Application of NFAM1 in preparation of kit for evaluating risk of coronary heart disease

Abstract

The invention provides application of NFAM1 in preparation of a kit for evaluating risk of coronary heart disease, and belongs to the technical field of biological medicine. The research finds that the expression of the NFAM1 in the peripheral blood mononuclear cells of the coronary heart disease patient is obviously improved. The invention provides shRNA (short hairpin Ribonucleic Acid) for specifically knocking down NFAM1 gene expression, and the expression of NFAM1 can be inhibited through the shRNA. Through construction of a cell model for inhibiting NFAM1 gene expression, the expression level of chemokine receptors CCR2 and CCR5 can be obviously reduced by inhibiting NFAM1 gene expression, and chemokine-induced p38MAPK pathway activation is inhibited, so that chemotactic migration of lymphoma monocytes is inhibited. In conclusion, by inhibiting expression of NFAM1, the risk of coronary heart disease can be evaluated, and lymphoma cell migration can be inhibited.

Description

[0001] This application is a divisional application of the application with the application date of April 14, 2020, application number 202010292380.6, and invention title "Application of NFAM1 in Screening Drugs for Preventing and Treating Coronary Heart Disease or Preparing a Kit". Technical Field

[0002] The present invention relates to the field of biomedical technologies, and specifically relates to the application of NFAM1 in preparing a kit for evaluating the risk of coronary heart disease. Background Art

[0003] Cardiovascular and cerebrovascular diseases have always been the main factors endangering human life. Among them, heart diseases (coronary heart disease) caused by atherosclerosis and its thrombosis leading to myocardial ischemia and hypoxia are important factors leading to myocardial infarction and stroke, and are related to multiple risk factors and pathophysiological complexities. Due to the complex clinical manifestations, early warning and timely intervention of coronary heart disease always face huge challenges.

[0004] Multiple studies have shown that monocytes are not only the initiating factor for plaque formation, but also one of the triggering factors for the progression and instability of atherosclerosis. The recruitment of monocytes in the blood to the injured endothelium by chemotactic factors and their migration to the arterial wall have been considered an important process in the development of atherosclerotic plaques. The increased lipid load and inflammatory stimulation caused by foam cells derived from monocytes accelerate the transformation of lesions from stable lesions to unstable lesions. Therefore, circulating monocytes can be an important source for the discovery of non-invasive early prediction and intervention methods for coronary heart disease.

[0005] The NFAT activating protein with ITAM motif1 (NFAM1), which has an ITAM motif 1, is highly expressed in monocytes and is a single transmembrane protein containing an Immunoreceptor tyrosine-based activation motif (ITAM). Its nucleotide sequence Genebank Gene ID is 150372. There is currently no prior art reporting the role of NFAM1 in the occurrence and development of coronary heart disease; nor is there any prior art reporting the role of NFAM1 in tumor spread and metastasis. Summary of the Invention

[0006] The technical problems solved by the present invention are as follows:

[0007] In the first aspect, there is provided the application of NFAM1 in searching for or screening drugs or biological agents for preventing and treating coronary heart disease and coronary heart disease-related diseases.

[0008] The second aspect provides the use of NFAM1 in the preparation of a kit for early warning, early diagnosis or prognosis assessment of coronary heart disease and coronary heart disease-related diseases.

[0009] The third aspect provides the use of the shRNA shown in SEQ ID No. 1 that inhibits the level of NFAM1 in the preparation of a reagent for regulating chemokine receptor CCR2 and / or CCR5.

[0010] The fourth aspect provides the use of the shRNA shown in SEQ ID No. 1 that inhibits the level of NFAM1 in the preparation of a reagent for inhibiting monocyte chemotaxis or migration.

[0011] The fifth aspect provides the use of the shRNA shown in SEQ ID No. 1 that inhibits the level of NFAM1 in the preparation of a MAPK inhibitor.

[0012] To solve the technical problems of the present invention, the following technical solutions are adopted in the present invention.

[0013] The first aspect of the technical solution of the present invention is to provide the use of NFAM1 in searching for or screening drugs or biological agents for preventing and treating coronary heart disease and coronary heart disease-related diseases.

