Cat hypertrophic cardiomyopathy related gene polymorphism detection kit

Abstract

The invention relates to the technical field of gene detection, in particular to a cat hypertrophic cardiomyopathy related gene polymorphism detection kit, the kit comprises MYBPC3A31P and R820W gene polymorphism detection, a reaction system, a primer and a probe for cat hypertrophic cardiomyopathy gene polymorphism detection are established, a locked nucleic acid modified Taqman probe and the primer are adopted, the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid modified Taqman probe and the locked nucleic acid According to the present invention, the wild type and the mutant type of the gene are effectively distinguished in the same reaction hole, the self-positive control of the reaction hole can be achieved, the use of the internal reference is reduced, the cost is reduced, the result interpretation is convenient, the structure interpretation is performed by using the Ct method, and the accuracy of the detection result is improved; the freeze-drying PPCR-fluorescent probe method, the amplification reaction and the detection adopt a completely closed system, the operation is convenient, the time for nucleic acid extraction and reagent preparation is reduced, the operation can be carried out without professional PCR personnel, and the kit is convenient to popularize and use in pet and animal husbandry industries.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and specifically provides a kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy. Background Art

[0002] Hypertrophic cardiomyopathy is a genetic disease with the highest incidence among all heart diseases in cats. The main feature of this disease is the abnormal thickening of one or more parts of the heart wall, most commonly in the left ventricle, accounting for about 60% of the confirmed heart disease cases. The probability of cats suffering from this disease may be as high as 15%, and the prevalence in males is higher than that in females. Cats with hypertrophic cardiomyopathy may not show any clinical symptoms throughout their lives, or may be at risk of developing congestive heart failure or thromboembolic diseases as the disease progresses, and may even die suddenly. Currently, no effective method for treating or delaying the course of hypertrophic cardiomyopathy has been found. Therefore, whether pet cats can be screened early for the tendency to suffer from hypertrophic cardiomyopathy for early prevention can effectively delay the course of hypertrophic cardiomyopathy in pet cats and reduce the occurrence of sudden death. Currently, the diagnosis of feline cardiomyopathy can be carried out through various methods, such as auscultation, ultrasound examination, X-ray imaging examination, electrocardiogram, and blood examination, especially the detection of B-type natriuretic peptide in the blood. However, these detection methods are usually used for cats with obvious clinical symptoms.

[0003] For some kits for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy, it is inconvenient to interpret the detection results, and the accuracy of the detection results is relatively poor. Among them, the time for nucleic acid extraction and reagent preparation is relatively long, and professional PCR personnel are required for operation. Therefore, a kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy is proposed for the above problems. Summary of the Invention

[0004] The purpose of the present invention is to provide a kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy, aiming to solve the problems that for some kits for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy, it is inconvenient to interpret the detection results, the accuracy of the detection results is relatively poor, the time for nucleic acid extraction and reagent preparation is relatively long, and professional PCR personnel are required for operation.

[0005] To achieve the above purpose, the present invention provides the following technical solutions:

[0006] A kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy, the kit includes the detection of MYBPC3 A31P and R820W gene polymorphisms, and provides a primer and a probe for simultaneously detecting the gene polymorphisms at the MYBPC3 A31P and R820W loci, including the following primers and probes:

[0007] Primer and probe for MYBPC3 A31P:

[0008] A31P - F 15’ - 3’: AAGCCAAGGTCAGTGGAAGTG

[0009] A31P - R 15’ - 3’: TGTCAGAGTGTGCCTCGTGC

[0010] A31P - PG1 5’ - 3’: FAM - CTGTGTTCGAG + GCCGAGACAGAGC - BHQ1

[0011] A31P - PC1 5’ - 3’: HEX - CTGTGTTCGAG + CCCGAGACAGAGC - BHQ1

[0012] Primers and probes for MYBPC3 R820W:

[0013] R820W - F 15’ - 3’: GGCTACATCCTGGAGCGCA

[0014] R820W - R 15’ - 3’: GTAGACTCGCATCTCATACACCAC

[0015] R820W - PC1 5’ - 3’: FAM - CTTCCGGTGGATG + CGGCTGAACTTT - BHQ1

[0016] R820W - PT1 5’ - 3’: HEX - CTTCCGGTGGATG + TGGCTGAACTTTG - BHQ1

[0017] For the genetic detection of MYBPC3 A31P and R820W gene polymorphisms, specific primers and Taqman probes are used to distinguish the bases at the mutation sites. Among them, when the template is present, the primers can rapidly amplify a large number of template genes. During the amplification process, when the Taqman probe is completely matched with the template, the Taqman probe binds to the DNA template and is hydrolyzed by Taq DNA polymerase to release the fluorescent reporter group, generating a fluorescent signal; when the Taqman probe is not completely matched with the template, the Taqman probe cannot bind to the template;

