Overexpression plasmid containing gene MvGMC1 and application thereof

Abstract

The invention discloses an overexpression plasmid containing a gene MvGMC1 and application of the overexpression plasmid, in the overexpression plasmid containing the gene MvGMC1, the nucleotide sequence of the gene MvGMC1 is as shown in SEQ ID NO: 1, and the nucleotide sequence of the gene MvGMC1 is as shown in SEQ ID NO: 2. The enzyme activity of the glucose-methanol-choline oxidoreductase expressed by the overexpression plasmid containing the gene MvGMC1 is higher than the enzyme activity of the glucose-methanol-choline oxidoreductase expressed by the M.verruca wild type strain.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and particularly relates to an overexpression plasmid containing gene MvGMC1 and its application. Background Art

[0002] Glucose-methanol-choline oxidoreductase is one of the important coenzymes for lignin degradation. Gene MvGMC1 exists in Myrothecium verrucaria MU-16 and can express glucose-methanol-choline oxidoreductase to improve the performance of Myrothecium verrucaria MU-16 in degrading lignin. However, the existing gene MvGMC1 has a low expression level in Myrothecium verrucaria MU-16, resulting in a low degradation rate of lignin by Myrothecium verrucaria MU-16. Summary of the Invention

[0003] The main object of the present invention is to propose an overexpression plasmid containing gene MvGMC1 and its application. The overexpression vector pBARGPE1-Hygro and gene MvGMC1 are fused to form an overexpression plasmid, realizing the overexpression of gene MvGMC1, aiming to solve the problem that the existing gene MvGMC1 has a low expression level in Myrothecium verrucaria MU-16, resulting in a low degradation rate of lignin by Myrothecium verrucaria MU-16.

[0004] To achieve the above object, the present invention proposes an overexpression plasmid containing gene MvGMC1, and the nucleotide sequence of the gene MvGMC1 is as shown in SEQ ID NO:1.

[0005] Optionally, the amino acid sequence of the protein encoded by the gene MvGMC1 is as shown in SEQ ID NO:2.

[0006] Optionally, it includes an overexpression vector that has been digested by an enzyme, and the overexpression vector is pBARGPE1-hygro.

[0007] Optionally, the enzymes for digesting the overexpression vector include restriction endonucleases EcoR I and Kpn I.

[0008] The present invention provides an application of the overexpression plasmid containing gene MvGMC1 in improving the degradation rate of lignin by Myrothecium verrucaria.

[0009] The present invention provides an engineered bacterium, which includes the overexpression plasmid containing gene MvGMC1 described above.

[0010] Optionally, the overexpression plasmid containing gene MvGMC1 is transformed into Myrothecium verrucaria to construct the engineered bacterium.

[0011] In the technical solution provided by the present invention, an overexpression plasmid containing the gene MvGMC1 is provided. The nucleotide sequence of the gene MvGMC1 is shown in SEQ ID NO: 1. The enzyme activity of the glucose-methanol-choline oxidoreductase expressed by the overexpression plasmid containing the gene MvGMC1 is higher than that of the glucose-methanol-choline oxidoreductase expressed by the wild-type strain of M. verrucaria. Description of the Drawings

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.

[0013] Figure 1 PCR amplification electrophoresis diagram of the gene MvGMC1 provided in Example 1 of the present invention;

[0014] Figure 2 PCR verification electrophoresis diagram of the transformed Escherichia coli DH5α bacterial solution provided in Example 1 of the present invention;

[0015] Figure 3 Double digestion verification electrophoresis diagram of the recombinant plasmid provided in Example 1 of the present invention;

[0016] Figure 4 PCR verification electrophoresis diagram of the recombinant plasmid pPICZαB provided in Example 2 of the present invention;

[0017] Figure 5 PCR verification electrophoresis diagram of the bacterial solution of Escherichia coli containing the plasmid pBARGPE1-hygro-MvGMC1 provided in Example 2 of the present invention;

[0018] Figure 6 Double digestion verification diagram of the plasmid pBARGPE1-Hygro-MvGMC1 provided in Example 2 of the present invention;

