Real-time fluorescent RT-qPCR detection method for viable bacteria of maize bacterial wilt germs

Abstract

The invention relates to the technical field of agricultural biology, and discloses a real-time fluorescent RT-qPCR detection method for viable bacteria of maize bacterial wilt germs, which comprises the following steps: S1, screening key genes; s2, designing a primer and a probe of a key gene; s3, evaluating the stability of the key gene mRNA after inactivation, and determining a target gene; the target gene is a LexA gene with a nucleotide sequence as shown in SEQ ID NO: 1; and S4, establishing a real-time fluorescent RT-qPCR detection method by adopting the primer and the probe corresponding to the target gene screened in the step S3. The efficient and accurate real-time fluorescent RT-qPCR detection method established by the invention has good specificity and sensitivity, and the sensitivity of detecting the mRNA of the PSS LexA gene is 1000 times that of a conventional RT-PCR method; the method can be used for quickly judging the condition that the PSS live bacteria are carried in an actual sample, and can provide powerful technical support for quarantine and prevention and control of PSS epidemic situations.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a real-time fluorescence RT-qPCR detection method for viable cells of Pantoea stewartii subsp. stewartii (PSS). Background Art

[0002] Pantoea stewartii subsp. stewartii (PSS) is a vascular wilt pathogen. Diseased plants are dwarfed or wilted, which can cause huge yield losses to maize, especially sweet maize production. Therefore, establishing an efficient and sensitive PSS detection method is very important for the early diagnosis and scientific prevention and control of this disease.

[0003] Currently, the detection of PSS at home and abroad is mainly based on DNA-based molecular biology methods, such as ordinary PCR, nested PCR, multiplex PCR, real-time fluorescence qPCR, RPA, etc. However, these methods cannot distinguish between viable and dead PSS in samples, and false positive results are likely to occur. Although there is a prior art that established a detection method combining DNA dye PMA with real-time fluorescence qPCR to distinguish between viable and dead PSS cells, this method has complex pretreatment, requiring steps such as preparing suspension, incubation, and photolysis, and PMA may not completely inhibit the DNA of dead cells, resulting in false positive results, which is limited in practical popularization and application.

[0004] In recent years, RT-PCR technology targeting RNA has shown great application prospects in the field of viable cell detection of medical diseases and food microorganisms. Currently, there is no reported viable cell detection method for plant pathogenic bacteria based on RNA as a target.

[0005] Through comparative genomic analysis of PSS and its closely related species, the present invention screens out species-specific expressed genes, predicts their functions, screens suitable mRNA target genes, and evaluates the stability of mRNA after inactivation, thereby establishing a real-time fluorescence RT-qPCR detection method for viable cells of PSS, aiming to solve the problem of being unable to distinguish between dead and viable bacteria in molecular detection and provide technical support for quarantine and prevention and control. Summary of the Invention

[0006] The purpose of the present invention is to provide a real-time fluorescence RT-qPCR detection method for viable cells of Pantoea stewartii subsp. stewartii, so as to solve the problem of being unable to distinguish between dead and viable bacteria in the detection of Pantoea stewartii subsp. stewartii.

[0007] To achieve the above purpose, the technical solution of the present invention is as follows:

[0008] The present invention provides a real-time fluorescence RT-qPCR detection method for viable cells of Pantoea stewartii subsp. stewartii, comprising the following steps:

[0009] S1. Screen key genes;

[0010] S2. Design primers and probes for key genes;

[0011] S3. Evaluate the stability of key genes after mRNA inactivation to determine target genes;

[0012] The target gene is the LexA gene with a nucleotide sequence as shown in SEQ ID NO: 1;

[0013] S4. Establish a real-time fluorescence RT-qPCR detection method using the primers and probes corresponding to the target genes screened in step S3.

[0014] Preferably, the primers corresponding to the target gene include:

[0015] The upstream primer LexA-1F with a nucleotide sequence as shown in SEQ ID NO: 2 and the downstream primer LexA-1R with a nucleotide sequence as shown in SEQ ID NO: 3.

[0016] Preferably, the probe used in combination with the primers described in claim 2 is the probe LexA-1P with a nucleotide sequence as shown in SEQ ID NO: 4.

