Application of gene knockout animal model in male sterility research

By constructing a mouse model of MTR4 knockout, the problem of studying the cause of non-obstructive azoospermia was solved, and the important role of the MTR4 gene in the mice was revealed, providing a new direction for the study of male infertility mechanisms.

CN120290641AInactive Publication Date: 2025-07-11INNER MONGOLIA MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510487012.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-07-11
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The prior art is difficult to study the causes of non-obstructive azoospermia (NOA), especially the molecular biological basis of sperm production disorders, which leads to ineffective assisted reproductive technology in NOA patients.

Method used

A mouse model of MTR4 knockout was constructed, and the MTR4 gene on the mouse genome was knocked out through CRISPR/Cas technology, and an azoospermia mouse model was established to study the mechanism of male infertility.

Benefits of technology

An animal model of male animal loss of reproductive ability was successfully constructed, revealing the important role of the MTR4 gene in the sperm production process in mice, and providing new ideas for the study of male infertility mechanisms, especially the regulatory mechanism of azoospermia.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention discloses application of a gene knockout animal model in male sterility research, and belongs to the technical field of transgenosis. The invention provides a construction method of an azoospermia mouse model, the construction method is characterized in that an MTR4 gene on a mouse genome is knocked out, and the knockout is carried out by utilizing CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / Cass). The important function of the MTR4 gene in the spermatogenesis process of mice is disclosed for the first time, testis dysplasia and azoospermia occur in male mice with MTR4 knockout, and a testis development regulation mechanism of MTR4 is expected to provide a new thought for research of a male infertility mechanism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of transgenic technology, and particularly to the application of a gene knockout animal model in the study of male infertility. Background Art

[0002] Infertility is a common disease that poses a major threat to human health, and its incidence has been continuously rising in recent years. This disease is defined as a couple who fails to conceive successfully for more than one year while maintaining normal sexual life and not using any contraceptive measures. The causes of male infertility are extremely complex, involving multiple aspects such as the anatomical structure of the reproductive system, functional abnormalities, infections, endocrine disorders, and genetic factors.

[0003] Azoospermia is an important cause of male infertility, accounting for 10% to 15% of male infertility patients. The diagnostic criterion for azoospermia is that after semen is centrifuged, the precipitate is observed under a microscope, and sperm are not found in three consecutive observations. Clinically, azoospermia can be divided into two categories: obstructive azoospermia (OA) and non-obstructive azoospermia (NOA). NOA is usually caused by testicular spermatogenic dysfunction, resulting in reduced or complete absence of sperm production. In recent years, the progress of assisted reproductive technology has brought hope for fertility to some OA patients, but NOA patients are difficult to benefit from it due to the absence of sperm. Therefore, in-depth study of the causes of NOA, especially the molecular biological basis of spermatogenesis disorders, and revealing the regulatory mechanism of sperm production have important clinical significance for understanding the causes of idiopathic male infertility. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of a gene knockout animal model in the study of male infertility to solve the problems existing in the above-mentioned prior art. The present invention first reveals the important role of the MTR4 gene in the spermatogenesis process of mice. Male mice with MTR4 knockout show testicular dysplasia and azoospermia. The mechanism by which MTR4 regulates testicular development is expected to provide new ideas for the study of the mechanism of male infertility.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] Technical Solution 1: A method for constructing an azoospermia mouse model, wherein the construction method is to knockout the MTR4 gene on the mouse genome, and the knockout is carried out using CRISPR / Cas.

[0007] Furthermore, the nucleotide sequence of the MTR4 gene is as shown in SEQ ID NO: 1.

[0008] Furthermore, the mouse is a C57BL / 6J mouse.

[0009] Furthermore, the knockout is: injecting the in vitro constructed gRNA into the fertilized egg to knockout the MTR4 gene.

[0010] Further, the construction method further includes genotyping the obtained mice by PCR using specific primers.

[0011] Further, the nucleotide sequences of the specific primers are as shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0012] Technical solution 2: Application of the azoospermia mouse model constructed by the described construction method in the preparation of male infertility research products.

[0013] The present invention discloses the following technical effects:

[0014] The present invention discloses the application of a gene knockout animal model in male infertility research. This gene is usually used in the treatment of tumors and is rarely applied in reproduction. The present invention has successfully constructed an animal model with progressive loss of male reproductive ability, providing a model for the study of progressive loss of animal reproductive ability and having valuable scientific research value. Moreover, the present invention for the first time reveals the important role of the MTR4 gene in the spermatogenesis process of mice. Male mice with MTR4 knockout show testicular dysplasia and azoospermia. The mechanism by which MTR4 regulates testicular development is expected to provide new ideas for the study of male infertility mechanisms. Detailed implementation manners

[0015] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation manners of the present invention.