[0019] Figure 7 PCR verification diagram of the transformed strain containing the plasmid pBARGPE1-Hygro-MvGMC1 provided in Example 2 of the present invention;

[0020] Figure 8 Standard curve diagram of alkali lignin provided in one embodiment of the present invention;

[0021] Figure 9 PCR verification diagrams of 10 transformants provided in one embodiment of the present invention;

[0022] Figure 10 Gene expression level diagram of M. verrucaria original bacteria and MvGMC1 positive transformants fermented for 96 h provided by an embodiment of the present invention;

[0023] Figure 11 Enzyme activity diagram of M. verrucaria original bacteria and MvGMC1 transformants fermented for 96 h provided by an embodiment of the present invention;

[0024] Figure 12 Alkaline lignin removal rate diagram of wild-type strain and engineered bacteria provided by an embodiment of the present invention. Detailed implementation manners

[0025] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0026] Glucose-methanol-choline oxidoreductase is one of the important coenzymes for lignin degradation. There is a gene MvGMC1 in Myrothecium verrucaria MU-16, which can express glucose-methanol-choline oxidoreductase to assist Myrothecium verrucaria MU-16 in degrading lignin. However, the existing gene MvGMC1 has a low expression level in Myrothecium verrucaria MU-16, resulting in a low degradation rate of lignin by Myrothecium verrucaria MU-16.

[0027] In view of this, the present invention proposes an overexpression plasmid containing the gene MvGMC1, and the nucleotide sequence of the gene MvGMC1 is as shown in SEQ ID NO:1. Integrating the gene MvGMC1 into the overexpression vector achieves the effect of overexpressing the target gene. The enzyme activity of the glucose-methanol-choline oxidoreductase expressed by the overexpression plasmid containing the gene MvGMC1 in this application is higher than that of the glucose-methanol-choline oxidoreductase expressed by the M. verrucaria wild-type strain.

[0028] Specifically, the MvGMC1 gene sequence is ATGGTGCGACAGGCACTCTCCGCTTTTTTCCTTCTCTGCTCAACATGGGCAGCTCAAGCCGTCGACCTAGACGGCTATGAGTACATCGTTGTCGGATCGGGTCCTGGAGGAGGCCCTCTCGCCGCACGCCTGGCCCTCGCCGGGCACAAAACGCTTCTCATTGACGCTGGCAGCGACCAAGGCAACAACTATAATTATTCTGTTCCTGCGTACCACGCAATTGCCTCGGAGGACCCCGATATGTCATGGAACTTCTTCGTGCGGCATTACGCAGACGATAAGCAGCAGGCCCGCGACTTTAAGACGACCTATGATACCCCCGACGGTGGCTTGTACACAGGACTGGACCCTCCAGCCGGGTCCAAAATTAAAGGCGTGCTTTATCCCCGAGTCGGCGCGCTGGGAGGTTGCAGTGCCCACAACGCTCAGATTCAAGTGTACCCCTTCCGGTCCGACTTCGATCAAATCGCTCAACTTACGGGCGACTCATC