[0018] The Taqman probe is modified with locked nucleic acid (LNA). LNA is an oligonucleotide derivative. After LNA modification, the annealing temperature of the Taqman probe can be increased, the length of the Taqman probe can be reduced, the specificity of the Taqman probe can be improved, and the ability to recognize SNPs can be enhanced. A ‘+’ is added in front of the base modified with locked nucleic acid in the sequence. One base modified with locked nucleic acid is the mutated base to be distinguished. Two or more bases modified with locked nucleic acid are preferably the bases on both sides close to the mutation site. The Taqman probe is modified with one locked nucleic acid;

[0019] The twelfth base of the A31P - PG1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 A31P wild - type gene. The twelfth base of the A31P - PC1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 A31P mutant gene;

[0020] The fourteenth base of the R820W - PC1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 R820W wild - type gene. The fourteenth base of the R820W - PT1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 R820W mutant gene;

[0021] The 5' end of the Taqman probe is labeled with a fluorescent reporter group, and the 3' end of the fluorescent probe is labeled with a fluorescent quenching group. In the primer - probe composition, the fluorescent reporter group is selected from FAM, HEX, CY5, ROX, VIC; the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3.

[0022] Preferably, a kit for simultaneously detecting the polymorphisms of MYBPC3 A31P and R820W genes based on the above - mentioned primer - probe combination. The kit includes lyophilized reagent A, lyophilized reagent B, nucleic acid releasing agent, reconstitution solution, positive control A, positive control B and negative control;

[0023] Lyophilized reagent A includes two specific primers for MYBPC3 A31P and two specific probes for distinguishing wild - type and mutant types, Taq DNA polymerase, 10x buffer and lyoprotectant;

[0024] Lyophilized reagent B includes two specific primers for MYBPC3 R820W and two specific probes for distinguishing wild - type and mutant types, Taq DNA polymerase, 10x buffer and lyoprotectant;

[0025] The lyoprotectant consists of the following components: 10% W / V mannitol and 2% W / V sucrose;

[0026] The nucleic acid releasing agent is used for leukocyte lysis and nucleic acid release in blood samples and includes the following components at the following concentrations: 100 mM NaOH, 5 mM EDTA, 100 mM Tris - HCl and 1% W / V DS;

[0027] The reconstitution solution is sterile deionized water;

[0028] Positive control A includes 1 plasmid of MYBPC3 A31P wild - type and 1 plasmid of MYBPC3 R820W wild - type, prepared by mixing at a ratio of 1:1;

[0029] The positive control B is prepared by mixing 1 plasmid each of MYBPC3 A31P and R820W mutants in a 1:1 ratio;

[0030] The negative control is sterile deionized water;

[0031] In the kit, the PCR mixture is prepared at a primer concentration of 0.25 μM; a probe concentration of 0.15 μM, 2 U Taq DNA polymerase, 2.5 μl of 10x buffer, and 12.5 μl of cryoprotectant to make 25 μl per reaction, and then aliquoted into PCR eight-strip tubes and lyophilized according to the following procedure:

[0032] Pre-freezing stage: Maintain at -45°C for 2 h;

[0033] Primary sublimation drying: Heat up to -30°C, and at the same time turn on the vacuum pump to quickly evacuate to 1 mbar and maintain for 2 h, then heat up to -15°C and maintain for 2 h;

[0034] Secondary sublimation drying: Continue to heat up to 10°C and maintain for 2 h, and after completion, heat up to 25°C and maintain for 2 h;

[0035] Capping: After the freeze-drying program is completed, flush with nitrogen to balance to atmospheric pressure, and then perform capping and bagging of the eight-strip tube to complete freeze-drying;

[0036] The samples that the kit can detect are whole cat blood or peripheral blood samples, and the blood needs to be collected using an EDTA blood collection tube.

[0037] Preferably, a method for detecting gene polymorphisms of feline hypertrophic cardiomyopathy includes the following steps:

[0038] S1. Take 25 μl of blood, add it to the sample release agent, vortex, and then pipette 25 μl of the suspension into the reconstitution solution, mix by shaking, and then take 25 μl of the mixture and add it to the lyophilized PCR reagent, mix well and centrifuge;

[0039] S2. Perform fluorescence quantitative PCR amplification on the above reaction mixture. The fluorescence quantitative PCR amplification program is:

[0040] Pre-denaturation: 95°C, reaction time 300 s;

[0041] Denaturation: 95°C, reaction time 15 s;

[0042] Annealing and extension: 60°C, reaction time 30 s, and collect fluorescence;

[0043] The number of reaction cycles is 45 cycles;