[0017] Preferably, the reaction system of the real-time fluorescence RT-qPCR contains: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of 10 μmol / L upstream and downstream primers and probes, 1.0 μL of RNA template, and RNase Free dH2O is added to make up to 20 μL.

[0018] Preferably, the reaction program of the real-time fluorescence RT-qPCR is: reverse transcription at 42°C for 5 min; pre-denaturation at 94°C for 10 s; denaturation at 94°C for 5 s, annealing at 60°C for 60 s, for 40 cycles.

[0019] Preferably, the screening of key genes specifically is: download the genomic and encoded amino acid sequence data of the PSS strain and 4 closely related species that have completed chromosomal-level assembly in the GenBank database, perform whole-genome homologous gene clustering analysis based on the online software OrthoVenn2 to screen out the gene clusters unique to PSS, and according to the gene function annotation results, screen out the key genes related to replication, transcription or metabolism.

[0020] Preferably, the PSS strain is DC283, and the four closely related species are P. stewartii subsp. indologenes strain LMG 2671, P. agglomerans strain FDAARGOS 1447, P. allii strain PNA, and P. ananatis strain PA13.

[0021] The present invention also provides an application of a real-time fluorescence RT-qPCR detection method for viable cells of Pantoea stewartii subsp. stewartii in detecting viable cells of Pantoea stewartii subsp. stewartii in corn seeds.

[0022] The sequences involved in the solution of the present invention are as follows:

[0023] LexA gene SEQ ID NO.1:

[0024] GTGGAACAACTGACTGACACGCAGCAGCGCACGCTGGATTTCATCCGGGGCTATATCCGGGAAAACGGTCTGTCGCCAACCATTGCTGAGATTGCGGAAGGTATGGGGTGGAGGTCGCCTAACTCAGCGCAGATTCACGTCAACGCTTTGCAGCAAAAAGGAAGACTGAAGGTAAAGCGGGGAGCCAATCGGGGAATAGTGCTCACGACCACCAGCTTTGATTGTAACAATCTGGCACTGGAAACAGCCGTGCGTATTATGGGGATCATTGAGAAAGCAAAATGCGAGAAAGAGTTGTGGCCTGACTTGCGTCTGCAAGCCGCCATTCATACTGAAGTGATTAATTTAATGATAAAGGGAGTAGTGTAA;

[0025] Upstream primer LexA-1F SEQ ID NO.2:

[0026] CTATATCCGGGAAAACGGTCTGTC;

[0027] Downstream primer LexA-1R SEQ ID NO.3:

[0028] GTTACAATCAAAGCTGGTGGTCG;

[0029] Probe LexA-1P SEQ ID NO.4:

[0030] FAM-ACCCCATACCTTCCGCAATCTCAGCAA-BHQ1。

[0031] In summary, compared with the prior art, the solution of the present invention has the following beneficial effects:

[0032] 1. The present invention determines that the Lex gene can be used as a candidate target gene for detecting the activity of Pantoea stewartii subsp. stewartii. A suitable target gene is the primary condition for establishing a viable bacteria detection method, which should be stably expressed in viable bacteria and the expression should disappear rapidly after inactivation. The half-life of rRNA is relatively long, and it can still be detected for a long time after heat-inactivated bacteria, while the half-life of mRNA is short and it will rapidly degrade after inactivation. Therefore, mRNA is more suitable as a detection target for activity. Through genomic comparative analysis, the present invention screens mRNA genes related to replication, transcription, and metabolic activity, and evaluates their stability after inactivation. It is found that 16S rRNA and 15 kinds of mRNA can still be detected by real-time fluorescence RT-qPCR after 72 hours of inactivation, and only the Lex gene is completely degraded after 12 hours.

[0033] 2. Different from directly selecting common mRNA genes as detection targets, the present invention uses a genomic comparison analysis method to screen out the specific genes of PSS, solving the problem of identifying the high genetic similarity between PSS and its closely related species. Specificity analysis also proves that the real-time fluorescence RT-qPCR method established with LexA as the target can effectively amplify PSS, and there is no amplification reaction for its closely related species and other 18 strains of plant pathogenic bacteria, showing good specificity.

