basis for cultivating new varieties of frozen rapeseed.
Smart Images

Figure CN120290603A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of agricultural biotechnology, and particularly to a rapeseed freeze-resistant regulatory gene and its application. Background Art
[0002] The damage of low temperature to plants is divided into chilling injury (0–15°C) and freezing injury (<0°C), and low temperature stress seriously affects the yield and quality of crops. In the long-term co-evolution with the environment, plants have evolved complex and precise regulatory mechanisms, among which the most important is the cold acclimation regulatory mechanism. Plants such as wheat and rye originating from temperate regions can activate cold-related genes to enhance low temperature stress and thus reduce frost damage after being exposed to non-freezing temperatures for a certain period of time for cold acclimation; after cold acclimation, when exposed to a relatively high temperature (>12°C) for a period of time, plants will lose the low temperature resistance obtained through cold acclimation, and this process is called "de-acclimation". Plant freeze resistance is a complex physiological and molecular regulatory process, involving the perception of low temperature signals, the transduction of low temperature signals, and the regulation of downstream genes. The improved low temperature resistance by cold acclimation involves gene regulatory processes at multiple levels.
[0003] In the study of the cold acclimation mechanism, in terms of signal transduction, the ICE1-CBFs-COR-mediated signal pathway has been most deeply studied. CBF transcription factors can specifically bind to the promoter elements of downstream COR genes such as RD29A, KIN, and COR15A, and regulate the expression of these downstream genes to respond to freezing stress. CBFs are themselves positively regulated by upstream transcription factors such as ICE1, CAMTA, and BZR1, and are also negatively regulated by transcription factors such as MYB, EIN3 / EIL1, and ZAT12. However, so far, in the research on the plant low temperature mechanism, three basic scientific questions have not been solved: how plants perceive low temperature signals, how low temperature signals are perceived and transduced by plant cells, and how plants balance low temperature resistance and growth and development?
[0004] RLCKs are members of the receptor-like protein kinase (RLK) subfamily and are widely involved in plant stress responses. For example, the Arabidopsis receptor protein kinase ERECTA, and the rice receptor protein kinases 25L1 and 25L2 are involved in high-temperature responses; the Arabidopsis CRLK1 / 2 and the rice CTB4a are involved in low-temperature responses. Omics studies have found that among the rice RLCKs, nearly 23% of the RLCKs are involved in stress responses including low temperature. In Arabidopsis, the cytoplasmic receptor-like protein kinase CRPK1 can be activated by low temperature. The activated CRPK1 further phosphorylates the 14-3-3 protein, and the phosphorylated 14-3-3 protein enters the nucleus to interact with CBFs, regulating plant cold resistance by modulating CBFs. We screened a mutant of the Brassica rapa cytoplasmic receptor-like kinase BrRLCK1 from the FOX-hunting mutant library of Brassica rapa constructed in our laboratory. BrRLCK1 negatively regulates the cold resistance of Brassica rapa. At the same time, we used gene editing technology to obtain knockout mutants bnrlck1 / 2 / 3 of three homologous genes, BnRLCK1, BnRLCK3, and BnRLCK3, in Brassica napus.
[0005] An in-depth understanding of the molecular mechanism of crop freezing tolerance is the basis for the molecular modular genetic improvement of crop cold (freezing) tolerance. In the research on the molecular mechanism of freezing tolerance in rapeseed, scientists at home and abroad have conducted a large number of studies from the aspects of phenotype, cell structure, and physiological and biochemical properties. However, rapeseed (Brassica napus AACC, 2n = 38) is an allopolyploid with a complex genome. In addition to genome polyploidization, it has also experienced a recent whole-genome triplication event (WGT). The complex genetic background has led to slow progress in the research on the molecular mechanism of rapeseed freezing tolerance. We screened a mutant of the Brassica rapa cytoplasmic receptor-like kinase BrRLCK1 from the cDNA FOX-hunting mutant library of Brassica rapa with specific freezing expression constructed in our laboratory. Preliminary studies have shown that BrRLCK1 in rapeseed not only negatively regulates the cold resistance of rapeseed but also regulates plant flowering and root development, indicating that BrRLCK1 is a key gene in rapeseed that balances cold resistance and growth and development. Due to the narrow germplasm resources in conventional cross-breeding, it is difficult to breed high-quality varieties with cold resistance and early flowering in a short time. Therefore, the inventors deeply studied the cold-resistant function of the BrRLCK1 gene and obtained new germplasm resources of knockout mutants bnrlck1 / 2 / 3 of three homologous genes, BnRLCK1, BnRLCK3, and BnRLCK3, in Brassica napus through gene editing technology, providing germplasm resources for the cultivation of new rapeseed varieties with freezing tolerance. Summary of the Invention
[0006] The object of the present invention is to solve the drawbacks existing in the prior art, and a rapeseed freezing resistance regulating gene and its application are proposed. Through gene editing technology, new germplasm resources of knockout mutants bnrlck1 / 2 / 3 of three homologous genes, namely BnRLCK1, BnRLCK3, and BnRLCK3 in Brassica napus, are obtained, providing germplasm resources for cultivating new rapeseed varieties with freezing resistance.
[0007] To achieve the above object, the present invention adopts the following technical solutions:
[0008] A rapeseed freezing resistance regulating gene, the rapeseed freezing resistance regulating gene includes BnRLCK1, BnRLCK2, and BnRLCK3 genes. Mutants are generated by gene editing means for the BnRLCK1, BnRLCK2, and BnRLCK3 genes of rapeseed. The sequences of the BnRLCK1, BnRLCK2, and BnRLCK3 genes are shown as SEQ ID N0.1, SEQ ID N0.2, and SEQ ID N0.3. The rapeseed freezing resistance regulating gene is prepared by gene editing from the bnrlck1 / 2 / 3 mutant. The sequences of the rapeseed freezing resistance regulating gene after editing are shown as SEQ ID N0.4, SEQ ID N0.5, and SEQ ID N0.6.
[0009] Preferably, the rapeseed freezing resistance regulating gene includes BnRLCK1, BnRLCK2, and BnRLCK3 genes. Mutants are generated by gene editing means for the BnRLCK1, BnRLCK2, and BnRLCK3 genes of rapeseed. The sequences of the BnRLCK1, BnRLCK2, and BnRLCK3 genes are shown as SEQ ID N0.1, SEQ ID N0.2, and SEQ ID N0.3. The rapeseed freezing resistance regulating gene is prepared by gene editing from the bnrlck1 / 2 / 3 mutant. The sequences of the rapeseed freezing resistance regulating gene after editing are shown as SEQ ID N0.4, SEQ ID N0.5, and SEQ ID N0.6;
[0010] The preparation method of the recombinant vector includes: separately synthesizing sgRNAs of three gene target sequences of BnRLCK1, BnRLCK2, and BnRLCK3, and ligating them to the psgR-Cas9-At vector. Each target is driven by a separate promoter, and then digested and ligated to the final vector 1300YAO, followed by sequencing verification, and then transformation and amplification verification of GV3101; for the BnRLCK1, BnRLCK2, and BnRLCK3 genes, the first target sgRNA sequence is as shown in SEQ ID NO.7, the second target sgRNA sequence is as shown in SEQ ID NO.8, and the third target sgRNA sequence is as shown in SEQ ID NO.9; the final vector to be transferred is 1300YAO, and after sequencing verification, transformation and amplification verification of GV3101 are carried out.