[0029] GTGGTCTGCCGACAAACTTCGAAAGCACTATACGCGTCTCGAAGAAAAC

[0030] CATCATCTTTTGCCTCTGAAGCCTGGCCACGGTTACAGTGGTTGGCTCGG

[0031] CGTCGATACCGCACCCGTCAGTCTAGTGCTTCAAGACCCGCAGCTTCTC

[0032] AGTCTTGTGTTAGGAGGCGCATTTGCGCTCGGAAATCTCACGGATACTGT

[0033] TTTCAATCTGGTTACCCTCCTAGCCGGCGATATAAATTCGAACTCGGGCG

[0034] ATCGCGATAAGGAGCCTGGCTTCTTTCAGGTTCCTCTTACTACGACTGCA

[0035] GATGGCGTTCGCAATGGAGCCCGCGAGTTTGTCCTTAGCGTGAGGGATG

[0036] CCAAAAACAGCGACGGTTCTAAGAAATATCCTCTCGATGTGCGCCTCAA

[0037] TTGCCACGTTACCAAAGTTGTCTTTGACAAGACAGTAACTCCTCCGCGA

[0038] GCCACAGGCGTTGAGTTTCTCGATGGCGCTCATTTGTACAGGGCAAGCC

[0039] CGCTCTCCAGCAAGGCGAAAGCTGGCGTGCCTGGATCCGCCAAGGCAT

[0040] CGCGCGAGGTTATTCTCTCTGGAGGAAGCTACAACACCCCTCAGATTTT

[0041] GAAACTGAGTGGTGTGGGACCGGCTCAAGAACTCAAGCGATTTGGCAT

[0042] TCCGATTGTGGCTGATCGGCCAGGTGTTGGAACAAATTTACAGGACCGT

[0043] TACGAAGTCGTCGTTGTTAGCGAGACTCCATCTAACCTGACCTTGCTGG

[0044] ACGGTTGCACCTTTAGCCTCCACGGCCAGGCCGACCCGTGCCTTGAGAG

[0045] GTGGAAGAAGCCAAACCTTCTGGGGGACCGCGGCATCTACCAGACAAG

[0046] TGGAGCTGCTGCCGCTATGATTCTACCATCATCGGTTTCAGAGCGAGGCG

[0047] ATTTTGACTTGTTCGTTTTTGCAACTGTCGCTGGGTTTACTGGATACTATC

[0048] CTGGGTATAGTGTAGATGCTGTCACTCCGCGAAATCGGTTCAGCTGGGCT

[0049] ATCCTCAAGGGCCAGTCGCGTAACCAAGCCGGTGCCGTTACTCTACGCT

[0050] CGTCAGATCCTCTCGATGTGCCAGACATTCAGTTCAACTACTTCGCACAA

[0051] GGTGGTGATAAAGATCTCCAAGCAGTTTACGAGGGCGTCAAGTTGGGTC

[0052] GAGAAGCTTTCCAGAGACAGTTCGTTGACGTGACGGAAGAGTTGCCCG

[0053] GCGACAAGGTACAGTCAGAAGAAGATATTAAAAGATACATTCGCGACAC

[0054] AGCTTGGGGGCATCATGCATCCAGCACATGTCCTATAGGCAAAGACAAC

[0055] GACCCTCTGGCTGTCCTCGACTCCAAATTTAGAGTCAGAGGCGTTCAGG

[0056] GCTTGCGGGTTGTAGACGCATCAGTATTTCCGAACATTCCTGGCACTTTT

[0057] ATTGCAGCAGCCATATACACGATATCAGAAAAGGCGGCGGAAGATATTTT

[0058] AGGAGATATCAGGTGA。

[0059] Furthermore, the amino acid sequence of the protein encoded by the gene MvGMC1 is shown in SEQ ID NO:2. Specifically, the amino acid sequence is MVRQALSAFFLLCSTWAAQAVDLDGYEYIVVGSGPGGGPLAARLALAGHKTLLIDAGSDQGNNYNYSVPAYHAIASEDPDMSWNFFVRHYADDKQQARDFKTTYDTPDGGLYTGLDPPAGSKIKGVLYPRVGALGGCSAHNAQIQVYPFRSDFDQIAQLTGDSSWSADKLRKHYTRLEENHHLLPLKPGHGYSGWLGVDTAPVSLVLQDPQLLSLVLGGAFALGNLTDTVFNLVTLLAGDINSNSGDRDKEPGFFQVPLTTTADGVRNGAREFVLSVRDAKNSDGSKKYPLDVRLNCHVTKVVFDKTVTPPRATGVEFLDGAHLYRASPLSSKAKAGVPGSAKASREVILSGGSYNTPQILKLSGVGPAQELKRFGIPIVADRPGVGTNLQDRYEVVVVSETPSNLTLLDGCTFSLHGQADPCLERWKKPNLLGDRGIYQTSGAAAAMILPSSVSERGDFDLFVFATVAGFTGYYPGYSVDAVTPRNRFSWAILKGQSRNQAGAVTLRSSDPLDVPDIQFNYFAQGGDKDLQAVYEGVKLGREAFQRQFVDVTEELPGDKVQSEEDIKRYIRDTAWGHHASSTCPIGKDNDPLAVLDSKFRVRGVQGLRVVDASVFPNIPGTFIAAAIYTISEKAAEDILGDIR。

[0060] Furthermore, it includes an overexpression vector that has been digested by an enzyme, and the overexpression vector is pBARGPE1-hygro.