[0034] 3. Since PSS is mainly spread over long distances through infected seeds, the most effective method to effectively control the spread of this pathogen is to use healthy seeds. The present invention detects the viable and dead bacteria of maize seeds artificially infected with PSS. The results show that the DNA-based real-time fluorescence qPCR method gives a positive result for detecting the inactivated infected seeds, while the real-time fluorescence RT-qPCR method established by the present invention is consistent with the traditional isolation and culture method. Viable PSS bacteria can be isolated from the infected seeds with a positive detection result, while viable PSS bacteria cannot be isolated from the inactivated infected seeds with a negative detection result. However, the traditional isolation and culture method takes more than 4 days. In contrast, the real-time fluorescence RT-qPCR method is simpler and faster, only taking 2 hours. Therefore, the real-time fluorescence RT-qPCR method established in this study has significant advantages for detecting viable PSS bacteria carried in maize seeds.

[0035] 4. An efficient and accurate real-time fluorescence RT-qPCR detection method established by the present invention has good specificity and sensitivity, and can quickly determine the presence of viable PSS bacteria in actual samples, providing strong technical support for the quarantine and prevention and control of PSS epidemics. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is the orthologous clustering analysis result of Pantoea stewartii subsp. stewartii of the present invention and its 4 similar species;

[0037] Figure 2 is the detection result of the stability of 17 target genes by conventional RT-PCR in the present invention (in the PCR amplification results, 1-4 are viable bacteria DNA, dead bacteria RNA, viable bacteria RNA, and dead bacteria RNA respectively, 5 is the blank control; in the RT-PCR amplification results, 6 is viable bacteria RNA, 7-14 are dead bacteria RNA at 0h, 6h, 12h, 24h, 48h, and 72h after heat treatment inactivation respectively; 15 is the blank control);

[0038] Figure 3 is the detection result of the stability of 4 candidate target genes by real-time fluorescence RT-qPCR in the present invention (a, b, c, and d are the real-time fluorescence RT-qPCR amplification curves of LexA, Portal, DnaJ, and Ami genes respectively; Live is viable bacteria RNA, Killed,0h, Killed,6h, Killed,12h, Killed,24h, Killed,48h, and Killed,72h are dead bacteria RNA at 0h, 6h, 12h, 24h, 48h, and 72h after inactivation respectively, CK is the blank control);

[0039] Figure 4 is the specificity detection result of the real-time fluorescence RT-qPCR detection method in the present invention (1-4 are Pantoea stewartii subsp. stewartii strains ATCC 29227, ATCC 29228, ATCC 29229, and ATCC8199 respectively; 5-38 are other 31 tested strains such as P.s.subsp.indologenes, healthy corn leaves, healthy corn seeds, and the blank control);

[0040] Figure 5 is the analysis result of the detection sensitivities of real-time fluorescence RT-qPCR and conventional RT-PCR in the present invention (a is the real-time fluorescence RT-qPCR amplification map, b is the conventional RT-PCR electrophoresis map; 1-9 are 2×10 8 fg / μL, 2×10 7 fg / μL, 2×10 6 fg / μL, 2×105 fg / μL, 2×10 4 fg / μL, 2×10 3 fg / μL, 2×10 2 fg / μL, 20 fg / μL, and 2 fg / μL of viable PSS bacteria RNA, with CK as the blank control). Detailed implementation methods

[0041] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of the present invention.

[0042] Embodiment

[0043] 1 Materials and Methods

[0044] 1.1 Materials

[0045] Test strains: A total of 30 strains were collected, including 4 PSS strains and 26 other strains. The strain information table is shown in Table 1.

[0046] Test plant materials: Corn seed samples were collected by this laboratory from July to October 2024, with the country of origin being the United States. A bacterial suspension of 10 5 CFU / mL was prepared using the PSS strain ATCC 29228. 2 mL of the bacterial suspension was sprayed onto 200 g of corn seed samples, mixed well, and air-dried naturally to obtain the bacteria-carrying corn seed samples; the inactivated bacterial suspension was used instead of the fresh bacterial suspension, and the inactivated bacteria-carrying corn seed samples were prepared using the above method. Healthy corn seeds and healthy corn leaf samples were collected from the fields in Guangzhou, Guangdong Province in September 2024.