[0011] Preferably, the preparation method of the recombinant vector includes: separately synthesizing sgRNAs of three gene target sequences of BnRLCK1, BnRLCK2, and BnRLCK3, and ligating them to the psgR-Cas9-At vector. Each target is driven by a separate promoter, and then digested and ligated to the final vector 1300YAO, followed by sequencing verification, and then transformation and amplification verification of GV3101; for the BnRLCK1, BnRLCK2, and BnRLCK3 genes, the first target sgRNA sequence is as shown in SEQ ID NO.7, the second target sgRNA sequence is as shown in SEQ ID NO.8, and the third target sgRNA sequence is as shown in SEQ ID NO.9; the final vector to be transferred is 1300YAO, and after sequencing verification, transformation and amplification verification of GV3101 are carried out.
[0012] The present invention also discloses an application of a rapeseed freeze resistance regulation gene, and the rapeseed functional genes include one or more of the homologous genes of BnRLCK1, BnRLCK2, and BnRLCK3.
[0013] Preferably, the sequences of the three homologous genes regulating rapeseed freeze resistance are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, and the enhanced low-temperature resistance of the three homologous gene knockout mutants Bnrlck123(36-1) depends on the downstream CBFs pathway.
[0014] Preferably, the rapeseed freeze resistance regulation gene mutant bnrlck123(36-1) enhances root elongation at low temperature.
[0015] Preferably, the rapeseed freeze tolerance regulation gene is introduced into the Brassica napus variety Westar by constructing a gene editing recombinant expression vector; the recombinant expression vector can be transformed into Brassica napus cells by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroconductivity, Agrobacterium-mediated conventional biological methods, and the transformed Brassica napus tissue is cultivated into a plant to obtain three homozygous mutants of rapeseed with knockout of homologous genes.
[0016] Preferably, the method includes knocking out the homologous genes of cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in Brassica napus by gene editing technology to obtain rapeseed with strong freeze tolerance. The editing sequences are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, and the sgRNA sequences of the three gene editing target sites are as shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0018] 1. The biological functions of the homologous genes of cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in rapeseed obtained in the present invention have not been reported in rapeseed.
[0019] 2. The homologous genes of cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in rapeseed obtained in the present invention are involved in the low temperature resistance of rapeseed.
[0020] 3. The cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in rapeseed obtained in the present invention are receptor kinases and are located on the cell membrane upstream of the low temperature signal transduction. It is possible to reveal the biological events of low temperature perception in rapeseed through the cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3.
[0021] 4. The cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in rapeseed obtained in the present invention are also involved in the development process of rapeseed.
[0022] In summary, the present invention has obtained a new germplasm resource of Brassica napus mutants bnrlck1 / 2 / 3 with knockout of three homologous genes BnRLCK1, BnRLCK3, and BnRLCK3 by gene editing technology, providing germplasm resources for cultivating new varieties of freeze-tolerant rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 For the construction process of the three-target gene editing vector;
[0024] Figure 2 For the identification of Agrobacterium colonies by PCR;
[0025] Figure 3 Results of transforming hypocotyls of rapeseed by Agrobacterium - induced callus
[0026] Figure 4 PCR detection of transgenic resistant plants
[0027] Figure 5 Low - temperature phenotype and sequencing analysis of homozygous mutant bnrlck1 / 2 / 3 with knockout of BnRLCK1 homologous gene in rapeseed
[0028] Figure 6 Phenotype and growth and development characteristics of homozygous mutant bnrlck1 / 2 / 3 with knockout of BnRLCK1 homologous gene in rapeseed under low temperature
[0029] Figure 7 Low - temperature resistance results of homozygous mutant bnrlck1 / 2 / 3 with knockout of BnRLCK1 homologous gene in rapeseed
[0030] Figure 8 Root growth phenotype of homozygous mutant bnrlck1 / 2 / 3 with knockout of BnRLCK1 homologous gene in rapeseed under low - temperature stress
[0031] Figure 9 Expression results of BnRLCK1 homologous genes in rapeseed under low - temperature treatment
[0032] Figure 10 Low - temperature resistance of homozygous mutant bnrlck1 / 2 / 3 with knockout of BnRLCK1 homologous gene in rapeseed depends on the CBFs pathway Specific implementation manners
[0033] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments.
[0034] Example 1
[0035] Refer to Figures 1 - 10, A rapeseed freezing resistance regulatory gene, the rapeseed BnRLCK1, BnRLCK2, and BnRLCK3 genes are mutated by gene editing means. The sequences of the BnRLCK1, BnRLCK2, and BnRLCK3 genes are as shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. The rapeseed freezing resistance regulatory gene is prepared by gene editing of the bnrlck1 / 2 / 3 mutant. The sequences of the rapeseed freezing resistance regulatory gene after editing are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6. Three target sgRNA sequences are designed for the BnRLCK1, BnRLCK2, and BnRLCK3 genes. The first target sgRNA sequence is as shown in SEQ ID NO.7, the second target sgRNA sequence is as shown in SEQ ID NO.8, and the third target sgRNA sequence is as shown in SEQ ID NO.9.
[0036] The sgRNAs of the target sequences of the three genes BnRLCK1, BnRLCK2, and BnRLCK3 are ligated to the psgR-Cas9-At vector. Each target is driven by a separate promoter, and then digested and ligated to the final vector 1300YAO, and verified by sequencing. Then, the transformation and amplification verification of GV3101 are carried out. For the BnRLCK1, BnRLCK2, and BnRLCK3 genes, the first target sgRNA sequence is as shown in SEQ ID NO.7, the second target sgRNA sequence is as shown in SEQ ID NO.8, and the third target sgRNA sequence is as shown in SEQ ID NO.9. They are transferred into the final vector 1300YAO and verified by sequencing. Then, the transformation and amplification verification of GV3101 are carried out.
[0037] The present invention also discloses the application of a rapeseed freezing resistance regulatory gene, including the following steps:
[0038] Step S1: Transfer the recombinant vector of the above claim into Agrobacterium tumefaciens GV3101;
[0039] Step S2: Infect the hypocotyls of 7-10d rapeseed sterile seedlings with the Agrobacterium tumefaciens into which the recombinant vector has been transferred, and induce differentiation and rooting of buds, and detect the positive resistant plants by PCR.
[0040] The rapeseed functional genes include one or more of the homologous genes of BnRLCK1, BnRLCK2, and BnRLCK3.
[0041] The sequences of the three homologous genes regulating rapeseed freezing resistance are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6. The enhanced cold resistance of the three homologous gene knockout mutants bnrlck123(36-1) depends on the downstream CBFs pathway.
[0042] The rapeseed freezing tolerance regulatory gene mutant bnrlck123(36-1) enhances root elongation at low temperatures.
[0043] The rapeseed freezing tolerance regulatory gene is introduced into the Brassica napus variety Westar by constructing a gene editing recombinant expression vector; the recombinant expression vector can be transformed into Brassica napus cells by using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated conventional biological methods, and the transformed Brassica napus tissue is cultivated into a plant to obtain three homozygous mutants of rapeseed with homologous gene knockout.
[0044] The method includes knocking out the homologous genes of the Brassica napus cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 by gene editing technology to obtain rapeseed with strong freezing tolerance. The edited sequences are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, and the gene editing three-target sgRNA sequences are as shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9.