[0014] Preferably, the application of searching for or screening drugs or biological agents for preventing and treating coronary heart disease and coronary heart disease-related diseases is to screen out drugs or biological agents that inhibit the expression of NFAM1 by measuring the expression of NFAM1 in monocytes and comparing whether the expression level of NFAM1 changes compared with the control group.

[0015] The second aspect of the technical solution of the present invention is to provide the use of NFAM1 in the preparation of a kit for early warning, early diagnosis or prognosis assessment of coronary heart disease and coronary heart disease-related diseases.

[0016] Preferably, the early warning, early diagnosis or prognosis assessment of coronary heart disease is to compare whether the expression level of NFAM1 in monocytes in the blood sample of the individual increases by measuring the expression of NFAM1 in monocytes in the blood sample of the individual compared with the control group.

[0017] Preferably, the reagent for measuring the expression of NFAM1 in monocytes in the blood sample of the individual is a primer and / or probe and / or antibody of NFAM1.

[0018] Preferably, the control group is a healthy person without symptoms of coronary heart disease angina and with a stenosis lesion of <50% stenosis by coronary CT / angiography.

[0019] The third aspect of the technical solution of the present invention is to provide the application of the shRNA shown in SEQ ID No.1 that inhibits the level of NFAM1 in the preparation of reagents for regulating chemokine receptor CCR2 and / or CCR5; in the preparation of reagents for inhibiting monocyte chemotaxis or migration; and in the preparation of MAPK pathway inhibitors.

[0020] Preferably, the shRNA shown in SEQ ID No.1 that inhibits the level of NFAM1 can inhibit the expression of CCR2 and / or CCR5.

[0021] Preferably, the shRNA shown in SEQ ID No.1 that inhibits the level of NFAM1 can inhibit the chemotaxis and / or migration of monocytes.

[0022] Preferably, the shRNA shown in SEQ ID No.1 that inhibits the level of NFAM1 can inhibit the activation of the p38 MAPK pathway mediated by chemokines.

[0023] The present invention provides the application of the NFAT activation protein NFAM1 with an ITAM motif 1 in the preparation of a kit for evaluating the risk of coronary heart disease.

[0024] Preferably, the evaluation includes any one or more than two of early warning, early diagnosis, and / or prognosis evaluation.

[0025] Preferably, the coronary heart disease includes stable coronary heart disease and / or acute coronary syndrome.

[0026] Preferably, the evaluation of the risk of coronary heart disease is by measuring the expression of NFAM1 in monocytes in the blood sample of an individual, and comparing whether the expression level of NFAM1 is increased compared with the control group.

[0027] Preferably, the reagents for measuring the expression of NFAM1 in monocytes in the blood sample of the individual include any one or more than two of primers, probes, and antibodies for detecting NFAM1.

[0028] The present invention provides the application of a reagent that inhibits the expression of NFAM1 protein in the preparation of a drug for inhibiting the migration and / or spread of lymphoma cells.

[0029] The present invention provides a shRNA that specifically inhibits the expression of the NFAM1 gene, and the nucleotide sequence of the shRNA is shown in SEQ ID No.1.

[0030] Beneficial technical effects:

[0031] The present invention for the first time established the correlation between the NFAT activation protein NFAM1 with ITAM motif 1 and the occurrence and development of coronary heart disease, and found that compared with the normal control group, the expression of NFAM1 in peripheral blood monocytes of coronary heart disease patients was significantly increased, and the high expression of NFAM1 could provide early warning for coronary heart disease. On the one hand, it could be used as a new target for screening drugs or preparations for coronary heart disease, and on the other hand, it could be used as a new biomarker for early warning, early diagnosis or prognosis evaluation of coronary heart disease. The molecular mechanism study further determined that inhibiting the expression of NFAM1 could significantly reduce the expression levels of chemokine receptors CCR2 and CCR5 closely related to coronary heart disease, and inhibit the activation of the p38 MAPK pathway induced by chemokines, thereby inhibiting the chemotactic migration of monocytes.