[0047] Reagents: The RNA extraction kit was purchased from Qiagen, Germany; the bacterial genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Premix Ex Taq, Probe qPCR Mix, One Step PrimeScript RT-qPCR Mix, DNA endonuclease I, and DL2000 DNA marker were purchased from TaKaRa, Japan; NA medium and LB liquid medium were purchased from Guangdong Huankai Microbial Technology Co., Ltd.; other reagents were all of analytical grade.

[0048] Instruments: The real-time fluorescence PCR instrument was purchased from ABI, USA; the PCR instrument, electrophoresis instrument, and gel imaging system were purchased from Bio-rad, USA.

[0049] Table 1 Information of the tested strains

[0050]

[0051]

[0052] Note: ZZ indicates isolated and preserved by our research group

[0053] 1.2 Mining and screening of key genes for metabolic activity

[0054] Download the genomic and encoded amino acid sequence data of the PSS strain DC283 (GCA_002082215.1) with chromosome-level assembly completed and its four closely related species, P. stewartii subsp. indologenes strain LMG 2671 (GCF_030370575.1), P. agglomerans strain FDAARGOS 1447 (GCF_019048385.1), P. allii strain PNA200-10 (GCF_003148935.1), and P. ananatis strain PA13 (GCA_000233595.1) from the GenBank database. Based on the online software OrthoVenn2 (https: / / orthovenn2.bioinfotoolkits.net / home), perform whole-genome homologous gene clustering analysis (parameters: e-value ≤ 1×10 －5 , Inflation value ≤ 1.5), screen out the gene clusters unique to PSS, and based on the gene function annotation results, screen the key genes related to replication, transcription, or metabolism as candidate target genes.

[0055] 1.3 Primers and probes

[0056] Design primers and probes for the candidate target gene sequences using Oligo 7.0 software. All primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer and probe information is shown in Table 2.

[0057] Table 2 Primer and probe information

[0058]

[0059]

[0060]

[0061] 1.4 Inactivation treatment

[0062] Take the culture grown to 10 in LB liquid medium 51 mL of the PSS bacterial suspension at CFU / mL was treated at 80 °C for 30 min, streaked on an NA plate, and cultured at a constant temperature of 28 °C for 3 to 5 days to evaluate the survival of the strain.

[0063] 1.5 DNA and RNA extraction

[0064] Take fresh or heat-inactivated bacterial suspension and centrifuge it at 10,000 rpm for 5 minutes. After the precipitate is washed twice with sterile water, extract DNA or RNA according to the kit instructions. The obtained RNA is treated with DNase I to remove residual genomic DNA and stored at -20 °C for later use.

[0065] 1.6 Evaluation of the stability of target genes after inactivation

[0066] To confirm the accuracy of the amplification of the target genes by 17 primer pairs and to exclude the interference of residual genomic DNA in RNA, take fresh and heat-inactivated bacterial suspension DNA and RNA as templates for PCR reaction. The heat-inactivated bacterial suspension is left in the medium at room temperature, and RNA is extracted at 0 h, 0.5 h, 1 h, 6 h, 12 h, 24 h, 48 h, and 72 h after inactivation respectively as templates for RT-PCR detection to evaluate the stability of the mRNA of 17 target genes after inactivation.

[0067] The total volume of the PCR (RT-PCR) reaction is 25 μL, including: 12.5 μL of 2×Premix Taq mix (2×One Step Buffer), (1.0 μL of Enzyme Mix), 0.5 μL each of the upstream and downstream primers at 10 μmol / L, 1 μL of DNA or RNA template, and RNase Free ddH2O is added to make up to 25 μL. The reaction program is: (reverse transcription at 50 °C for 30 min); pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 45 s, 35 cycles; extension at 72 °C for 10 min. The amplification products are detected and analyzed by 1.2% agarose gel electrophoresis.