[0044] S3. Analyze and judge the gene polymorphism in the test sample based on the Ct values of two reaction wells and two channels in the fluorescence quantitative PCR reaction system. In the detection method, the specific analysis and judgment method for step S3 is as follows:

[0045] If the fluorescence channel of the fluorescence probe A31P-PG1 in reaction well A is the first fluorescence channel, and the fluorescence channel used by A31P-PC1 is the second fluorescence channel;

[0046] When the Ct value of the first fluorescence channel < 40, and there is no Ct value in the second fluorescence channel, or the Ct value < 40, but the Ct value of the second channel - the Ct value of the first channel > 5, it indicates that the MYBPC3 A31P gene in the sample is wild type;

[0047] When there is no Ct value in the first fluorescence channel or the Ct value < 40, and the Ct value of the second fluorescence channel < 40, but the Ct value of the first channel - the Ct value of the second channel > 5, it indicates that the MYBPC3 A31P gene in the sample is mutant;

[0048] When the Ct value of the first fluorescence channel < 40, the Ct value of the second fluorescence channel < 40, and the difference in Ct values between the two channels is less than 5, it indicates that the MYBPC3 A31P gene in the sample is heterozygous;

[0049] If the fluorescence channel of the fluorescence probe R820W-PC1 in reaction well B is the first fluorescence channel, and the fluorescence channel used by R820W-PT1 is the second fluorescence channel;

[0050] When the Ct value of the first fluorescence channel < 40, and there is no Ct value in the second fluorescence channel, or the Ct value < 40, but the Ct value of the second channel - the Ct value of the first channel > 5, it indicates that the MYBPC3 R820W gene in the sample is wild type;

[0051] When there is no Ct value in the first fluorescence channel or the Ct value < 40, and the Ct value of the second fluorescence channel < 40, but the Ct value of the first channel - the Ct value of the second channel > 5, it indicates that the MYBPC3 R820W gene in the sample is mutant;

[0052] When the Ct value of the first fluorescence channel < 40, the Ct value of the second fluorescence channel < 40, and the difference in Ct values between the two channels is less than 5, it indicates that the MYBPC3 R820W gene in the sample is heterozygous.

[0053] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0054] 1. The present invention establishes a reaction system, primers and probes for detecting gene polymorphism of feline hypertrophic cardiomyopathy, which can be used for early screening, prevention, diagnosis and treatment, and scientific breeding of feline hypertrophic cardiomyopathy, improving the diagnosis and treatment level and reducing the losses brought to pet owners by feline hypertrophic cardiomyopathy;

[0055] 2. The present invention uses locked nucleic acid-modified Taqman probes and primers to effectively distinguish between wild-type and mutant genes in the same reaction well, and can achieve self-positive control of the reaction well, reduce the use of internal references, lower costs, facilitate result interpretation, use the ΔCt method for structure interpretation, and improve the accuracy of detection results;

[0056] 3. The present invention uses a nucleic acid releasing agent, freeze-dried PPCR-fluorescent probe method. The amplification reaction and detection adopt a completely closed system, which is convenient to operate, reduces the time for nucleic acid extraction and reagent preparation, can be operated without professional PCR personnel, and is convenient for promotion and use in the pet and livestock industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 It is a schematic diagram of the three-component comparative analysis of the result analysis A of Example 1 of the present invention;

[0058] Figure 2 It is a schematic diagram of the three-component comparative analysis of the result analysis B of Example 1 of the present invention;

[0059] Figure 3 It is a schematic diagram of the three-component comparative analysis of the result analysis C of Example 1 of the present invention;

[0060] Figure 4 It is a schematic diagram of the three-component comparative analysis of the result analysis D of Example 1 of the present invention;

[0061] Figure 5 It is a schematic diagram of the three-component comparative analysis of the result analysis E of Example 1 of the present invention;

[0062] Figure 6 It is a schematic diagram of the three-component comparative analysis of the result analysis F of Example 1 of the present invention;

[0063] Figure 7 It is a schematic diagram of the gradient dilution detection of the MYBPC3 A31P genotype in the sensitivity experiment of Example 3 of the present invention;

[0064] Figure 8 It is a schematic diagram of the gradient dilution detection of the MYBPC3 R820W genotype in the sensitivity experiment of Example 3 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0065] Next, the technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0066] Example 1:

[0067] Screening of primer-probe compositions:

[0068] 1. Design optimization and screening of primer-probe compositions;

[0069] The kit of the present invention obtained the cds sequences of MYBPC3 A31P and R820W genes and the mutation sites from the literature and NCBI. According to the primer-probe design principle, multiple pairs of upstream and downstream primers and probes capable of amplifying each mutation site were designed using Primer 5 and Primer Express software, and verified by real-time fluorescence quantitative PCR technology;

[0070] The primer-probe sequences are as follows in the table:

[0071] Table 1 Primer-probe sequence table

[0072]

[0073] Note: In the table, "+N" represents locked nucleic acid modified bases.