[0061] Understandably, the overexpression vector is integrated with the gene MvGMC1 after digestion to form the overexpression plasmid containing the gene MvGMC1 in this application. This overexpression plasmid can increase the expression level of the gene MvGMC1 and can be stably passed on to the next generation. Among them, the overexpression vector pBARGPE1-hygro carries the strong promoters gpdA and TrpC.

[0062] Furthermore, the enzymes for digesting the overexpression vector include restriction endonucleases EcoR I and Kpn I, and the expression vector is digested to create a nick for integration with gene MvGMC1.

[0063] The present invention provides an application of the overexpression plasmid containing gene MvGMC1 in increasing the degradation rate of lignin by Mycogone perniciosa.

[0064] Among them, the enzyme activity of glucose-methanol-choline oxidoreductase expressed by wild Mycogone perniciosa is lower than that expressed by Mycogone perniciosa containing the overexpression plasmid. Therefore, Mycogone perniciosa containing the overexpression plasmid with gene MvGMC1 has an increased degradation rate of lignin.

[0065] The present invention provides an engineered bacterium comprising the overexpression plasmid containing gene MvGMC1.

[0066] The engineered bacterium has all the beneficial effects of the aforementioned overexpression plasmid containing gene MvGMC1, which will not be elaborated one by one here.

[0067] Furthermore, the overexpression plasmid containing gene MvGMC1 is transformed into Mycogone perniciosa to construct the engineered bacterium.

[0068] The technical solutions of the present invention will be further described in detail below in conjunction with specific examples and drawings. It should be understood that the following examples are only used to explain the present invention and are not used to limit the present invention.

[0069] Experimental materials

[0070] Reverse transcription kit, Takara, PrimeScript RT reagent Kit with gDNA Eraser(Perfect Real Time);

[0071] Fungal genomic DNA extraction kit, Solarbio, D2300-50T;

[0072] YEB liquid medium: 5 g of tryptone, 1 g of yeast extract, 0.49 g of Mg2SO4·7H2O, 5 g of beef extract, 5 g of sucrose, add water to make up to 1 L, adjust the pH to 7.0 with NaOH solution, and store at 4°C after autoclaving in a water bath.

[0073] IM liquid medium: Add 0.8 mL of phosphate buffer, 20 mL of MN buffer, 1 mL of 1% CaCl₂ solution, 10 mL of 0.01% FeSO₄ solution, 5 mL of IM trace element solution, 2.5 mL of 20% NH₄NO₃ solution, 10 mL of 50% glycerol solution, and 40 mL of 1M MES solution to 1 L of water. When the temperature drops to about 60 °C, add acetosyringone to make the final concentration of the solution 0.2 mM;

[0074] MM medium: Weigh 15 g of agar, add 957 mL of deionized water, mix well, sterilize by high-pressure water bath, and then add 20 mL of ASP+N solution, 20 mL of 50% glucose solution, 2 mL of 1M MgSO₄ solution, and 1 mL of MM trace element solution in a UV ultra-clean workbench. When the temperature drops to about 60 °C, add hygromycin B to a final concentration of 100 μg / mL and cefotaxime to a final concentration of 0.2 mM. After mixing, store at 4 °C in a petri dish for later use;

[0075] LB solid medium: Dissolve 5 g of yeast extract, 10 g of tryptone, 10 g of sodium chloride, and 15 g of agar powder in 1 L of water.

[0076] Example 1: Cloning of glucose-methanol-choline oxidoreductase gene MvGMC1

[0077] A gene MvGMC1 predicted to encode glucose-methanol-choline oxidoreductase was screened from the whole gene sequence of Myrothecium verrucaria MU-16. Primers were designed according to the information of this glucose-methanol-choline oxidoreductase gene for amplifying the relevant gene fragment in MU-16. The primers include the MvGMC1-F base sequence (CGGAATTCCGACAGG CACTC TCCGCTT) as shown in SEQ ID No: 3, and the MvGMC1-R base sequence (GCGGTACCTA TCTTCCGCCG CCTTTTC) as shown in SEQ ID No: 4.