[0045] Example 2
[0046] Homologous gene search
[0047] The research group screened a low-temperature sensitive mutant from the constructed Brassica rapa–Arabidopsis FOX-hunting mutant library of Brassica rapa. Sequencing revealed that it was a mutant of the Brassica rapa cytoplasmic receptor-like kinase BrRLCK1; using the BrRLCK1 amino acid sequence for BLAST alignment in the BRAD (http: / / www.brassicadb.cn) database, three BrRLCK1 homologous genes (BnRLCK1, BnRLCK2, BnRLCK3) were identified in Brassica napus; the full-length CDS sequence of the Brassica napus BnRLCK1 gene discovered in the present invention is 1194 bp, encoding 398 amino acids, the full-length CDS sequence of the BnRLCK2 gene is 1191 bp, encoding 397 amino acids; the full-length CDS sequence of the BnRLCK3 gene is 1197 bp, encoding 399 amino acids.
[0048] Example 3
[0049] Construction of gene editing vector
[0050] Design the sgRNA gene editing sequences of three genes on the CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ) online website. The sgRNA sequence of the BnRLCK1 gene, such as SEQ ID No. 7, is used as target 1; the sgRNA sequence of the BnRLCK2 gene, such as SEQ ID No. 8, is used as target 2; the sgRNA sequence of the BnRLCK3 gene, such as SEQ ID No. 9, is used as target 3 (as Figure 1 ).
[0051] Synthesize the sgRNAs of the three gene target sequences and ligate them to the psgR-Cas9-At vector simultaneously. Each target is initiated by a separate promoter; then digest and ligate to the final vector 1300YAO (as Figure 2 ); Detect the constructed sequences of the three sgRNA vectors using the following primers:
[0052] PJ102-pYAO-seqF: 5'-GAGCTCATGGAACTACGTTG-3'
[0053] PJ102-pYAO-ba1-R: 5'-CTCTTGTGGCATGAGAAACAC-3'
[0054] PJ102-pYAO-ba2-R: 5'-TCAATGTAAGACAGAGAGACAATC-3'
[0055] PJ102-pYAO-ba3-R: 5'-TTGTACACAGAGCCAAACCC-3'
[0056] The PCR amplification reaction system is as follows:
[0057]
[0058] The PCR reaction program is as follows:
[0059] (1) 95°C for 5 min;
[0060] (2) 94°C for 30 s, 55°C for 30 s, 72°C for 15 s / kb (30 cycles);
[0061] (3) 72°C for 10 min, store at 4°C.
[0062] Example 4
[0063] Genetic transformation of rapeseed
[0064] Obtaining aseptic seedlings: Soak the seeds in sterile water for 15 min; disinfect with 75% alcohol for 60 s, disinfect with sodium hypochlorite solution (available chlorine is 2%) for 15 min, rinse with sterile water 4 times, and inoculate on 1 / 2MS + 1 mg / L 6-BA solid medium.
[0065] Preparation of explants: After 7 - 10 d, take the hypocotyls and place them in the pre-culture medium for 2 d (MS + 1 mg / L 2,4-D + 1 mg / L 6-BA pH 5.8).
[0066] Agrobacterium proliferation: Streak the glycerol bacteria on LB solid medium (50 mg / L kanamycin + 50 mg / L rifampicin). After culturing at 28°C for two days, pick a single colony and inoculate it into 5 ml LB liquid medium (containing 50 mg / L kanamycin + 50 mg / L rifampicin). Incubate at 28°C and 220 rpm with constant shaking overnight until the OD600 of the bacterial solution is about 0.6. Then centrifuge at 5000 rpm for 10 min to collect the bacteria, and resuspend the collected bacteria with MS liquid medium to OD600 = 0.4.
[0067] Agrobacterium infection and co-culture: Place the pre-cultured explants in the resuspended Agrobacterium bacterial solution, gently shake for 15 min, blot the bacterial solution on the surface of the explants with sterile filter paper, and place them on the co-culture medium (MS + 0.15 mg / L NAA + 3 mg / L 6-BA + 5 mg / L AgNO3) for dark culture for 3 d.
[0068] Transform Agrobacterium GV3101. Take out the Gv3101 competent cells and thaw them on ice; add 5 μL of plasmid, mix gently, and incubate on ice for 5 min; freeze quickly in liquid nitrogen for 5 min; incubate in a water bath at 28°C for 5 min; incubate on ice for 5 min; add 700 μL of antibiotic-free LB liquid medium, shake at 28°C for 1 - 2 h; take 400 μL of the bacterial solution and spread it on a plate (resistance: kanamycin + rifampicin), and incubate it upside down at 28°C;
[0069] Bud induction and differentiation: After co-culture, transfer the explants to the bud induction and differentiation medium (MS + 0.15 mg / L NAA + 3 mg / L 6-BA + 5 mg / L AgNO3 + 5 mg / L Hyg + 300 mg / L Timentin pH 5.8) to induce bud formation, and change the medium every two weeks.
[0070] Rooting and screening of resistant plants: When the resistant buds grow to 2 cm, cut the buds and transfer them to the rooting medium (MS + 0.15 mg / L NAA + 300 mg / L Timentin + 5 mg / L Hyg PH 5.8). When a complete small plant is formed, cut off some leaves and detect positive plants by PCR (such as Figure 2 , Figure 3 )
[0071] DNA Extraction: Use a kit to extract genomic DNA. The specific operation steps are as follows:
[0072] (1) Take about 5 mg or 0.5 cm² of plant tissue sample, cut it into small pieces, add 40 μL of PD1 Buffer, and mix well by pipetting or vortexing.
[0073] (2) Incubate at 95 °C for 10 minutes.
[0074] (3) Add 40 μL of PD2 Buffer, mix well, and use it directly as a template for PCR or store it at 4 °C or -20 °C.
[0075] B. PCR Amplification
[0076] The primer sequences for detecting 1300-pYAO-Cas9 are: The amplified fragment length is 661 bp, Tm = 54 °C
[0077] 1300-pYAO-Cas9-F: 5’-TGTTTCTCATGCCACAAGAG-3’
[0078] 1300-pYAO-Cas9-R: 5’-ACTCAATGTAAGACAGAGAGACA-3’
[0079] The PCR amplification reaction system is as follows:
[0080]
[0081] The PCR reaction program is as follows:
[0082] (1) 95 °C for 5 min;
[0083] (2) 94 °C for 30 s, 54 °C for 30 s, 72 °C for 50 s (30 cycles);
[0084] (3) 72 °C for 7 min, store at 4 °C.
[0085] Example 5
[0086] Select the T4 rapeseed bnrlck1 / 2 / 3 mutant, and sequence to identify heterozygosity and homozygosity (such as Figure 5 ); Select plump WT, bnrlck1 / 2 / 3 heterozygous, and bnrlck1 / 2 / 3 homozygous mutant seeds, and plant them in nutrient pots (nutrient soil 3: vermiculite 1;). Cultivate them at 22 °C under a 16 h light / 8 h dark condition for 30 d, or cultivate them at 4 °C under a 16 h light / 8 h dark condition for 30 d after germination, and compare and analyze growth status and development-related indicators such as chlorophyll content and fresh leaf weight (such as Figure 6 ).