[0068] The one-step TaqMan real-time fluorescence RT-qPCR method is used to further evaluate the stability of the target genes with relatively fast mRNA degradation rate screened above. The total reaction volume is 20 μL, including: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of the upstream and downstream primers and probe at 10 μmol / L, 1.0 μL of RNA template, and RNase Free ddH2O is added to make up to 20 μL. The reaction program is: reverse transcription at 42 °C for 5 min; pre-denaturation at 94 °C for 10 s; denaturation at 94 °C for 5 s, annealing at 60 °C for 60 s (collect fluorescence signal), 40 cycles.

[0069] 1.6 Specificity analysis

[0070] Using the total RNA of PSS strain, PSS related species and other important phytopathogenic bacteria as test materials, the total RNA of healthy corn seed samples as negative control, and RNase Free ddH2O as blank control, TaqMan real-time fluorescence RT-qPC detection and analysis were carried out using the above screened primers and probes to evaluate its specificity.

[0071] 1.7 Sensitivity analysis

[0072] Dilute the total RNA concentration of PSS strain to 200 ng / μL, and perform 10-fold serial dilution into 9 gradients with EASY Dilution buffer (TaKaRa), and the concentrations are 2×10 8 fg / μL, 2×10 7 fg / μL, 2×10 6 fg / μL, 2×10 5 fg / μL, 2×10 4 fg / μL, 2×10 3 fg / μL, 2×10 3 fg / μL, 20 fg / μL and 2 fg / μL, used as templates, and ordinary RT-PCR and real-time fluorescence RT-qPCR were carried out for detection and analysis to compare the sensitivities of the two methods.

[0073] 1.8 Detection and analysis of actual samples

[0074] Using 5 PSS-infected corn seed samples, 5 inactivated PSS-infected corn seed samples, 5 healthy corn seeds and 5 healthy corn leaf samples preserved in the laboratory, a total of 20 samples as test materials, using PSS positive strain as positive control, PSM strain as negative control, and RNase Free ddH2O as blank control, respectively, traditional plate separation method, real-time fluorescence qPCR method targeting DNA and real-time fluorescence RT-qPCR method targeting mRNA were used for detection, and the detection results were determined according to the plate separation results, amplification curves and Ct values.

[0075] 2 Results and analysis

[0076] 2.1 Mining of key genes for metabolic activity

[0077] Orthologous clustering analysis was performed on the whole genome amino acid sequences of strain PSS and 4 related strains using OrthoVenn 2 software. The results showed that a total of 4510 gene clusters were obtained, including 1742 orthologous gene clusters (at least containing 2 strains) and 2768 single-copy gene clusters. By Figure 1It can be seen that the strain PSS has 120 unique gene clusters, with a total of 673 genes on the genome, 103 of which are genes of known gene families, including 94 genes related to biological processes, 8 genes related to molecular functions, and 1 gene related to cellular components. According to the COG functional annotation results, 16 genes related to replication, transcription, or metabolism were further selected as candidate target genes, mainly including the IS66-like element accessory protein TnpA (IS66-like element accessory protein TnpA, TnpA), the LexA family transcriptional regulator (LexA family transcriptional regulator, LexA), and the recombinase family protein (recombinase family protein, rec), etc. (see Table 3).

[0078] Table 3 Genes related to replication, transcription, or metabolism obtained by screening

[0079]

[0080]

[0081] 2.2 Evaluation of the stability of target genes after heat treatment-induced death

[0082] The 10 5 CFU / mL bacterial suspension was streaked on NA plates after dry heat treatment at 80°C for 30 min and cultured at a constant temperature of 28°C for 3 - 5 days. No colony growth was found, indicating that the pathogen had been killed and inactivated after heat treatment. To confirm the accuracy of the 17 primer pairs in amplifying the target genes, DNA and RNA of live bacteria and dead bacteria were extracted respectively for PCR detection. The results showed that all 17 primer pairs could amplify the target fragments from the DNA of live bacteria and dead bacteria, while the PCR results of the RNA of live bacteria and dead bacteria were both negative, indicating that all 17 primer pairs could effectively amplify the target genes, and there was no DNA residue in the RNA of live bacteria or dead bacteria affecting the detection results.