[0078] After culturing the MU-16 strain for 3 d, total RNA was extracted and its quality was inspected by agarose gel electrophoresis; then the total RNA was immediately reverse-transcribed using a reverse transcription kit to obtain cDNA, and PCR amplification was performed to obtain the target fragment. The result was identified by gel electrophoresis, as shown in Figure 1 , from Figure 1 it can be seen that a clear band appeared at the size of the target band, proving that the target fragment was successfully amplified. In Figure 1 , M: Marker DL12000; Lane 1: Target gene. The target fragment was recovered using a gel recovery kit and stored at -20 °C.

[0079] Using pMD-19T as the cloning vector, the vector was double-digested with EcoR I and Kpn I and then ligated with the target fragment using T4 ligase overnight at 16°C. It was transformed into Escherichia coli DH5α by heat shock transformation method. Escherichia coli DH5α was cultured in LB solid medium containing ampicillin resistance. Newly transformed single colonies were picked from the LB solid medium containing ampicillin resistance. Two single colonies were picked and cultured in LB medium. The bacterial liquid of the transformed Escherichia coli DH5α was verified by PCR. The results are as Figure 2 shown, Figure 2 wherein, M: Marker DL12000; Lanes 1-2: Verification by bacterial liquid PCR. There was no band at the size of the target band in Lane 1, indicating that the transformation was unsuccessful. The remaining 1 transformant was a positive transformant. Subsequently, the successfully verified strain was cultured, and the plasmid was extracted and verified by double digestion with EcoR I and Kpn I. The results are as Figure 3 shown. The obtained bands were consistent with the expected target band size, indicating that the recombinant plasmid was successfully constructed and stored. Among them, Figure 3 wherein, M: MarkerDL12000; Lane 1: Double digestion verification of pMD-19T-MvGMC1 plasmid. After proving successful construction, the plasmid was sent to the company for sequencing (Sangon Biotech), and the results were compared using DNAman software to analyze whether nucleotide site mutations occurred in the cloned target gene.

[0080] Example 2 Transformation of Gene MvGMC1

[0081] 2.1 Construction of Overexpression Plasmid

[0082] The MvGMC1 cloning vector constructed in Example 1 was activated and then the plasmid was extracted. The target gene MvGMC1 and the overexpression vector pBARGPE1-hygro were digested with the restriction endonucleases EcoRI and Kpn I. Agarose gel electrophoresis was performed and the digested products were recovered. Then, the MvGMC1 fragment double-digested with EcoR I and Kpn I and the overexpression vector pBARGPE1-hygro were ligated with T4 ligase overnight at 16°C. The recombinant overexpression plasmid was verified by PCR. The results are as Figure 4 shown. The target band was clear and the size was correct. Among them, M: Marker DL12000; Lane: Target fragment. The ligation product was transformed into Escherichia coli DH5α and stored. The transformed strains with positive verification by bacterial liquid PCR were saved. The results are as Figure 5 shown. A bright and clear band appeared at 1935 bp, and no miscellaneous bands appeared, which was consistent with the expected target band size. Among them Figure 5Among them, M: Marker DL5000; Lane 1: Verification by bacterial liquid PCR. To exclude the possibility of false positives, the grown pBARGPE1-Hygro-MvGMC1 positive transformants were amplified, preserved, and the plasmids were extracted for double digestion verification. The results are as Figure 6 shown. After double digestion, agarose gel electrophoresis showed clear and bright single bands at 5992 bp and 1935 bp. The former is the target band of the overexpression vector, and the latter is the MvGMC1 target band. The band sizes are consistent with the expected sizes. Among them, Figure 6 M: Marker 15000 bp; Lane 1: pBARGPE1-Hygro-MvGMC1. The successfully verified plasmid was sent to Sangon Biotech for sequencing, and the results were analyzed using DNAman, showing no mutation sites, proving that the overexpression vector pBARGPE1-Hygro-MvGMC1 was successfully constructed.