[0087] Example 6
[0088] Verification of Low Temperature Resistance in Rapeseed
[0089] Select plump WT, bnrlck1 / 2 / 3 heterozygotes, and bnrlck1 / 2 / 3 homozygous mutant seeds, and plant them in nutrient pots (nutrient soil 3: vermiculite 1) at 22°C under a 16h light / 8h dark condition for 12 days. To verify the effect of cold acclimation on the low temperature resistance of rapeseed, for a part, directly conduct low temperature stress at -7°C for 2 hours and then detect the ion leakage rate, and count the survival rate after recovering growth for 3 days under the condition of 22°C, 16h light / 8h dark; in the cold acclimation experimental group, after normal growth for 12 days, first conduct cold acclimation at 4°C for 3 days, then conduct low temperature stress at -7°C for 2 hours and then detect the ion leakage rate, and count the survival rate after recovering growth for 3 days under the condition of 22°C, 16h light / 8h dark (as Figure 8 ).
[0090] Analysis of Root Growth in Rapeseed under Low Temperature Stress
[0091] After rapeseed is hydroponically grown for 3 days (22°C, 16h light / 8h dark), count the root length as the initial root length; after rapeseed is hydroponically grown for 3 days under the condition of 22°C, 16h light / 8h dark, then conduct low temperature stress at 4°C for 3 days (16h light / 8h dark), and then recover for 3 days under the condition of 22°C, 16h light / 8h dark, as the root growth under low temperature stress. Then, by comparing the initial root length with the root length after low temperature stress, calculate the elongation rate (as Figure 8 ).
[0092] Analysis of Gene Expression in Rapeseed under Low Temperature Stress
[0093] To determine whether the homologous genes of rapeseed BnRLCK1, BnRLCK2, and BnRLCK3 actively respond to low temperature stress, after rapeseed is subjected to low temperature stress at 4°C for 6 hours, extract RAN, reverse it into cDNA, and then conduct qRT-PCR expression analysis (as Figure 9 ).
[0094] The detection primers are as follows:
[0095] BnRLCK1-F: GATTTCGACGCCCTGAATAA
[0096] BnRLCK1-R: CTTGACTCAGCGGAAAGGAC
[0097] BnRLCK2-F: CGCAAGAAGCAACAAAAACA
[0098] BnRLCK2-R: CGTCGAAAACTCCGTTTAGC
[0099] BnRLCK3-F: GTCTTTGACGGAGACGAAGC
[0100] BnRLCK3-R: GACCGGTCCTTTCACTTTCA
[0101] BnACT7-F: TGGGTTTGCTGGTGACGAT
[0102] BnACT7-R: TGCCTAGGACGACCAACAATACT
[0103] To detect whether the low-temperature resistance regulated by BnRLCK1 in rapeseed is associated with downstream CBFs, after rapeseed was subjected to low-temperature stress at 4°C for 3 h, RNA was extracted, reverse-transcribed into cDNA, and then qRT-PCR expression analysis was performed (as Figure 10 ).
[0104] The detection primers are:
[0105] BnCBF1-F: AGACGCGTCACCCAATTTAC
[0106] BnCBF1-R: ATCTCGGCGGTTAGGAAAGT
[0107] BnCBF2-F: CTGGACATGGAGGAGACGAT
[0108] BnCBF2-R: GCATTCCTTCCGCCATACTA
[0109] BnCBF3-F: TTGAGGCCGAGAAGAGTGAT
[0110] BnCBF3-R: GCCATATCAGCCAACAAGGT
[0111] BnACT7-F TGGGTTTGCTGGTGACGAT
[0112] BnACT7-R TGCCTAGGACGACCAACAATACT
[0113] In this application, SEQ ID NO.1 is
[0114] ACTGACGCGTGCTTCAGATTTACGAAGACCCCTTCTTCCTTCTTCTTCATTCTTTCCCTCTCCTACTCTATTTCATCAAA
[0115] TACTTAATATCTGATATCCACACACACGCCGAGGATAAGAAGAGAGAGAGAGAGAGCGACTCTGATCGCGTAAAGTCAGA
[0116] GCCTTTTTTATACCAATTTCAACCTGCGATCTCCGAACCACTCTCTCTGAGGTGGGTTTCTCTTTCTTTCTATTTTTTCT
[0117] GAGTCTGTTTCGAGTTTTTGTTCTCAATCCTAAGAAACTCAAATTCAAAGTCGGCAGCTTTTTTTTTTAGTTGCTTTAGC
[0118] TTCTGAGGTCTTTGGGGAGTTTCTTACTTGGATAGAGATTCTATTGAGTAGTAGTAATTGGATTCGATCTTATCTCTGGT
[0119] TTACTAGTTAGAATTCAAATCTCTGAACTGGTCTCGTTTCTTTTTCTCGTGGGTAATCATTATAATTGATGGCATCAACA
[0120] GTTCACAGGTCTGTCTTATTACAATGATGGGCTCCTGTTTCTCATGCCACAAGAGTGGAGGAGAACCTTCACAAGTTGAT
[0121] AGAGGTAACATATACTACTTTTAAGCTTGGAATGTTAACTATGCATAGTCTTGTTGCTGGTTTCCTCTTAACTTGGTGTT
[0122] TGTTTATCTTTCTTGCTTACAGAAATCTCAGCGATAATTAAGGTAAAGATTTACAAATACAAAGAGATTCGTCAAGCTAC
[0123] TGATGATTTCGACGCCCTGAATAAAATTGGAGAAGGAGGGTTTGGCTCTGTGTACAAGGTAAAATGAGTAAACTCACTTC
[0124] CTTGCTACTCTCTGTCTTCATTTTTTTTTGTAACTCAAACAGTGTCAAATGATTAGGGCCGTCTTAAAGATGGAAAGATT
[0125] GCAGCTATCAAAGTCCTTTCCGCTGAGTCAAGACAAGGCGTGAAAGAGTTCTTGACTGAGATCAATGTCATATCAGAGAT
[0126] ACAGCATGAGAATCTAGTTAAGTTATATGGATGCTGCGTTGAGGGGAATCACAGGATACTTGTCTACAACTATCTGGAGA
[0127] ACAATAGCCTTGATAAGACCCTCTTAGGTGATTCTCGTAGTTTGTATGTCAGTTTCTTTAGTGTCATATTCTCAATGAAT