[0032] In summary, the present invention for the first time found that the expression level of NFAM1 in monocytes is correlated with the occurrence and development of coronary heart disease, and it can be used as an important target for targeting chemokine receptors, providing support for finding new targets for early warning and other applications of coronary heart disease.

[0033] Furthermore, the present invention also found the effect of NFAM1 on the migration of lymphoma cells, and obtained that inhibiting the expression of the NFAM1 gene could inhibit the migration of lymphoma cells, and further obtained that inhibiting the expression of the NFAM1 gene could be applied to inhibit the migration and spread of lymphoma. Description of the Drawings

[0034] Figure 1 It is a correlation analysis diagram of the NFAM1 level in human peripheral blood monocytes and the occurrence and development of coronary heart disease in Example 1; wherein, A is the flow cytometry analysis and quantification result of the NFAM1 expression level in peripheral blood monocytes of coronary heart disease patients and normal control group, with 79 cases in the control group, 70 cases of stable coronary heart disease, 183 cases of acute coronary syndrome, and a total of 253 coronary heart disease patients (the sum of stable coronary heart disease and acute coronary syndrome); B is the analysis of whether NFAM1 can be used for early prediction of coronary heart disease by using the receiver operating characteristic curve (ROC curve).

[0035] Figure 2 It is an expression verification diagram of the monocyte model with stable knockdown of NFAM1 in Example 2; wild-type U-937 cells without transfection treatment, negative control shRNA cells, and NFAM1 shRNA cells with stable knockdown of NFAM1 were used to measure the expression of NFAM1 respectively; wherein, A is the comparison diagram of real-time fluorescence quantitative PCR results, B is the comparison diagram of flow cytometry analysis results, and C is the comparison diagram of Western Blot results.

[0036] Figure 3Results of the effect of inhibiting NFAM1 expression on the expression of monocyte chemokine receptors in Example 3; wild-type U-937 cells without transfection treatment, negative control shRNA cells, and NFAM1 shRNA stable knockdown NFAM1 cells were used to measure the expression of chemokine receptors CCR2 and CCR5 respectively; among them, A is the comparison chart of real-time fluorescence quantitative PCR results, and B is the comparison chart of flow cytometry analysis results;

[0037] Figure 4 Comparison chart of the results of inhibiting the chemotactic migration ability of monocytes under the action of chemokine MCP-1 or CCL5 by inhibiting NFAM1 expression in Example 4;

[0038] Figure 5 Diagram of inhibiting the activation of the p38 MAPK pathway by inhibiting NFAM1 expression in Example 5; A is the comparison chart of the effect of inhibiting NFAM1 expression on the activation of the p38 MAPK pathway induced by MCP-1; B is the comparison chart of the effect of inhibiting NFAM1 expression on the activation of the p38 MAPK pathway induced by CCL5;

[0039] Figure 6 Schematic diagram of the chemical structures of AMPK agonists M1, MP, and 119 used in Example 6;

[0040] Figure 7 Experimental example of screening compounds capable of regulating NFAM1 expression using NFAM1 as a target in Example 6, comparison chart of Western blot results. Detailed implementation manners

[0041] The following specific examples are only used to illustrate the present invention in detail and are not used to limit the scope of the present invention. Without special instructions, the experimental methods or experimental materials used in the following examples are conventional means well known to those skilled in the art, and the reagents used can be obtained from commercial channels.

[0042] The overall experimental scheme of the present invention is as follows:

[0043] The NFAT activating protein NFAM1 with ITAM motif 1 involved in the present invention is derived from transcriptome sequencing and subsequent bioinformatics analysis of monocytes sorted from the peripheral blood of coronary heart disease patient groups and control groups. Analysis of the transcriptome results found that the expression of NFAM1 in peripheral blood monocytes of coronary heart disease patients was significantly up-regulated. To study the correlation between NFAM1 and the occurrence and development of coronary heart disease, the inventors further collected peripheral blood samples from 332 patients (including 79 control cases, 70 cases of stable coronary heart disease, and 183 cases of acute coronary syndrome), and performed flow cytometry analysis, which confirmed that the expression of NFAM1 protein in peripheral blood monocytes of coronary heart disease patients was significantly increased. Combining clinical index analysis, it was found that NFAM1 could be used as a biomarker or therapeutic target for early warning or prevention and treatment of coronary heart disease. Further, the inventors constructed a monocyte cell line with knocked-down NFAM1, explored the effect of NFAM1 on the biological functions of monocytes, and found that inhibiting the expression level of NFAM1 could effectively reduce the expression of chemokine receptors CCR2 and CCR5, and inhibit the activation of the p38 MAPK pathway, thereby inhibiting the chemotactic migration of monocytes.