[0083] 2.2 Transformation of Agrobacterium tumefaciens EHA105 by freeze-thaw method of overexpression plasmid

[0084] Escherichia coli DH5α containing the pBARGPE1-hygro-MvGMC1 overexpression plasmid was amplified and the plasmid was extracted, and it was transformed into Agrobacterium tumefaciens EHA105 by the freeze-thaw method. The specific operations include:

[0085] a. Take out the Agrobacterium competent cells at -80°C, and insert them on ice after partial thawing;

[0086] b. Add the target plasmid to the Agrobacterium competent cells and mix well, let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a water bath at 37°C for 5 min, and in an ice bath for 5 min;

[0087] c. Add 700 μL of antibiotic-free YEB liquid medium, resuscitate at 28°C and 200 rpm for 2 - 3 h to obtain the resuscitation solution;

[0088] d. Spread the resuscitation solution on a YEB plate containing the corresponding antibiotic, incubate it upside down at 28°C for 2 - 3 d. After single colonies of the transformants grow, perform bacterial liquid PCR verification. The results are as Figure 7 shown. A clear and bright single band appears at 1935 bp, which is consistent with the expected result size, proving that the overexpression plasmid was successfully transferred into Agrobacterium rhizogenes EHA105. The Agrobacterium rhizogenes EHA105 containing pBARGPE1-Hygro-MvGMC1 was co-cultured with the original M. verrucaria using the Agrobacterium rhizogenes transformation method (ATMT) so that Agrobacterium rhizogenes EHA105 could infect M. verrucaria to achieve the purpose of transformation.

[0089] 2.3 Transformation of Myrothecium verrucaria mediated by Agrobacterium tumefaciens EHA105

[0090] a. Incubate M. verrucaria on a PDA plate at 28 °C until fresh spores grow. Wash the spores with sterile water and prepare a solution with a concentration of 1×10 5 spores / mL;

[0091] b. Inoculate the previously obtained positive transformants (Agrobacterium tumefaciens EHA105 transformed with the overexpression plasmid screened in step 2.2) into YEB liquid medium containing 25 μg / mL rifampicin and 100 μg / mL ampicillin for culture. After taking an appropriate amount of the bacterial solution and centrifuging to discard the supernatant, transfer the bacterial cells to IM liquid medium and culture at 28 °C and 160 rpm until OD 600 = 0.5 - 0.8.

[0092] c. Take 100 μL of the solutions from step a and step b respectively, mix them evenly, coat and culture on IM medium (containing 0.2 M AS) covered with cellophane. After co-culturing in the dark at 22.5 °C for 72 h, transfer the cellophane to MM medium containing hygromycin resistance (200 μg / mL) and cefotaxime (0.2 mmol / L) and culture at 30 °C.

[0093] Performance measurement

[0094] 3.1 Screening and verification of transformants

[0095] Co-culture Agrobacterium tumefaciens EHA105 and M. verrucaria in an incubator at 30 °C for 4 d, and observe the colonies with hygromycin B resistance growing on the surface of MM medium. Randomly pick the transformants for rescreening in MM medium with hygromycin B resistance, and extract the genomic DNA of the transformants using a fungal genomic DNA extraction kit for PCR verification. Use the genomic DNA of wild-type M. verrucaria as a negative control. Select the strains with correct PCR verification results and store them frozen in 50% glycerol.

[0096] 3.2 Real-time quantitative PCR detection of the expression level of glucose-methanol-choline oxidoreductase gene

[0097] Use a reverse transcription kit to remove the genomic DNA mixed in the total RNA of the overexpression engineering bacteria and reverse transcribe it into cDNA. Using cDNA as a template, use a fluorescence quantitative kit to perform real-time fluorescence quantitative detection of the expression level of the glucose-methanol-choline oxidoreductase gene. After the reaction, use the 2 -ΔΔCt method to calculate the relative expression level of the target gene for expression level analysis. Select 18S RNA as the internal reference control for gene expression level.