[0128] GAATGTTTTTTTTTTCAGCTGGGGGATACATTAAGAGTGGGATACAGTTTGATTGGAGAACTCGGTCCAGAATCTGCGTT
[0129] GGGGTTGCTAAAGGTCTTGCCTTTCTTCATGAAGAAGTAAGGCCTCACATTATTCATAGAGATATCAAGGCGAGCAACAT
[0130] TCTACTTGACAGAGACTTATCTCCCAAGATAGCTGATTTTGGACTCGCCAAGCTTATGCCGCCGAACATGACTCATGTCA
[0131] GCACTCGTGTCGCCGGTACAATGTGAGTTTCAAGCGTTTTTTTATATTCTCGCTATAAGTAAAGGTTCTTAATTAACATC
[0132] TGGTTTGTGCAGTGGTTATCTAGCGCCAGAGTATGCGGTTAGGGGACAGGTTACGCGCAAAGCTGATGTTTACAGCTATG
[0133] GAGTCCTTCTGATGGAGATAGTCAGTGCAAGAAGTAACAAAAACACACGGTTACCCCAGGGGTATCAATATCTTCTAGAA
[0134] AGAGTAAAAGTCTCTTGCCTTTTATGTTCTTTTGTAAGCTCTTTGGTTTTAGAGATATAACTTTTTTTCTTGCATTTCCA
[0135] CAGGCTTGGGATCTTTATGAGCGGAATGAGCTAGTGGATCTCGTTGACACAGGGCTAAACGGAGTCTTTGACGGAGAGGA
[0136] AGCTTGCCGGTACCTAAAAATAGGTCTTTTGTGCACGCAAGACAATCCTAAGCTAAGGCCAAGTATGTCCACGGTGGTGA
[0137] AGCTGTTAACAGGGGAGAAGAAGGATATAGAGAGCAGGAACATAACCAGACCAGGTTTGATTTCTGATTTTATGGACTTG
[0138] AAAGTGAAAGGACCGGTCGAGAAAAAGCAAGAGGAAGTGAACAGACGCAACTACTACACGAATCTTTCTTCAGATAATGC
[0139] CTCGTCTAGCACCGGGACTAGAGATAACTCGAATGCTTACTCGTCAGGGGCTTCTTCATCTACTGCGGTTTCTACACTCA
[0140] GCAGTACCATTTAGAAAAGAAAAGGAGAAACAGCTTTTTTTTTGTCTTTGATGTTTCTGTCTGTCTCATCACCTTCTTCT
[0141] TCCTTGGACCCAAACAGAAGGTTTCTTTCTGTTAGATTTTGTCTTTAGTTGCAAACAGAGATTTGTGTCATTGTGTGTAT
[0142] GTATATAAGATTGAAACCGTATCTGAATTGGTCCCCAAAAAATAGTTATGATGTCT
[0143] SEQ ID NO.2 in this application is
[0144] ATGGCAGAAACAGTTGACGGGTCTCTCTGTCTTACATTGATGGGTTGCTCCTGGTTCTCACGGAGGGGAGGAAGACCTTC
[0145] TGAAGTTGATGATGGAGGTACTTAATTAAACCAAGAGGATGATTACTAGTTTCTGAGCTTTAACTCTTCCATAGTCATGT
[0146] TACTGGCTTCCTCTAATTTTAGTGTGTTGTGTCTTTTTTTTTTTTTTGCAAAACAGGAATCGCATCGATACAAAACGTAA
[0147] AGATTTACAAATACAAAGAGATTCGTCAGGCTACAGATGATTTCAATCCCCACAATAAAATTGGTGAAGGAGGGTTTGGT
[0148] TCTGTGTACAAGGTAAATGAGAAAACACACACTCGTTTTGCACTCTTCTTATTCAAATGATCTAATTCATCTTTGCTAAC
[0149] GCTTTGGATGACTGTAGGGCCATCTTAAAGATGGAAAGATCGCAGCTATCAAAGTCCTCTCGGCTGAGTCAAGACAAGGC
[0150] GTTAGAGAGTTTTTGACTGAGATCAACGTGATATCAGAGATACAGCATGAGAATCTTGTCAAGCTTTATGGTTACTGCGT
[0151] GGAGGGGAACCACAGGATTCTCGTTTACAACTACCTCGAGAACAAGAGCCTTGACAAGACCCTTCTAGGTAACTCTCCTA
[0152] GTTTTGTTTACTCTCTATGGTGTCAGCTTATCATTTTCTAACCGAATGAATGTGTTTTTTCTTTCAGCTGGGGGATACAC
[0153] TCGGAGTGGGATACAGTTTGATTGGAGAACTCGTGCCAATATCTGCATTGGGGTTGCTAAAGGTCTTGCCTTTCTTCACG
[0154] AAGAAGTAAGGCCGCACATTATCCACAGAGATATCAAGGCGAGCAACATTCTACTTGACAGAGACTTATCCCCCAAGATC
[0155] TCTGATTTTGGACTCGCCAGGCTTATGCCACCCAACATGACTCATGTCAGCACTCGTGTCGCTGGTACAATGTGAGTTCC
[0156] TTTCTTTTTCTTTACTCTCAGCTTAAACCTTCAGGTATTTTAACATGTGTTCATATCCGTTTTGTGCAGTGGTTATTTAG
[0157] CTCCGGAGTATGCTGTTAGAGGACAGGTGACGCGTAAAGCAGATATATACAGCTTTGGAGTCCTTCTGATGGAGATAGTC
[0158] AGCGCAAGAAGCAACAAAAACACTCGGCTACCCACTGAGTATCAATATCTCCTAGAAAGAGTAAGTCATTATCTGGTCTA
[0159] GTTAGACATGTCTAAGCGTCTAAGCTCTTGTTTTGAGAGATGATAACCTTTTTCTTTTGCATTCCACAGGCTTGGGAACT
[0160] TTATGAGCGGAACGAGCTCGTGGACCTTGTCGACACAGGGCTAAACGGAGTTTTCGACGCAGAGGAAGCTTGCCGGTACC
[0161] TAAAAATCGGTCTTCTGTGCACGCAAGACAGTCCAAAGCTGAGACCAACGATGTCCACGGTGGTGAAGCTGCTCACAGGG
[0162] GAGAAGGATATAGACACAAGGAAAATAACCAGGCCGGGTTTGATATCTGATTTTATGGACTTGAAAGTGAGAGGACCCGT
[0163] GGTGGAAACAAAGCCAGACGACGAAGTGAACAGACAGAACTACACGAACCCTTCTTCTTATAATGCCTCGTCTAGCTCTG
[0164] GGACTAGAGACAACTCAAATGCTTACTCATCAGGGGCTTCATCAGCTGCTGCGGTTTCTTCGTTCAGCAGTACTATTTAG
[0165] AAAAGACAAAAAAGTGTTTTGATGTTTCATCATCTTTCTTCTTTCTTGGATGCAAACAGAGGTTTTTCTGTTAGATTTTT
[0166] GAATTGATAGGCAACTGTAAGAGAATTGAGGTTTTCTGCCTCACTCTTGTTAAGGTTGTCTTCAGTTGTAAACTAAGATT
[0167] TGAGTGTATGTATATAAGTTTGAAATCTG
[0168] SEQ ID NO.3 in this application is
[0169] ATGTGGGGCTCCTGTTTCTCATGCCACAAGAGTGGAGGAGAACCTTCACAAGTTGATAGAGGTAACATATACTAATTTAA
[0170] GCGTAACGTTTAAGCTTGGAATGTTAACTATGCATCCTCTTAACTTAGTGTTTGTTTATCTTTCTTGCATACAGAGATCT
[0171] CAGCGATAATCAAGGTAAAGATTTACAAATATAAAGAGATTCGCCAAGCTACTAATGATTTCGACGCCCTGAACAAAATT
[0172] GGAGAAGGAGGGTTTGGCTCTGTGTACAAGGTAAAATGAGAAAGCTCACTTCCTTGCTCTTCTTCTTCTCTCTTCATTTT
[0173] TTTTTTTAACTCGAACAATGTCAAATGATTAGGGCCGTCTTAAAGATGGAAATATCGCAGCTATCAAAGTCCTTTCCGCC
[0174] GAATCAAGACAAGGCGTGAAAGAGTTCTTGACTGAGATCAATGTCATATCAGAGATACAGCATGAGAATTTGGTTAAGTT
[0175] ATATGGATGCTGCGTGGAAAGGGATCACAGGATTCTTGTCTACAACTATCTCGAGAACAGTAGCCTCGACATGACGCTTC
[0176] TAGGTGATTCTCATAGTTTGTTTACTCTCTCTCTCTGTGTCAGCTTCTCTGGGGTTCTAAATGAATGAATGTTTTCAGCT
[0177] GGGGGATACATTAAGAGTGGGATACAGTTTGATTGGAGTACTCGGTCCAGAATCTGCGTTGGTGTTGCTAAAGGTCTTGC
[0178] CTTTCTTCATGAAGAAGTAAGGCCTCACATCATTCATAGAGATATCAAAGCGAGCAACATCCTACTTGACAGAGATTTAT