[0083] To evaluate the stability of target genes, live bacteria RNA and dead bacteria RNA at 0 h, 0.5 h, 1 h, 6 h, 12 h, 24 h, 48 h, and 72 h after inactivation were taken for RT-PCR detection respectively. The results showed that all 17 pairs of primers could effectively amplify the target gene RNA of untreated live bacteria; for the target gene RNA of inactivated dead bacteria, only 4 mRNA genes were completely degraded 72 h after death. Among them, the LexA gene and the Portal gene could be detected within 6 h after heat treatment-induced death and disappeared after 12 h. The DnaJ gene could be detected within 12 h after heat treatment-induced death and disappeared after 24 h. The Ami gene could be detected within 48 h after heat treatment-induced death and disappeared after 72 h; the remaining 13 target genes (12 mRNA genes and the 16S rRNA gene) could still be detected within 72 h after heat treatment-induced death, indicating that the RNA of these 13 target genes was relatively stable and difficult to be completely degraded after the death of the pathogen (see Figure 2 ).

[0084] The real-time fluorescence RT-qPCR method was used to further evaluate the stability of the above 4 screened mRNA genes (LexA, Portal, DnaJ, and Ami). The results showed that the detection result of the LexA gene was consistent with that of the ordinary RT-PCR. It could be detected within 6 h after inactivation and disappeared after 12 h. The detection Ct values at 0 min and 6 h were approximately 24.2 and 28.4 respectively, indicating that the LexA gene mRNA was gradually degraded after heat treatment-induced death and was completely degraded after 12 h (see Figure 3 a); while the detection Ct values of the Portal, DnaJ, and Ami genes gradually increased within 0 h to 12 h after heat treatment-induced death, and there were still amplification signals from 24 h to 72 h, but the change in the detection Ct value was small, indicating that mRNA degradation occurred within 0 h to 12 h, and the mRNA degradation rate slowed down or the remaining mRNA after degradation affected the detection results from 24 h to 72 h (see Figure 3 b - d). Therefore, the LexA gene had the fastest degradation rate after heat treatment-induced death and was completely degraded after 12 h, and could be used as a candidate target gene for activity detection.

[0085] 2.4 Specificity analysis

[0086] Specificity evaluation was carried out on the primers and probes of the screened LexA gene. The TaqMan real-time fluorescence RT-qPCR method established with primers LexA-1F, LexA-1R and probe LexA-1P had specific amplification for 4 Pantoea stewartii subsp. stewartii strains ATCC 29227, ATCC 29228, ATCC 29229 and ATCC 8199, and the Ct values were between 18 and 23; there was no amplification reaction for 13 strains of its closely related species P. stewartii subsp. indologenes, P. agglomerans, P. ananatis and P. stewartii, and no amplification reaction for 18 main phytopathogenic bacteria such as Clavibacter michiganensis subsp. nebraskensis, Pseudomonas syringae pv. pisi and P. savastanoi pv. phaseolicola, and no amplification reaction for healthy corn leaves, seeds and blank controls (see Figure 4 ), indicating that the TaqMan real-time fluorescence RT-qPCR method established with primers LexA-1F, LexA-1R and probe LexA-1P had good specificity.

[0087] 2.5 Sensitivity analysis

[0088] The sensitivity test was carried out using the RNA of PSS ATCC 29228 strain diluted successively by 10-fold gradient as the template. The results showed that for the RNA with a concentration of 20 fg / μL detected by the TaqMan real-time fluorescence RT-qPCR method, the Ct value was 35.22, and there was no fluorescence signal for the RNA with a concentration of 2 fg / μL (see Figure 5 a), and the lowest detection concentration for PSS was 20 fg / μL. The detection results of the conventional RT-PCR method showed that when amplifying the RNA with a concentration of 2×10 4 fg / μL, there was a clear target band with a size of about 178 bp (see Figure 5 b), and there was no amplification band for lower concentration RNA, that is, the conventional RT-PCR method could detect the lowest concentration of 2×104 fg / μL, indicating that the sensitivity of the TaqMan real-time fluorescence RT-qPCR method for detecting the mRNA of the PSS LexA gene was 1000 times that of the conventional RT-PCR method.