[0074] 2. Preparation of reaction system:

[0075] For each group, 0.25 μl of primer, 0.15 μl of probe, 2 U of Taq DNA polymerase, 2.5 μl of 10x buffer, and sterile deionized water were respectively formulated into a 20 μl reaction system and dispensed into an eight-strip tube;

[0076] 3. Sample loading: 5 μl of wild-type, mutant, and mixed heterozygous plasmids were respectively taken and added to the above-prepared reaction systems;

[0077] 4. Machine running: Put it into a fluorescence quantitative PCR instrument, set the reaction program for PCR amplification and fluorescence signal collection. The PCR amplification reaction program is: 95°C, 300 s, 1 cycle; 95°C, 15 s, 60°C, 30 s (collect fluorescence), 45 cycles;

[0078] 5. Result analysis:

[0079] As shown in the figure: In reaction system A, for the 3 groups of primer-probes, in group 1, the amplification was advanced in both wild-type, mutant, and heterozygous samples, and the non-specific amplification was relatively low. Therefore, group 1 primer-probe was preferably selected;

[0080] A: MYBPC3 A31P wild-type sample, as Figure 1 shown, the fluorescence amplification curve of group 1 was advanced compared to groups 2 and 3, and the Ct value was smaller. Group 1 primer-probe was preferably selected.

[0081] B: MYBPC3 A31P mutant sample, as Figure 2As shown, the fluorescence amplification curve of Group 1 is significantly earlier than those of Group 2 and Group 3, with a smaller Ct value and higher fluorescence intensity. The primer-probe of Group 1 is preferred;

[0082] C: MYBPC3 A31P heterozygous sample, such as Figure 3 As shown, the two amplification curves of Group 1 almost coincide, and are earlier than those of Group 2 and Group 3 in terms of fluorescence value, with high fluorescence intensity. The primer-probe of Group 1 is preferred;

[0083] D: MYBPC3 R820W wild-type sample, such as Figure 4 As shown, the fluorescence amplification curve of Group 1 is earlier than those of Group 2 and Group 3, with a smaller Ct value. The primer-probe of Group 1 is preferred;

[0084] E: MYBPC3 R820W mutant sample, such as Figure 5 As shown, the fluorescence amplification curve of Group 1 is slightly earlier than those of Group 2 and Group 3, with a smaller Ct value, and there is slight non-specificity in Group 3. Therefore, Group 1 is preferred;

[0085] F: MYBPC3 R820W heterozygous sample, such as Figure 6 As shown, the two amplification curves of Group 1 almost coincide, and are earlier than those of Group 3 in terms of fluorescence value, with high fluorescence intensity. One of the two amplification curves in Group 2 is severely inhibited. The primer-probe of Group 1 is preferred;

[0086] Example 2:

[0087] Preparation of the kit and detection of clinical samples:

[0088] (1) In this example, a kit for application was designed for the primer-probe of Group 1 in Example 1. The main components of the kit are as follows in the table:

[0089] Table 2 Main components of the kit

[0090]

[0091] Among them, the lyophilized reagent A includes the following components: 0.25 μM A31P-F1, 0.25 μM A31P-R1, 0.15 μM A31P-PG1, 0.15 μM A31P-PC1, 2 U Taq DNA polymerase, 2.5 μl 10x buffer, 12.5 μl lyoprotectant;

[0092] The lyophilized reagent B includes the following components: 0.25 μM R820W-F1, 0.25 μM R820W-R1, 0.15 μM R820W-PC1, 0.15 μM R820W-PT1, 2 U Taq DNA polymerase, 2.5 μl 10x buffer, 12.5 μl lyoprotectant;

[0093] After preparation, it is aliquoted into PCR eight-strip tubes and then lyophilized according to a multi-stage lyophilization program.

[0094] The lyophilization program is as follows:

[0095] Pre-freezing: Maintain at -45°C for 2 h. For the first sublimation drying, raise the temperature to -30°C, and at the same time, turn on the vacuum pump to quickly evacuate to 1 mbar and maintain for 2 h, then raise the temperature to -15°C and maintain for 2 h.

[0096] Secondary sublimation drying: Continue to raise the temperature to 10°C and maintain for 2 h. After completion, raise the temperature to 25°C and maintain for 2 h.

[0097] Capping: After the freeze-drying program is completed, flush with nitrogen to balance to atmospheric pressure, and then perform capping and bag-sealing on the eight-strip tubes to complete lyophilization.

[0098] (2) This example also provides a method and application for detecting the polymorphism of genes related to feline hypertrophic cardiomyopathy. The detection method and application include the following steps:

[0099] 1. Collect 1 ml of venous blood from each of 10 cats with relatively obvious clinical symptoms using EDTA blood collection tubes.