[0179] CTCCCAAGATAGCTGACTTTGGACTCGCCAAGCTTATGCCGCCGAACATGACTCATGTCAGCACTCGTGTCGCCGGTACA
[0180] ATGTGAGTTTCAAGCGTTTTTTTTTAATTCTCCCTATAATTAAAGGTTCTTAATTAACATGTGTTCACATCTGGTTTGTG
[0181] CAGTGGTTATCTAGCGCCAGAGTATGCGGTTAGGGGACAGGTTACGCGCAAAGCTGATGTTTACAGCTTTGGAGTCCTTC
[0182] TGATGGAGATAGTCAGTGCAAGAAGTAACAAAAACACACGGTTACCCCAGGGGTATCAATATCTTCTAGAAAGAGTAAGT
[0183] CTCTTGCCTTTTATGTTCTTTTGTAAGCTCTTTGCTTTGAGAGATAACTTTTTTCTTGCATTTCCAACAGGCTTGGGATC
[0184] TTTATGAGCGAAATGAGCTCGTGGATCTCGTCGACACAGGGCTAAACGGAGTCTTTGACGGAGACGAAGCTTGCCGGTAC
[0185] TTAAAAATAGGTCTTTTGTGCACGCAAGACAATCCTAAGCTAAGGCCAAGTATGTCCACAGTGGTGAAGCTGTTAACAGG
[0186] GGAGAAGAAGGATATAGAGAGCAGGAACATAACCAGACCGGGTTTGATTTCTGATTTTATGGACTTGAAAGTGAAAGGAC
[0187] CGGTCGAGAAAAAGCCAGAGGAAGTGAACAGACGCAGCAACTACTACACGAATCTTTCTTCAGATAATGCCTCGTCTAGC
[0188] ACCGGGACTAGAGATAACTCAAATGCTTACTCGTCAGGGGCTTCTTCATCTACTGCGGTTTCTACACTCAGCAGTACCAT
[0189] TTAGAAAAGAAAAGGAGAAAACGTTTTTTTTTTGTCTTTGATGTTTTTGTGGTCCCATCATCTTCTTCTTCTTCTTCCTT
[0190] GGACCCAAACAGAAGGTTTCTTTCTGTTAGATTTTGTCTTTAGTTGCAATCATAGATTTGTGTGTATGTATATAAGATTG
[0191] AAACCGTATCTGAATTGGTCCCCAA
[0192] SEQ ID NO.4 in this application is
[0193] ACTGACGCGTGCTTCAGATTTACGAAGACCCCTTCTTCCTTCTTCTTCATTCTTTCCCTCTCCTACTCTATTTCATCAAA
[0194] TACTTAATATCTGATATCCACACACACGCCGAGGATAAGAAGAGAGAGAGAGAGAGCGACTCTGATCGCGTAAAGTCAGA
[0195] GCCTTTTTTATACCAATTTCAACCTGCGATCTCCGAACCACTCTCTCTGAGGTGGGTTTCTCTTTCTTTCTATTTTTTCT
[0196] GAGTCTGTTTCGAGTTTTTGTTCTCAATCCTAAGAAACTCAAATTCAAAGTCGGCAGCTTTTTTTTTTAGTTGCTTTAGC
[0197] TTCTGAGGTCTTTGGGGAGTTTCTTACTTGGATAGAGATTCTATTGAGTAGTAGTAATTGGATTCGATCTTATCTCTGGT
[0198] TTACTAGTTAGAATTCAAATCTCTGAACTGGTCTCGTTTCTTTTTCTCGTGGGTAATCATTATAATTGATGGCATCAACA
[0199] GTTCACAGGTCTGTCTTATTACAATGATGGGCTCCTGTTTCTCATGCCACAAAAAGGGAGGAGAACCTTCACAAGTTGAT
[0200] AGAGGTAACATATACTACTTTTAAGCTTGGAATGTTAACTATGCATAGTCTTGTTGCTGGTTTCCTCTTAACTTGGTGTT
[0201] TGTTTATCTTTCTTGCTTACAGAAATCTCAGCGATAATTAAGGTAAAGATTTACAAATACAAAGAGATTCGTCAAGCTAC
[0202] TGATGATTTCGACGCCCTGAATAAAATTGGAGAAGGAGGGTTTGGCTCTGTGTACAAGGTAAAATGAGTAAACTCACTTC
[0203] CTTGCTACTCTCTGTCTTCATTTTTTTTTGTAACTCAAACAGTGTCAAATGATTAGGGCCGTCTTAAAGATGGAAAGATT
[0204] GCAGCTATCAAAGTCCTTTCCGCTGAGTCAAGACAAGGCGTGAAAGAGTTCTTGACTGAGATCAATGTCATATCAGAGAT
[0205] ACAGCATGAGAATCTAGTTAAGTTATATGGATGCTGCGTTGAGGGGAATCACAGGATACTTGTCTACAACTATCTGGAGA
[0206] ACAATAGCCTTGATAAGACCCTCTTAGGTGATTCTCGTAGTTTGTATGTCAGTTTCTTTAGTGTCATATTCTCAATGAAT
[0207] GAATGTTTTTTTTTTCAGCTGGGGGATACATTAAGAGTGGGATACAGTTTGATTGGAGAACTCGGTCCAGAATCTGCGTT
[0208] GGGGTTGCTAAAGGTCTTGCCTTTCTTCATGAAGAAGTAAGGCCTCACATTATTCATAGAGATATCAAGGCGAGCAACAT
[0209] TCTACTTGACAGAGACTTATCTCCCAAGATAGCTGATTTTGGACTCGCCAAGCTTATGCCGCCGAACATGACTCATGTCA
[0210] GCACTCGTGTCGCCGGTACAATGTGAGTTTCAAGCGTTTTTTTATATTCTCGCTATAAGTAAAGGTTCTTAATTAACATC
[0211] TGGTTTGTGCAGTGGTTATCTAGCGCCAGAGTATGCGGTTAGGGGACAGGTTACGCGCAAAGCTGATGTTTACAGCTATG
[0212] GAGTCCTTCTGATGGAGATAGTCAGTGCAAGAAGTAACAAAAACACACGGTTACCCCAGGGGTATCAATATCTTCTAGAA
[0213] AGAGTAAAAGTCTCTTGCCTTTTATGTTCTTTTGTAAGCTCTTTGGTTTTAGAGATATAACTTTTTTTCTTGCATTTCCA
[0214] CAGGCTTGGGATCTTTATGAGCGGAATGAGCTAGTGGATCTCGTTGACACAGGGCTAAACGGAGTCTTTGACGGAGAGGA
[0215] AGCTTGCCGGTACCTAAAAATAGGTCTTTTGTGCACGCAAGACAATCCTAAGCTAAGGCCAAGTATGTCCACGGTGGTGA
[0216] AGCTGTTAACAGGGGAGAAGAAGGATATAGAGAGCAGGAACATAACCAGACCAGGTTTGATTTCTGATTTTATGGACTTG
[0217] AAAGTGAAAGGACCGGTCGAGAAAAAGCAAGAGGAAGTGAACAGACGCAACTACTACACGAATCTTTCTTCAGATAATGC
[0218] CTCGTCTAGCACCGGGACTAGAGATAACTCGAATGCTTACTCGTCAGGGGCTTCTTCATCTACTGCGGTTTCTACACTCA
[0219] GCAGTACCATTTAGAAAAGAAAAGGAGAAACAGCTTTTTTTTTGTCTTTGATGTTTCTGTCTGTCTCATCACCTTCTTCT
[0220] TCCTTGGACCCAAACAGAAGGTTTCTTTCTGTTAGATTTTGTCTTTAGTTGCAAACAGAGATTTGTGTCATTGTGTGTAT
[0221] GTATATAAGATTGAAACCGTATCTGAATTGGTCCCCAAAAAATAGTTATGATGTCT
[0222] SEQ ID NO.5 in this application is
[0223] ATGGCAGAAACAGTTGACGGGTCTCTCTGTCTTACATTTGGGTTGCTCCTGGTTCTCACGGAGGGGAGGAAGACCTTCTG
[0224] AAGTTGATGATGGAGGTACTTAATTAAACCAAGAGGATGATTACTAGTTTCTGAGCTTTAACTCTTCCATAGTCATGTTA
[0225] CTGGCTTCCTCTAATTTTAGTGTGTTGTGTCTTTTTTTTTTTTTTGCAAAACAGGAATCGCATCGATACAAAACGTAAAG
[0226] ATTTACAAATACAAAGAGATTCGTCAGGCTACAGATGATTTCAATCCCCACAATAAAATTGGTGAAGGAGGGTTTGGTTC
[0227] TGTGTACAAGGTAAATGAGAAAACACACACTCGTTTTGCACTCTTCTTATTCAAATGATCTAATTCATCTTTGCTAACGC
[0228] TTTGGATGACTGTAGGGCCATCTTAAAGATGGAAAGATCGCAGCTATCAAAGTCCTCTCGGCTGAGTCAAGACAAGGCGT