[0044] The statistical methods involved in the present invention:

[0045] Quantitative variables with normal distribution are expressed as mean ± standard deviation, and quantitative variables with non-normal distribution are expressed as median + interquartile ranges (IQRs); the between-group differences of quantitative variables are calculated using Student's t-test, One-way or Two-way ANOVA; Spearman test is used to evaluate the expression level of NFAM1 and clinical indicators or risk factors; ROC curve is used to evaluate the predictive degree of NFAM1 expression for the occurrence of coronary heart disease. In flow cytometry analysis, the expression of NFAM1 in monocytes is expressed as positive percentage (%), and other indicators are expressed as median fluorescence intensity (MFI). Data analysis uses Graphpad Prism 7 and SPSS Statistics 26, and p < 0.05 indicates statistical significance.

[0046] Example 1. Correlation between the level of NFAM1 in human peripheral blood monocytes and the occurrence and development of coronary heart disease

[0047] From April 2018 to November 2018, patients suspected of having coronary atherosclerotic disease who underwent coronary CT / angiography examination in Fuwai Hospital were enrolled in this invention. This study has been approved by the Ethics Committee of Fuwai Hospital, and all enrolled patients have signed informed consent.

[0048] The acute coronary syndromes included in this invention were ST-segment elevation myocardial infarction (STEMI), non-ST-segment elevation myocardial infarction (NSTEMI), and unstable angina (determined by Brauwald classification), with a total of 183 cases; coronary CT / angiography showed that at least one major coronary artery (diameter ≥ 2.5 mm) had a stenosis lesion of ≥ 50%, and the diagnosis of stable coronary heart disease was made in 70 cases; the control group was a normal population without symptoms of coronary heart disease angina and with < 50% stenosis by coronary CT / angiography, with a total of 79 cases.

[0049] This invention extracted peripheral blood samples and used BD CPT TM Vacutainer (BD, USA, catalog number 362761) to separate peripheral blood mononuclear cells. The specific operation referred to the supplier's instructions. 100 μL of NFAM1 antibody (Abcam, catalog number ab203206) diluted 1:100 in PBS was added and incubated at 4°C for 1 hour. After washing twice with PBS, 1:100 μL of fluorescein-conjugated secondary antibody goat anti-rabbit FITC antibody FITC (BD, USA, catalog number 554020) diluted 1:2500 in PBS was added and incubated at 4°C for 40 minutes. The cells were washed twice with PBS, resuspended in 100 μL of PBS, filtered through a 40-μm filter membrane into a flow cytometry tube, and the expression level of NFAM1 was detected using a FACSMelody flow cytometer (BD, USA).

[0050] The results showed that ( Figure 1 as shown in A), compared with the normal control group, the expression of NFAM1 in peripheral blood monocytes of coronary heart disease patients was significantly upregulated (p < 0.0001). Further classified according to the disease severity, compared with the normal control group (65.31% (49.87% - 78.97%)), the expression of NFAM1 was significantly increased in peripheral blood monocytes of stable coronary heart disease (85.44% (75.22% - 91.43%)) and acute coronary syndrome (86.14% (77.71% - 91.58%)) (p < 0.0001). The results of ROC curve analysis ( Figure 1 as shown in B) showed that the area under the curve (AUC) of NFAM1 for the prediction of coronary heart disease was 0.816 (specificity 84.8%, sensitivity 65.6%), proving that early warning of the occurrence of coronary heart disease can be achieved by detecting the expression level of NFAM1 in peripheral blood monocytes.