[0100] 2. Take 25 μl of blood, add it to the sample release agent, and after thorough vortex mixing, take 25 μl and add it to the reconstitution solution, and mix thoroughly by vortexing.

[0101] Take reagent A, B, quality control product A, B, and negative control from the kit. Add 25 μl of the above reconstitution solution to the lyophilized reagent A and B respectively. At the same time, take another portion of the lyophilized reagent and add 25 μl of quality control product A and quality control product B respectively as positive and negative controls. Cover the tube caps, mix well, and centrifuge.

[0102] 4. Place the centrifuged eight-strip tubes into a real-time fluorescence PCR instrument, set the reaction program for PCR amplification and fluorescence signal collection. The PCR amplification reaction program is: 95°C, 300 s, 1 cycle; 95°C, 15 s, 60°C, 30 s (collect fluorescence), 45 cycles.

[0103] 5. Test results: For 10 cats with relatively obvious clinical symptoms, the test results are shown in Table 3. Among them, 8 samples were detected with gene mutations, 3 were homozygous mutations, 5 were heterozygous mutations, and 2 were normal. This gene polymorphism can be used for the auxiliary diagnosis of feline hypertrophic cardiomyopathy.

[0104] Table 3 Test results of clinical samples

[0105]

[0106]

[0107] Example 3:

[0108] Performance analysis experiment of the kit of Example 2;

[0109] Operate the kit of Example 2 according to the detection method of Example 2, and conduct performance tests in multiple aspects such as sensitivity, precision, accuracy, anti-interference, etc. respectively;

[0110] (1) Sensitivity experiment:

[0111] ① Experimental method:

[0112] Mix the MYBPC3 A31P WT and MT synthetic plasmid standards in a ratio of 1:1, and mix the R820W WT and MT synthetic plasmid standards in a ratio of 1:1, and perform gradient dilution. The diluted concentrations are 1x10 1 ~1x10 5 copies / ul. Each dilution gradient is detected and analyzed using the kit of Example 2 of the present invention, and each minimum detection limit standard is detected 20 times repeatedly to evaluate the sensitivity of the kit;

[0113] ② Experimental results and analysis:

[0114] The experimental results show that the kit has high sensitivity to MYBPC3 A31P and R820W, both reaching

[0115] 1x10 1 copies / ul. As shown in the results of Figure 7 and 8 When detecting the 1x10 1 ~1x10 5 copies / ul gradient-diluted plasmid of MYBPC3 A31P with the above kit, the minimum detection limit is 1x10 1 copies / ul. When detecting the 1x10 1 ~1x10 5 copies / ul gradient-diluted plasmid of MYBPC3 R820W, the minimum detection limit is also 1x10 1 copies / ul. Each minimum detection limit standard is detected 20 times repeatedly, and the positive detection rate is 100%. The verification results are shown in Table 4;

[0116] Table 4 Sensitivity detection results

[0117]

[0118] (2) Precision (repeatability)

[0119] ① Experimental method:

[0120] Mix the MYBPC3 A31P WT and MT synthetic plasmid standards in a 1:1 ratio, and mix the R820W WT and MT synthetic plasmid standards in a 1:1 ratio. Then perform gradient dilution and dilute them to 1x10 4 copies / ul and 1x10 2 copies / ul respectively. Conduct 10 repeated detections for each, calculate their coefficient of variation and standard deviation, and evaluate the repeat performance;

[0121] ② Experimental results:

[0122] As shown in Table 5, for the MYBPC3 A31P mutation site gene, the standard deviations of the Ct values detected at the concentration of 1x10 4 copies / ul in the FAM and HEX channels are 1.18 and 1.44 respectively, and the coefficients of variation are 4.27% and 5.05% respectively. At the concentration of 1x10 2 copies / ul, the standard deviations of the Ct values detected in the FAM and HEX channels are 1.50 and 1.79 respectively, and the coefficients of variation are 4.12 and 4.94 respectively; for the MYBPC3 R820W mutation site gene, at the concentration of 1x10 4 copies / ul, the standard deviations of the Ct values detected in the FAM and HEX channels are 0.89 and 0.78 respectively, and the coefficients of variation are 3.15% and 2.81% respectively. At the concentration of 1x10 2 copies / ul, the standard deviations of the Ct values detected in the FAM and HEX channels are 0.88 and 1.03 respectively, and the coefficients of variation are 2.65 and 3.01 respectively. The above results indicate that the kit has good repeatability in the detection of MYBPC3 A31P and MYBPC3 R820W.