[0229] TAGAGAGTTTTTGACTGAGATCAACGTGATATCAGAGATACAGCATGAGAATCTTGTCAAGCTTTATGGTTACTGCGTGG
[0230] AGGGGAACCACAGGATTCTCGTTTACAACTACCTCGAGAACAAGAGCCTTGACAAGACCCTTCTAGGTAACTCTCCTAGT
[0231] TTTGTTTACTCTCTATGGTGTCAGCTTATCATTTTCTAACCGAATGAATGTGTTTTTTCTTTCAGCTGGGGGATACACTC
[0232] GGAGTGGGATACAGTTTGATTGGAGAACTCGTGCCAATATCTGCATTGGGGTTGCTAAAGGTCTTGCCTTTCTTCACGAA
[0233] GAAGTAAGGCCGCACATTATCCACAGAGATATCAAGGCGAGCAACATTCTACTTGACAGAGACTTATCCCCCAAGATCTC
[0234] TGATTTTGGACTCGCCAGGCTTATGCCACCCAACATGACTCATGTCAGCACTCGTGTCGCTGGTACAATGTGAGTTCCTT
[0235] TCTTTTTCTTTACTCTCAGCTTAAACCTTCAGGTATTTTAACATGTGTTCATATCCGTTTTGTGCAGTGGTTATTTAGCT
[0236] CCGGAGTATGCTGTTAGAGGACAGGTGACGCGTAAAGCAGATATATACAGCTTTGGAGTCCTTCTGATGGAGATAGTCAG
[0237] CGCAAGAAGCAACAAAAACACTCGGCTACCCACTGAGTATCAATATCTCCTAGAAAGAGTAAGTCATTATCTGGTCTAGT
[0238] TAGACATGTCTAAGCGTCTAAGCTCTTGTTTTGAGAGATGATAACCTTTTTCTTTTGCATTCCACAGGCTTGGGAACTTT
[0239] ATGAGCGGAACGAGCTCGTGGACCTTGTCGACACAGGGCTAAACGGAGTTTTCGACGCAGAGGAAGCTTGCCGGTACCTA
[0240] AAAATCGGTCTTCTGTGCACGCAAGACAGTCCAAAGCTGAGACCAACGATGTCCACGGTGGTGAAGCTGCTCACAGGGGA
[0241] GAAGGATATAGACACAAGGAAAATAACCAGGCCGGGTTTGATATCTGATTTTATGGACTTGAAAGTGAGAGGACCCGTGG
[0242] TGGAAACAAAGCCAGACGACGAAGTGAACAGACAGAACTACACGAACCCTTCTTCTTATAATGCCTCGTCTAGCTCTGGG
[0243] ACTAGAGACAACTCAAATGCTTACTCATCAGGGGCTTCATCAGCTGCTGCGGTTTCTTCGTTCAGCAGTACTATTTAGAA
[0244] AAGACAAAAAAGTGTTTTGATGTTTCATCATCTTTCTTCTTTCTTGGATGCAAACAGAGGTTTTTCTGTTAGATTTTTGA
[0245] ATTGATAGGCAACTGTAAGAGAATTGAGGTTTTCTGCCTCACTCTTGTTAAGGTTGTCTTCAGTTGTAAACTAAGATTTG
[0246] AGTGTATGTATATAAGTTTGAAATCTG
[0247] SEQ ID NO.6 in this application is
[0248] ATGTGGGGCTCCTGTTTCTCATGCCACAAGAGTGGAGGAGAACCTTCACAAGTTGATAGAGGTAACATATACTAATTTAA
[0249] GCGTAACGTTTAAGCTTGGAATGTTAACTATGCATCCTCTTAACTTAGTGTTTGTTTATCTTTCTTGCATACAGAGATCT
[0250] CAGCGATAATCAAGGTAAAGATTTACAAATATAAAGAGATTCGCCAAGCTACTAATGATTTCGACGCCCTGAACAAAATT
[0251] GGAGAAGGAGGGTTTGGCTCTGGGTACAAGGTAAAATGAGAAAGCTCACTTCCTTGCTCTTCTTCTTCTCTCTTCATTTT
[0252] TTTTTTTAACTCGAACAATGTCAAATGATTAGGGCCGTCTTAAAGATGGAAATATCGCAGCTATCAAAGTCCTTTCCGCC
[0253] GAATCAAGACAAGGCGTGAAAGAGTTCTTGACTGAGATCAATGTCATATCAGAGATACAGCATGAGAATTTGGTTAAGTT
[0254] ATATGGATGCTGCGTGGAAAGGGATCACAGGATTCTTGTCTACAACTATCTCGAGAACAGTAGCCTCGACATGACGCTTC
[0255] TAGGTGATTCTCATAGTTTGTTTACTCTCTCTCTCTGTGTCAGCTTCTCTGGGGTTCTAAATGAATGAATGTTTTCAGCT
[0256] GGGGGATACATTAAGAGTGGGATACAGTTTGATTGGAGTACTCGGTCCAGAATCTGCGTTGGTGTTGCTAAAGGTCTTGC
[0257] CTTTCTTCATGAAGAAGTAAGGCCTCACATCATTCATAGAGATATCAAAGCGAGCAACATCCTACTTGACAGAGATTTAT
[0258] CTCCCAAGATAGCTGACTTTGGACTCGCCAAGCTTATGCCGCCGAACATGACTCATGTCAGCACTCGTGTCGCCGGTACA
[0259] ATGTGAGTTTCAAGCGTTTTTTTTTAATTCTCCCTATAATTAAAGGTTCTTAATTAACATGTGTTCACATCTGGTTTGTG
[0260] CAGTGGTTATCTAGCGCCAGAGTATGCGGTTAGGGGACAGGTTACGCGCAAAGCTGATGTTTACAGCTTTGGAGTCCTTC
[0261] TGATGGAGATAGTCAGTGCAAGAAGTAACAAAAACACACGGTTACCCCAGGGGTATCAATATCTTCTAGAAAGAGTAAGT
[0262] CTCTTGCCTTTTATGTTCTTTTGTAAGCTCTTTGCTTTGAGAGATAACTTTTTTCTTGCATTTCCAACAGGCTTGGGATC
[0263] TTTATGAGCGAAATGAGCTCGTGGATCTCGTCGACACAGGGCTAAACGGAGTCTTTGACGGAGACGAAGCTTGCCGGTAC
[0264] TTAAAAATAGGTCTTTTGTGCACGCAAGACAATCCTAAGCTAAGGCCAAGTATGTCCACAGTGGTGAAGCTGTTAACAGG
[0265] GGAGAAGAAGGATATAGAGAGCAGGAACATAACCAGACCGGGTTTGATTTCTGATTTTATGGACTTGAAAGTGAAAGGAC
[0266] CGGTCGAGAAAAAGCCAGAGGAAGTGAACAGACGCAGCAACTACTACACGAATCTTTCTTCAGATAATGCCTCGTCTAGC
[0267] ACCGGGACTAGAGATAACTCAAATGCTTACTCGTCAGGGGCTTCTTCATCTACTGCGGTTTCTACACTCAGCAGTACCAT
[0268] TTAGAAAAGAAAAGGAGAAAACGTTTTTTTTTTGTCTTTGATGTTTTTGTGGTCCCATCATCTTCTTCTTCTTCTTCCTT
[0269] GGACCCAAACAGAAGGTTTCTTTCTGTTAGATTTTGTCTTTAGTTGCAATCATAGATTTGTGTGTATGTATATAAGATTG
[0270] AAACCGTATCTGAATTGGTCCCCAA
[0271] SEQ ID NO.7 in this application is
[0272] TGTTTCTCATGCCACAAGAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0273] SEQ ID NO.8 in this application is
[0274] TCTCTCTGTCTTACATTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0275] SEQ ID NO.9 in this application is
[0276] GGTTTGGCTCTGTGTACAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
[0277] SEQ ID NO.10 in this application is
[0278] GAGCTCATGGAACTACGTTG
[0279] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. An antifreeze regulation gene of rapeseed, characterized in that, The rapeseed freeze tolerance regulatory genes include BnRLCK1, BnRLCK2, and BnRLCK3 genes. Mutants are generated for the rapeseed BnRLCK1, BnRLCK2, and BnRLCK3 genes by gene editing means. The sequences of the BnRLCK1, BnRLCK2, and BnRLCK3 genes are as shown in SEQ ID N0.1, SEQ ID N0.2, and SEQ ID N0.