[0089] 2.5 Detection and application of actual samples

[0090] The detection results of actual samples showed that after extracting the RNA of the samples, the detection results of 20 samples by using the TaqMan real-time fluorescence RT-qPCR method established in this study with the LexA gene mRNA as the target were consistent with the traditional isolation and culture results. The detection results of 5 contaminated corn seeds were positive, and the results of the remaining 15 samples were negative. By extracting the DNA of the samples and using real-time fluorescence PCR with the LexA gene DNA as the target, 10 positive results were detected, and the detection results of 5 inactivated contaminated corn seeds were also positive (see Table 4). The results indicated that the TaqMan real-time fluorescence RT-qPCR method established in this study with the LexA gene mRNA as the target could quickly distinguish the viability of PSS strains carried in the samples.

[0091] Table 4 Detection results of samples by real-time fluorescence RT-qPCR and PCR methods

[0092]

[0093]

[0094] Note: Ct±SD: Cycle threshold Ct (average value of 3 replicates) ± standard deviation; N / A: No Ct value after 40 cycles of amplification; NC: Negative control; PC: Positive control; CK: Blank control.

[0095] In summary, through genomic comparative analysis, this invention screened mRNA genes related to replication, transcription, and metabolic activities, evaluated their stability after inactivation, and established a real-time fluorescence RT-qPCR system for detecting viable bacteria of Pantoea stewartii subsp. stewartii, which could specifically and effectively amplify the viable PSS bacteria carried in the samples.

[0096] The above-described embodiments merely represent the preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but should not be construed as limiting the scope of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention should be subject to the appended claims.

Claims

1. A real-time fluorescence RT-qPCR detection method for viable cells of Pantoea stewartii subsp. stewartii, characterized in that, It includes the following steps: S1. Screen key genes; S2. Design primers and probes for the key genes; S3. Evaluate the stability of the key genes after mRNA inactivation to determine the target gene; The target gene is the LexA gene with the nucleotide sequence shown in SEQ ID NO: 1; S4. Establish a real-time fluorescence RT-qPCR detection method using the primers and probes corresponding to the target gene screened in step S3.

2. The real-time fluorescence RT-qPCR detection method according to claim 1, characterized in that, The primers corresponding to the target gene include: The upstream primer LexA-1F with the nucleotide sequence shown in SEQ ID NO: 2 and the downstream primer LexA-1R with the nucleotide sequence shown in SEQ ID NO:

3.

3. The real-time fluorescence RT-qPCR detection method according to claim 1, wherein, The probe used in combination with the primers described in claim 2 is the probe LexA-1P with the nucleotide sequence shown in SEQ ID NO:

4.

4. The real-time fluorescence RT-qPCR detection method according to claim 1, characterized in that The reaction system of the real-time fluorescence RT-qPCR contains: 12.5 μL of 2×One Step PrimeScript RT-qPCR Mix, 0.5 μL each of the upstream and downstream primers and the probe at 10 μmol / L, 1.0 μL of RNA template, and RNase Free ddH2O is added to make up to 20 μL.

5. The real-time fluorescence RT-qPCR detection method according to claim 1, wherein, The reaction program of the real-time fluorescence RT-qPCR is: reverse transcription at 42°C for 5 min; pre-denaturation at 94°C for 10 s; denaturation at 94°C for 5 s, annealing at 60°C for 60 s, for 40 cycles.

6. The real-time fluorescence RT-qPCR detection method according to claim 1, wherein The specific screening of the key genes is as follows: Download the genomic and encoded amino acid sequence data of the PSS strain and 4 related species that have completed chromosome-level assembly in the GenBank database. Based on the online software OrthoVenn2, perform whole-genome homologous gene clustering analysis to screen out the gene clusters unique to PSS. According to the gene function annotation results, screen the key genes related to replication, transcription, or metabolism.

7. The real-time fluorescence RT-qPCR detection method according to claim 6, wherein The PSS strain is DC283, and the 4 related species are P. stewartii subsp. indologenes strain LMG 2671, P. agglomerans strain FDAARGOS1447, P. allii strain PNA, and P. ananatis strain PA13.

8. Use of the real-time fluorescence RT-qPCR detection method according to any one of claims 1-7, characterized in that, The method is applied to the detection of viable bacteria of Pantoea stewartii subsp. stewartii in maize seeds.

Images