[0016] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0017] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0018] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0019] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0020] Example 1

[0021] Expression of MTR4 in various tissues and its expression pattern in testis

[0022] Lung, muscle, kidney, brain, liver, and testis tissues of 90-day-old wild-type C57BL / 6J mice were obtained, RNA was extracted respectively, and the expression level of MTR4 gene was detected by qPCR.

[0023] The nucleotide sequence of MTR4 is shown as follows:

[0024]

[0025] The results showed that MTR4 was highly expressed in the testis. Testis tissues of wild-type mice at 2w, 3w, 4w, 5w, 6w, 7w, and 8w were obtained, proteins were extracted, and western blot was performed for detection. The results showed that MTR4 was highly expressed in the testes of 2-week-old and 3-week-old mice, and its expression was lower at 4 - 8 weeks of age. Immunohistochemical staining of MTR4 was performed using paraffin sections of testes from 90-day-old wild-type mice. The results showed that MTR4 was expressed in spermatogonia, pachytene spermatocytes, leptotene spermatocytes, and Sertoli cells.

[0026] Example 2

[0027] 1. Construction of an MTR4 knockout mouse model (C57BL / 6)

[0028] To further clarify the role of MTR4 in testicular development, Cyagen Biosciences in Guangzhou was commissioned to construct an MTR4 knockout mouse model using CRISPR / Cas gene editing technology.

[0029] gRNAs were designed with exons 1 and 2 of MTR4 as targets; the in vitro constructed gRNAs were injected into fertilized eggs for MTR4 gene knockout. The sequence of the gRNA is as follows: TGGGTTCATTGTAATCGTACAGG (SEQ ID NO: 2).

[0030] Example 3 Genotyping of Mice

[0031] Primers were designed to identify the genotypes of the mice obtained in Example 2. The nucleotide sequences of the primers are as follows:

[0032] Forward sequence: GCCTTATTTGCCACGGAGACCT (SEQ ID NO: 3);

[0033] Reverse sequence: TCCTTCCAGCACGACCAGACAT (SEQ ID NO: 4).

[0034] 2. Genotyping of 10-day-old neonatal mice

[0035] A small amount of mouse tail tissue was obtained, and DNA was extracted using the Mouse Direct PCR Kit (Bimake, B40015). PCR was performed using the HotStart enzyme PCR reaction system. A 3% agarose gel was prepared for DNA electrophoresis. The results of the electrophoresis map for mouse genotype identification showed that wild-type mice had only a 730-bp band, homozygous mice had only an 890-bp band, and heterozygous mice had both 890-bp and 730-bp bands. The PCR reaction system was as follows: ddH2O 20.35 μL; dNTP Mix 1.5 μL; 10x buffer 3 μL; HSTaq 0.15 μL; upstream primer 1 μL; downstream primer 1.5 μL; DNA template 1.5 μL. The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, for 35 cycles; extension at 72°C for 1 min; full extension at 72°C for 10 min; storage temperature at 12°C.

[0036] Example 4 Mouse Phenotype Identification

[0037] There were no differences in the body weights of P0 mice (the day of mouse birth was recorded as P0 day), and there were also no differences in body weights at P40 days. There were no obvious differences in the testis sizes of P0 mice with different genotypes. From P14 days, there were no obvious differences in the testes of homozygous mice compared with heterozygous and wild-type mice. From P21 days, the testis weights of homozygous mice were lower than those of wild-type and heterozygous mice, while there were no obvious differences in the testis weights of heterozygous and wild-type mice. Therefore, heterozygous mice and wild-type mice were used as control mice. HE sections of the testes of P90-day-old mice showed that sperm appeared in the spermatogenic epithelium of the testes of control mice, while no sperm production was observed in the spermatogenic epithelium of KO mice (homozygous MTR4 - / - mice), and there were no secondary meiotic cells such as round spermatids and secondary spermatocytes, suggesting that the testes of KO mice failed to enter the second meiotic division. There were degenerated tubules in the testes of KO mice, and apoptotic cells could be observed.

[0038] Further examination of the epididymis, the site of sperm maturation, found that the epididymis of control mice was filled with sperm, while only some cell debris was observed in the epididymis of KO mice, and no sperm were observed, suggesting that KO mice were azoospermic mice. Since a large number of cells were missing in the degenerated spermatogenic tubules in the HE sections of the testes of KO mice, proliferation and apoptosis were further detected. Tunnel chromosome indicated that a large number of apoptotic signals appeared in the testis sections of KO mice. PCNA (Proliferating Cell Nuclear Antigen) immunohistochemical detection indicated that there were no obvious differences in the proliferation signals in the testis sections of control mice and KO mice; MVH is a marker molecule for germ cells, and its immunohistochemistry indicated that a large number of germ cells were missing in the testes of KO mice. Therefore, it is suggested that the apoptosis of germ cells in the testes of KO mice led to the loss of a large number of germ cells, which also explained why the testis weight of KO mice was lower than that of control mice.