[0098] 3.3 Determination of glucose dehydrogenase activity

[0099] The oxidized state solution of 2,6-dichlorophenolindophenol (DCIP) is blue, and the reduced state solution is colorless. It has an absorbance at OD 600 . The activity of glucose dehydrogenase is calculated by the change in absorbance value in the reaction system. Under certain conditions, the amount of enzyme required to oxidize 1 μmol of glucose in 1 min is defined as one enzyme activity unit (U):

[0100] First, determine the DCIP standard curve. Prepare DCIP standard solutions with different concentrations using potassium phosphate buffer, measure their absorbance values at 600 nm, plot the standard curve, and perform regression analysis using software to obtain the millimolar extinction coefficient. Then, determine the activity of glucose dehydrogenase. The reaction conditions are to pre-mix 10 mmol / L 2,6-dichlorophenolindophenol, 100 mmol / L potassium phosphate solution at pH 6.0, 1.0 mol / L D-glucose, and 3.0 mmol / L N-methylphenazine methosulfate and preheat for 10 min. Then add the enzyme solution preheated at 25 °C. The control group uses potassium phosphate buffer instead of the enzyme solution, and measure the OD 600 value. The calculation formula is as follows:

[0101]

[0102] where: Vt - total volume of the reaction solution (mL); Vs - volume of the enzyme solution added (mL); ΔA / Δt - change in absorbance per minute; ε - molar extinction coefficient (ε 600 = 4.0114 L·(mmol·cm) -1 ); I - optical path of the microplate strip (cm).

[0103] 3.4 Determination of lignin degradation rate

[0104] a. Alkaline lignin standard curve

[0105] Prepare a 1 g / L alkaline lignin solution, perform a full wavelength scan at wavelengths from 200 to 400 nm to determine that the maximum absorption wavelength of alkaline lignin is 230 nm. Prepare alkaline lignin standard solutions with concentrations of 20, 40, 60, 80, and 100 mg / L by dilution. Measure the absorbance A of the standard solutions at 230 nm, and perform regression of the concentration C (mg / L) against A based on the measured values to obtain the regression equation of alkaline lignin as: y = 0.00534x + 0.03353 (R 2 = 0.9972). See the standard curve in Figure 8 .

[0106] b. Calculation of alkaline lignin removal rate

[0107] The absorbance of alkali lignin in the fermentation broth of each strain was measured at 230 nm using a multifunctional microplate reader. The content of alkali lignin in the culture medium was calculated according to the standard curve of alkali lignin, and the removal rate of alkali lignin was calculated according to the following formula:

[0108] Alkali lignin removal rate = (C1 - C2) / C1 x 100%

[0109] Where: C1 - the content of alkali lignin in the medium without inoculation; C2 - the content of alkali lignin in the medium after degradation by the strain.

[0110] Results

[0111] 4.1 Screening and identification of transformants

[0112] According to the pBARGPE1-Hygro plasmid map, Hygromycin B is a fungal screening resistance marker for the overexpression vector, and cefotaxime has the effect of inhibiting the growth of Agrobacterium tumefaciens. Therefore, the co-cultured mixed strains were transferred to MM medium containing hygromycin B and cefotaxime resistance for multiple generations of screening. Finally, 10 stable genetic positive transformants were obtained. To exclude the possibility of false positives of these 10 transformants, we re-activated and amplified the 10 transformants on PDA plates, and then extracted their genomic DNA for PCR verification. The results are as Figure 9 shown. Among them, clear and obvious bands appeared in 6 lanes, and the sizes were consistent with the expected bands. No target bands appeared in the other 4 lanes, which proved that 4 out of the 10 M.verrucaria overexpression transformants were false positives. The 6 positive transformants were sent to Sangon Biotech for sequencing. Through sequence alignment with the DNAman software, the correct alignment results indicated that the construction of M.verrucaria overexpression transformants was successful. They were named MvGMC1-1, MvGMC1-2, MvGMC1-3, MvGMC1-4, MvGMC1-5, and MvGMC1-6 in turn, and fresh spores were stored in a -80°C refrigerator.