3. The rapeseed freeze tolerance regulatory gene is prepared by gene editing from the Bnrlck1 / 2 / 3 mutant. The sequences of the rapeseed freeze tolerance regulatory gene after editing are as shown in SEQ ID N0.4, SEQ ID N0.5, and SEQ ID N0.
6.
2. The rape freeze resistance regulating gene according to claim 1, characterized in that The rapeseed freeze tolerance regulatory gene further includes a recombinant vector. Three target sgRNA sequences are designed for the BnRLCK1, BnRLCK2, and BnRLCK3 genes. The first target sgRNA sequence is as shown in SEQ ID N0.7, the second target sgRNA sequence is as shown in SEQ ID N0.8, and the third target sgRNA sequence is as shown in SEQ ID N0.
9. The preparation method of the recombinant vector includes: separately synthesizing the sgRNAs of the target sequences of the BnRLCK1, BnRLCK2, and BnRLCK3 genes, and ligating them to the psgR-Cas9-At vector. Each target is initiated by a separate promoter, and then digested and ligated to the final vector 1300YAO and verified by sequencing. Then, transformation and amplification verification of GV3101 are carried out. For the BnRLCK1, BnRLCK2, and BnRLCK3 genes, the first target sgRNA sequence is as shown in SEQ ID N0.7, the second target sgRNA sequence is as shown in SEQ ID N0.8, and the third target sgRNA sequence is as shown in SEQ ID N0.
9. The final vector to be transferred is 1300YAO, and after sequencing verification, transformation and amplification verification of GV3101 are carried out.
3. The rapeseed freeze resistance regulation gene according to claim 1, characterized in that, The rapeseed freeze tolerance regulatory gene further includes a method for regulating rapeseed freeze tolerance. The method for regulating rapeseed freeze tolerance includes: Step S1: Transfer the recombinant vector of the above claim into Agrobacterium tumefaciens GV3101. Step S2: Infect the hypocotyls of 7 - 10-day-old sterile rapeseed seedlings with the Agrobacterium tumefaciens into which the recombinant vector has been transferred, and induce bud differentiation, root formation, and perform PCR detection on positive resistant plants.
4. An application of a rapeseed freeze tolerance regulatory gene, where the rapeseed functional genes include one or more of the homologous genes of BnRLCK1, BnRLCK2, and BnRLCK3.
5. Use of a rape frost resistance regulation gene according to claim 4, characterized in that, The sequences of the 3 homologous genes regulating rapeseed freeze tolerance are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.
6. The enhanced low-temperature resistance of the 3 homologous gene knockout mutant Bnrlck123(36 - 1) depends on the downstream CBFs pathway.
6. Use of a rapeseed freeze resistance regulating gene according to claim 4, characterized in that, The rapeseed freeze tolerance regulatory gene mutant Bnrlck123(36 - 1) enhances root elongation at low temperature.
7. Use of a rape freeze resistance regulatory gene according to claim 4, characterized in that, The rapeseed freeze tolerance regulatory gene is introduced into the Brassica napus variety westar by constructing a gene editing recombinant expression vector; the recombinant expression vector can be transformed into Brassica napus cells by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroconductivity, Agrobacterium-mediated conventional biological methods, and the transformed Brassica napus tissues are cultivated into plants to obtain three homozygous mutants of rapeseed with knockout of homologous genes.
8. Use of a rape freezing resistance regulating gene according to claim 4, characterized in that, The method includes knocking out the homologous genes of the cytoplasmic receptor-like kinases BnRLCK1, BnRLCK2, and BnRLCK3 in Brassica napus by gene editing technology to obtain rapeseed with strong freeze tolerance. The editing sequences are as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, and the gene editing three-target sgRNA sequences are as shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9.
Citation Information
Cited By
Receptor-like kinase MaHPCA1 and application thereof in relieving banana cold injury
CN121472267A