[0051] Table 1 Correlation between the expression level of NFAM1 in human peripheral blood monocytes and the clinical characteristics of coronary heart disease

[0052] Clinical characteristics Correlation coefficient p value Significance a Sex -0.128 0.020 * Age 0.113 0.041 * Body mass index (BMI) -0.024 0.662 - History of hypertension -0.184 0.001 ** History of diabetes mellitus -0.066 0.233 - History of hyperlipidemia -0.163 0.003 ** Family history 0.022 0.685 - Current smoker -0.115 0.036 * Alcohol consumption 0.094 0.087 - Total white blood cell count (WBC) 0.307 0.000 ** Percentage of neutrophils (NEUT%) 0.264 0.000 ** Glucose 0.148 0.007 ** Triglyceride 0.006 0.916 - Total cholesterol -0.144 0.009 ** High-density lipoprotein cholesterol (HDL-C) -0.109 0.047 * Low-density lipoprotein cholesterol (LDL-C) -0.129 0.019 * Glycated hemoglobin (HBAlc) 0.126 0.023 * Creatinine 0.035 0.524 - Lactate dehydrogenase (LDH) 0.200 0.000 ** High-sensitivity C-reactive protein (Hs-CRP) 0.274 0.000 ** Apolipoprotein A (ApoA) -0.229 0.000 ** Apolipoprotein B (ApoB) -0.105 0.057 - Lipoprotein (a) (Lp(a)) 0.095 0.086 - Potassium (Ka) -0.092 0.095 - N-terminal pro-brain natriuretic peptide (NT-ProBNP) 0.283 0.000 ** Beta-blocker -0.136 0.014 * Angiotensin-converting enzyme inhibitor (ACE-I) -0.055 0.320 - Aspirin -0.118 0.032 * Statins -0.147 0.008 ** Metformin -0.016 0.769 -

[0053] In Table 1, the statistical correlation coefficient is the Spearman correlation coefficient. When p<0.05, the larger the absolute value of the correlation coefficient, the better the correlation, the positive number is positive correlation, and the plural number is negative correlation. ** indicates p<0.01, and * indicates p<0.05. As shown in Table 1, the expression of NFAM1 is not correlated or weakly correlated with various clinical indicators and risk factors. Except for the total white blood cell count (WBC), the absolute values ​​of all correlation coefficients are below 0.3, indicating that the expression of NFAM1 is not affected by other indicators and can be used as an independent early warning biomarker for coronary heart disease.

[0054] Example 2: Establishment and verification of a stable NFAM1 knockdown monocyte model

[0055] 1. Culture of monocytic cell lines

[0056] Human histiocytic lymphoma cells (U-937) were cultured in RPMI-1640 medium (Corning, USA) containing 10% FBS, and the medium was changed every 3-4 days. The cells were centrifuged at 800 rpm for 4 minutes, and then fresh medium was replaced. Cells in logarithmic growth phase were used for subsequent experimental operations.

[0057] 2. Construction of U-937 cell line with stable knockdown of NFAM1

[0058] U-937 cells in the logarithmic growth phase were infected with recombinant lentivirus containing shRNA that inhibits NFAM1 expression (sequence as shown in SEQ ID No. 1, specifically: gcaggatcac ctatccatac acgaatgtat ggataggtgatcctgc) and the corresponding negative control (sequence as shown in SEQ ID No. 2, specifically: cctaaggtta agtcgccctcgccgaagcgagggcgactta accttagg), the multiplicity of infection (MOI) was 10, and the infected lentiviral vector and virus particles were constructed by Beijing Hesheng Gene Technology Co., Ltd. After 16 hours of infection, fresh culture medium was replaced, and 250 ng / mL puromycin was given for screening after 96 hours of infection. After 1 week of resistance screening, the cell concentration was diluted to 0.8-1 cells / well using a culture medium containing 250 ng / mL puromycin and inoculated into a 96-well cell culture plate. After 4-5 days of culture, the monoclonal wells that generated a single cell population were observed under an inverted microscope and marked once. After another week of culture, single cell clones were selected and placed in 24-well culture plates for expansion. The knockdown efficiency was verified by real-time fluorescence quantitative PCR, flow cytometry, and Western blot. The cell population obtained after verification was the U-937 cell line with stable knockdown of NFAM1, and the cell line stably transfected with negative control lentiviral particles was used as a negative control.