[0113] 4.2 Fluorescent quantitative analysis of the overexpression level of glucose-methanol-choline oxidoreductase gene in positive transformants

[0114] The gene expression level of MvGMC1 in 6 M.verrucaria overexpression transformants was measured by real-time fluorescence quantitative PCR. The original M.verrucaria and positive transformants were cultured for 96 h, and total RNA was extracted using the Trizon kit. The stably inherited 18sRNA of M.verrucaria was used as an internal reference gene, and reverse transcription and real-time fluorescence quantification were performed using the RT-qPCR kit. The results are as Figure 10As shown in the figure. Compared with the wild type of M.verrucaria, the expression level of MvGMC1 in the transformants MvGMC1-4 and 1-6 increased significantly, which were 2.94 times and 3.38 times that of the wild type respectively; while the transcriptional levels of MvGMC1-3 and 1-5 were almost the same as those of the original M.verrucaria, with no significant difference; the expression levels of MvGMC1-1 and 1-2 were even lower than those of the wild type gene.

[0115] 4.3 Determination of Glucose Dehydrogenase Activity

[0116] Six MvGMC1 transformants were fermented for 96 h, and the glucose dehydrogenase activity was measured. The glucose dehydrogenase activities of the original M.verrucaria and the six overexpression transformants are as Figure 11 shown. The enzyme activity of the original strain was 277.86 U / L. The glucose dehydrogenase activity of the overexpression transformant MvGMC1-6, which had the highest enzyme activity, reached as high as 693.57 U / L after 96 h of fermentation, an increase of 2.5 times. The result was consistent with the trend of the real-time fluorescence quantitative results. The failure to reach the transcriptional level increase might be because the fermentation medium and the excessive glucose dehydrogenase in the cells inhibited the expression instead, and finally reached an equilibrium level.

[0117] 4.4 Determination of Alkaline Lignin Degradation Rate

[0118] The overexpression strain MvGMC1-6 with the highest enzyme activity was used for the analysis of lignin degradation rate, with the wild type strain as the control. The results are as Figure 12 shown. As Figure 12 can be seen, under the alkaline lignin culture conditions, within 0 - 84 h, the removal of alkaline lignin by the wild type strain and the engineered bacteria showed a rapid increase trend, and reached the maximum values at 84 h and 96 h respectively, and then tended to be stable. The highest degradation rate of alkaline lignin by the wild type strain was 36.73%, while the maximum degradation rate of the engineered bacteria with overexpressed genes was as high as 58.69%, which was 59.78% higher than that of the wild type strain. This indicates that overexpressing the glucose-methanol-choline oxidoreductase gene MvGMC1 in M.verrucaria can effectively improve the lignin degradation ability of the strain.

[0119] The above are only the preferred embodiments of the present invention, and do not limit the patent scope of the present invention accordingly. For those skilled in the art, the present invention can have various changes and modifications. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the patent protection scope of the present invention.

Claims

1. An overexpression plasmid containing the gene MvGMC1, characterized in that, The nucleotide sequence of the gene MvGMC1 is shown in SEQ ID NO:

1.

2. The overexpression plasmid containing the gene MvGMC1 according to claim 1, wherein, The amino acid sequence of the protein encoded by the gene MvGMC1 is shown in SEQ ID NO:

2.

3. The overexpression plasmid containing the gene MvGMC1 as described in claim 1, characterized in that It includes an overexpression vector that has been digested by an enzyme, and the overexpression vector is pBARGPE1-hygro.

4. The overexpression plasmid containing the gene MvGMC1 according to claim 3, characterized in that, The enzymes for digesting the overexpression vector include the restriction enzymes EcoR I and Kpn I.

5. Use of the overexpression plasmid containing the gene MvGMC1 according to any one of claims 1-4 in increasing the degradation rate of lignin by Myrothecium verrucaria.

6. An engineered bacterium, characterized in that, It includes the overexpression plasmid containing the gene MvGMC1 according to any one of claims 1-4.

7. The preparation method of the engineering bacteria according to claim 6, characterized in that, Transform the overexpression plasmid containing the gene MvGMC1 into Myrothecium verrucaria.

Images