[0123] Table 5 Precision verification results of MYBPC3 A31P and R820W

[0124]

[0125] (3) Accuracy

[0126] ① Experimental method

[0127] Use the above kit to detect 3 wild-type clinical samples confirmed by sequencing, 2 MYBPC3 A31P heterozygous clinical samples, 1 MYBPC3 A31P mutant clinical sample, 1 MYBPC3 R820W heterozygous clinical sample, and 1 MYBPC3 R820W mutant clinical sample respectively to evaluate the accuracy of the kit. ② Experimental results:

[0128] The verification results are shown in Table 6. From these results, it can be seen that the kit detected 3 cases of wild type, 2 cases of MYBPC3 A31P heterozygous clinical samples, 1 case of MYBPC3 A31P mutant clinical sample, 1 case of MYBPC3 R820W heterozygous clinical sample, and 1 case of MYBPC3 R820W mutant clinical sample, which is consistent with the sequencing results.

[0129] Table 6 Accuracy test results of the kit

[0130]

[0131]

[0132] (4) Anti-interference

[0133] ① Experimental method

[0134] The common interfering substances that inhibit PCR in blood were detected using the kit of the present invention, including: 60 g / L albumin, 37 mmol / L triglyceride, 342 μmol / L bilirubin, and 200 g / L hemoglobin. The interfering substances were added to positive samples for detection respectively to evaluate the anti-interference ability of the kit.

[0135] ② Experimental results:

[0136] The experimental results are shown in Table 7. The above-mentioned common blood interfering substances (albumin, triglyceride, bilirubin, and hemoglobin) have no interference on the detection results, indicating that the detection kit has strong anti-interference ability.

[0137] Table 7 Anti-interference verification of the kit

[0138]

[0139] Through the above settings, the present invention establishes a reaction system for detecting gene polymorphisms of feline hypertrophic cardiomyopathy, primers and probes, which can be used for early screening prevention, diagnosis and treatment, and scientific breeding of feline hypertrophic cardiomyopathy, improve the diagnosis and treatment level, and reduce the losses brought to pet owners by feline hypertrophic cardiomyopathy;

[0140] The present invention uses locked nucleic acid-modified Taqman probes and primers to effectively distinguish between wild-type and mutant genes in the same reaction well, and can achieve self-positive control of the reaction well, reduce the use of internal references, reduce costs, facilitate result interpretation, and use the ΔCt method for structure interpretation to improve the accuracy of detection results;

[0141] The present invention uses a nucleic acid releasing agent and the freeze-dried PPCR-fluorescent probe method. The amplification reaction and detection adopt a completely closed system, which is convenient to operate, reduces the time for nucleic acid extraction and reagent preparation, can be operated without professional PCR personnel, and is convenient for popularization and use in the pet and livestock industries.

[0142] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principle and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

[0143] Plasmid sequence:

[0144] A31P WT:

[0145] Tgctttaggaagaagggatgcagggttggggtgcctgggccagccagcggctcctgcagcctccattggcccatctcagtctcagccttcagcaagaagccaaggtcagtggaagtggcagccagcagctctgctgtgttcgaggccgagacagagcggtcaggagtaaaggtgcgctggcagcgggggggcagtgacatcagcgccagtgacaagtatggcctagcagccgagggcacgaggcacactctgacagtgcgggacgtgggccccaccgaccagggaccctacgcagtcatcgctggctcctccaaggtcaagtttgacctcaaggtcatagaagcaggtaagaccctggtccgccttccctaggtttgagcttctggggca

[0146] A31P MT:

[0147] tgctttaggaagaagggatgcagggttggggtgcctgggccagccagcggctcctgcagcctccattggcccatctcagtctcagccttcagcaagaagccaaggtcagtggaagtggcagccagcagctctgctgtgttcgagcccgagacagagcggtcaggagtaaaggtgcgctggcagcgggggggcagtgacatcagcgccagtgacaagtatggcctagcagccgagggcacgaggcacactctgacagtgcgggacgtgggccccaccgaccagggaccctacgcagtcatcgctggctcctccaaggtcaagtttgacctcaaggtcatagaagcaggtaagaccctggtccgccttccctaggtttgagcttctggggca

[0148] R820W WT:

[0149] Ccagatgtgccagatccccccgcggcccccaagatcagcaatgtgggtgaggactcctgcaccgtgcagtgggagccgcctgcctacgacgggggacagccagtcctgggtgagtgcagggcccggggatagagctcagggccggggttgtggggcaggctgggccccagaccagagctcctgtccccccttcatcaggctacatcctggagcgcaagaagaagaagagcttccggtggatgcggctgaactttgacctgctgcaggagctgagccacgaggcacggcgcatgattgagggcgtggtgtatgagatgcgagtctacgcggtcaatgccatcggcatgtccaggcccagccctgcctcccagcccttcatgcctattggtgagcctgcctggcctggcactgccccacaccctccctggtcagaagcagctgctctgtgggcggccaccccactaggcatttacatccgggtccctttta