[0039] To clarify the reason for azoospermia in KO mice, qPCR was used to further detect the marker molecules at various stages of meiosis, such as Stra8 (differentiated spermatogonia), Sycp3 (pachytene spermatocytes of the first meiotic division), Dkkl1 (pachytene spermatocytes of the first meiotic division), and Tnp1 (spermatids). The results showed that the marker molecule sycp3 of the first meiotic division was downregulated in KO mice, while the marker molecules Dkkl1 of pachytene spermatocytes of the first meiotic division and Tnp1 of spermatids were not detected. It was suggested that the testes of testicular KO mice could enter the first meiotic division but could not enter the second meiotic division, that is, the meiosis of KO mouse testes was blocked at the first meiotic stage.

[0040] To further clarify the reason for the failure of meiosis in KO mice, we obtained the testes of 56-day-old mice and performed a chromosome spreading experiment to detect the formation of synaptonemal complex (SC) in the prophase of the first meiotic division, where Sycp3 and Sycp1 were used as marker molecules of SC. Meiosis has a series of special and ordered chromosomal behaviors. In chronological order, the chromosomal behaviors in the first meiotic division include: the formation of the lateral axis of the synaptonemal complex and the cohesion between sister chromatids, the pairing, synapsis, recombination, and separation of homologous chromosomes, etc. According to the morphology of the synaptonemal complex, the prophase of the first meiotic division is divided into leptotene, zygotene, pachytene, diplotene, and diakinesis. The results showed that there were no pachytene cells in KO mice, suggesting that the synapsis of pachytene spermatocytes of the first meiotic division in KO mice failed, and the chromosomes could not synapse completely, thus failing to enter the pachytene stage.

[0041] To clarify the reason for the failure of KO mice to enter the pachytene stage, we next detected the signal of γ-H2AX. During the first meiotic division, under the action of the SPO11 molecule, DNA double-strand breaks (DSBs) appear on the chromosomes. The formation of DSBs induces the formation of γ-H2AX signals. By the pachytene stage, the γ-H2AX signals are only present in the sex vesicle region, and the γ-H2AX signals on autosomes disappear as the DSBs are repaired. Our results showed that there were no significant differences in the γ-H2AX signals between control mice and KO mice at the leptotene and zygotene stages. After entering the pachytene stage, the γ-H2AX signals in control mice were only present in the sex vesicle region, while the γ-H2AX signals in KO mice were still present on autosomes, suggesting that the repair of DSBs failed, resulting in the inability to clear the DSB signals from autosomes.

[0042] To further detect the formation and recombination of meiotic DSBs, we next detected the RPA2 signal. The results showed that there was no significant difference in the RPA2 signal between control mice and KO mice at the leptotene and zygotene stages. However, at the pachytene stage, the RPA2 signal in KO mice was significantly higher than that in control mice, indicating that the clearance of RPA2 was blocked at the pachytene stage. After entering the late pachytene stage, DSB recombination leads to the formation of crossovers. As a marker of crossover, we further detected the MLH1 signal and found that no crossovers were formed in KO mice.

[0043] In summary, the present invention first reveals the important role of the MTR4 gene in mouse spermatogenesis. Male mice with MTR4 knockout show testicular dysplasia and azoospermia. The mechanism by which MTR4 regulates testicular development is expected to provide new ideas for the study of the mechanism of male infertility.

[0044] The embodiments described above are only used to describe the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an azoospermia mouse model, characterized in that, The construction method is to knockout the MTR4 gene on the mouse genome, and the knockout is carried out using CRISPR / Cas.

2. The construction method according to claim 1, characterized in that, The nucleotide sequence of the MTR4 gene is shown as SEQ ID NO:

1.

3. The construction method according to claim 1, wherein, The mouse is a C57BL / 6J mouse.

4. The construction method according to claim 1, characterized in that, The knockout is: injecting the in vitro constructed gRNA into the fertilized egg to knockout the MTR4 gene.

5. The construction method according to claim 1, characterized in that The construction method further includes genotyping the obtained mice by PCR using specific primers.

6. The construction method according to claim 5, wherein The nucleotide sequences of the specific primers are shown as SEQ ID NO: 3 and SEQ ID NO:

4.

7. Application of the azoospermia mouse model constructed by the construction method according to any one of claims 1-6 in the preparation of male infertility research products.