[0150] R820W MT:

[0151] ccagatgtgccagatccccccgcggcccccaagatcagcaatgtgggtgaggactcctgcaccgtgcagtgggagccgcctgcctacgacgggggacagccagtcctgggtgagtgcagggcccggggatagagctcagggccggggttgtggggcaggctgggccccagaccagagctcctgtccccccttcatcaggctacatcctggagcgcaagaagaagaagagcttccggtggatgtggctgaactttgacctgctgcaggagctgagccacgaggcacggcgcatgattgagggcgtggtgtatgagatgcgagtctacgcggtcaatgccatcggcatgtccaggcccagccctgcctcccagcccttcatgcctattggtgagcctgcctggcctggcactgccccacaccctccctggtcagaagcagctgctctgtgggcggccaccccactaggcatttacatccgggtccctttta

Claims

1. A kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy, the kit includes the detection of MYBPC3 A31P and R820W gene polymorphisms, and is characterized in that: Provided are primers and probes for simultaneously detecting gene polymorphisms at the MYBPC3 A31P and R820W loci, including the following primers and probes: Primer-probes for MYBPC3 A31P: A31P-F1 5'-3': AAGCCAAGGTCAGTGGAAGTG A31P-R1 5'-3': TGTCAGAGTGTGCCTCGTGC A31P-PG1 5'-3': FAM-CTGTGTTCGAG+GCCGAGACAGAGC-BHQ1 A31P-PC1 5'-3': HEX-CTGTGTTCGAG+CCCGAGACAGAGC-BHQ1 Primer-probes for MYBPC3 R820W: R820W-F1 5'-3': GGCTACATCCTGGAGCGCA R820W-R1 5'-3': GTAGACTCGCATCTCATACACCAC R820W-PC1 5'-3': FAM-CTTCCGGTGGATG+CGGCTGAACTTT-BHQ1 R820W-PT1 5'-3': HEX-CTTCCGGTGGATG+TGGCTGAACTTTG-BHQ1 For the detection of MYBPC3 A31P and R820W gene polymorphisms, specific primers and Taqman probes are used to distinguish the bases at the mutation sites. Among them, when the template is present, the primers can rapidly amplify a large amount of template genes. During the amplification process, when the Taqman probe is completely matched with the template, the Taqman probe binds to the DNA template and is hydrolyzed by Taq DNA polymerase to release the fluorescent reporter group, generating a fluorescent signal; when the Taqman probe is not completely matched with the template, the Taqman probe cannot bind to the template; The Taqman probe is modified with locked nucleic acid (LNA). LNA is an oligonucleotide derivative. After LNA modification, the annealing temperature of the Taqman probe can be increased, the length of the Taqman probe can be reduced, the specificity of the Taqman probe can be improved, and the ability to recognize SNPs can be enhanced. A '+' is added before the base modified with locked nucleic acid in the sequence. One base modified with locked nucleic acid is the mutated base to be distinguished. Two or more bases modified with locked nucleic acid are preferably the bases on both sides close to the mutation site. The Taqman probe is modified with one locked nucleic acid; The twelfth base of the A31P-PG1 probe sequence is modified with LNA. This probe is used to identify the wild-type gene of MYBPC3 A31P. The twelfth base of the A31P-PC1 probe sequence is modified with LNA. This probe is used to identify the mutant gene of MYBPC3 A31P; The fourteenth base of the R820W-PC1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 R820W wild-type gene. The fourteenth base of the R820W-PT1 probe sequence is modified with LNA. This probe is used to identify the MYBPC3 R820W mutant gene; The 5' end of the Taqman probe is labeled with a fluorescent reporter group, and the 3' end of the fluorescent probe is labeled with a fluorescent quenching group. In the primer-probe composition, the fluorescent reporter group is selected from FAM, HEX, CY5, ROX, VIC; the fluorescent quenching group is selected from BHQ1, BHQ2, BHQ3.

2. The kit for detecting gene polymorphisms related to feline hypertrophic cardiomyopathy according to claim 1, wherein: A kit for simultaneously detecting the polymorphisms of MYBPC3 A31P and R820W genes based on the above primer-probe combination. The kit includes lyophilized reagent A, lyophilized reagent B, nucleic acid releasing agent, reconstitution solution, positive control A, positive control B, and negative control; Lyophilized reagent A includes two specific primers for MYBPC3 A31P and two specific probes for differentiating wild-type and mutant types, Taq DNA polymerase, 10x buffer, and lyoprotectant; Lyophilized reagent B includes two specific primers for MYBPC3 R820W and two specific probes for differentiating wild-type and mutant types, Taq DNA polymerase, 10x buffer, and lyoprotectant; The lyoprotectant consists of the following components: 10% W / V% mannitol and 2% W / V% sucrose; The nucleic acid releasing agent is used for leukocyte lysis and nucleic acid release in blood samples, and includes the following components at the following concentrations: 100 mM NaOH, 5 mM EDTA, 100 mM Tris-HCl, and 1% W / V% DS; The reconstitution solution is sterile deionized water; Positive control A includes 1 plasmid each of MYBPC3 A31P and R820W wild-type, prepared by mixing at a ratio of 1:1; Positive control B includes 1 plasmid each of MYBPC3 A31P and R820W mutant, prepared by mixing at a ratio of 1:1; The negative control is sterile deionized water; In the kit, the PCR mixture is formulated at a primer concentration of 0.25 μM; a probe concentration of 0.15 μM, 2 U Taq DNA polymerase, 2.5 ul 10x buffer, and 12.5 ul lyoprotectant to make 25 ul / reaction, and then aliquoted into PCR eight-strip tubes and lyophilized according to the following procedure: Pre-freezing stage: Maintain at -45°C for 2 h; Primary sublimation drying: Raise the temperature to -30°C, and at the same time turn on the vacuum pump to quickly evacuate to 1 mbar and maintain for 2 h, then raise the temperature to -15°C and maintain for 2 h; Secondary sublimation drying: Continue to raise the temperature to 10°C and maintain for 2 h. After completion, raise the temperature to 25°C and maintain for 2 h; Capping: After the freeze-drying program is completed, flush with nitrogen to balance to atmospheric pressure, and then perform capping and sealing of the eight-strip tube lid to complete freeze-drying; The samples that the kit can detect are whole blood or peripheral blood samples of cats, and the blood needs to be collected in an EDTA blood collection tube.

3. The kit for detecting polymorphisms of genes related to feline hypertrophic cardiomyopathy according to claim 1, wherein: A detection method for detecting gene polymorphisms of feline hypertrophic cardiomyopathy, comprising the following steps: S1. Take 25 μl of blood, add it to the sample release agent, vortex and shake, then aspirate 25 μl of the suspension and add it to the reconstitution solution. After shaking and mixing evenly, take 25 μl of the mixture and add it to the lyophilized PCR reagent, mix well and centrifuge; S2. Perform fluorescence quantitative PCR amplification on the above reaction mixture. The fluorescence quantitative PCR amplification program is as follows: Pre-denaturation: 95 °C, reaction time 300 s; Denaturation: 95 °C, reaction time 15 s; Annealing and extension: 60 °C, reaction time 30 s, and collect fluorescence; The number of reaction cycles is 45 cycles; S3. Analyze and judge the gene polymorphisms in the test sample according to the Ct values of two reaction wells and two channels in the fluorescence quantitative PCR reaction system. In the detection method, the specific analysis and judgment method in step S3 is as follows: If the fluorescence channel of the fluorescence probe A31P-PG1 in reaction well A is the first fluorescence channel, and the fluorescence channel used by A31P-PC1 is the second fluorescence channel; When the Ct value of the first fluorescence channel < 40 and there is no Ct value in the second fluorescence channel, or the Ct value < 40, but the Ct value of the second channel - the Ct value of the first channel > 5, it indicates that the MYBPC3 A31P gene of the sample is wild type; When there is no Ct value in the first fluorescence channel or the Ct value < 40, the Ct value of the second fluorescence channel < 40, but the Ct value of the first channel - the Ct value of the second channel > 5, it indicates that the MYBPC3 A31P gene of the sample is mutant; When the Ct value of the first fluorescence channel < 40, the Ct value of the second fluorescence channel < 40, and the difference in Ct values between the two channels is less than 5, it indicates that the MYBPC3 A31P gene of the sample is heterozygous; If the fluorescence channel of the fluorescence probe R820W-PC1 in reaction well B is the first fluorescence channel, and the fluorescence channel used by R820W-PT1 is the second fluorescence channel; When the Ct value of the first fluorescence channel < 40 and there is no Ct value in the second fluorescence channel, or the Ct value < 40, but the Ct value of the second channel - the Ct value of the first channel > 5, it indicates that the MYBPC3 R820W gene of the sample is wild type; When there is no Ct value in the first fluorescence channel or the Ct value < 40, the Ct value of the second fluorescence channel < 40, but the Ct value of the first channel - the Ct value of the second channel > 5, it indicates that the MYBPC3 R820W gene of the sample is mutant; When the Ct value of the first fluorescence channel < 40, the Ct value of the second fluorescence channel < 40, and the difference in Ct values between the two channels is less than 5, it indicates that the MYBPC3 R820W gene of the sample is heterozygous.

Images