[0059] 3. Expression verification after NFAM1 knockdown

[0060] In this experiment, the knockdown efficiency was verified by real-time fluorescence quantitative PCR, flow cytometry analysis, and Western blot. The cell line stably transfected with negative control lentiviral particles was used as a control.

[0061] 3.1 Detection of NFAM1 mRNA expression changes by real-time fluorescence quantitative PCR

[0062] Take the stably knocked-down NFAM1 cells, negative control cells, and U-937 cells without transfection treatment in the logarithmic growth phase, count and collect 1×10 6 cells, centrifuge at 800 rpm for 4 minutes, and discard the supernatant. Total cellular RNA was extracted from the cells using the TRIzol method (Thermo Fisher Scientific, USA, catalog number 15596-026), and reverse transcribed into cDNA ( One-step cDNA synthesis kit, TransGen Biotech, Beijing, catalog number AT311), and a qPCR kit (TransGen Biotech, Beijing, catalog number AQ142) was used. The gene expression level was detected using an ABI7900HT real-time fluorescence quantitative PCR instrument (Applied Biosystems, USA). GAPDH was used as an internal reference, and the relative expression of the gene was calculated by the ΔΔCt method. The specific primers for amplifying NFAM1 were synthesized by Genewiz, Suzhou, and the sequences are shown in Table 2.

[0063] Table 2 Primer sequences

[0064] Primer name Primer sequence Number NFAM1-Forward 5'-CACTCCCCAATTCAAGGTTTTCA-3' SEQ ID No.3 NFAM1-reverse 5’-GTTGGCTTCTTAGGGCTCCTC-3’ SEQ ID No.4 GAPDH-Forward 5’-ATGGGGAAGGTGAAGGTCG-3' SEQ ID No.5 GAPDH-Reverse 5'-CTGGAAGATGGTGATGGGATT-3' SEQ ID No.6

[0065] The qPCR reaction system is shown in Table 3.

[0066] Table 3 Reaction system

[0067]

[0068] The qPCR reaction conditions are as follows:

[0069] 94°C, 30 sec; 94°C, 5 sec, 60°C, 30 sec, 45 cycles; Dissociation Stage.

[0070] 3.2 Detection of NFAM1 protein expression changes by flow cytometry analysis

[0071] Take the stably knocked-down NFAM1 cells, negative control cells, and U-937 cells without transfection treatment in the logarithmic growth phase, count and collect 1×10 6Cells were centrifuged at 800 rpm for 4 minutes, and the supernatant was discarded. The cell pellet was washed twice with 1×PBS buffer, centrifuging at 800 rpm for 4 minutes each time. 100 μL of primary antibody NFAM1 antibody diluted 1:500 in PBS (Abcam, catalog number ab203206) was added and incubated at 4°C for 1 hour. After washing twice with PBS, 1:100 μL of Alexa 647 goat anti-rabbit secondary antibody (Abcam, catalog number ab150079) diluted 1:2500 in PBS was added and incubated at 4°C for 40 minutes. The cells were washed twice with PBS, resuspended in 100 μL of PBS, filtered through a 40-μm filter membrane into a flow cytometry tube, and the expression level of NFAM1 was detected using a BD FACSMelody flow cytometer.

[0072] 3.3 Detection of changes in NFAM1 protein expression by Western blot

[0073] Stably knocked-down NFAM1 cells, negative control cells, and untransfected U-937 cells in the logarithmic growth phase were counted and 1×10 6 cells were collected, centrifuged at 800 rpm for 4 minutes, and the supernatant was discarded. The cell pellet was washed twice with pre-cooled 1×PBS buffer, centrifuging at 800 rpm for 4 minutes each time. 100 μL of pre-cooled RIPA cell lysate (Beijing Pulilai Gene Technology Co., Ltd., catalog number C1053+) containing protease inhibitor (Roche, catalog number 04693159001) and phosphatase inhibitor (Roche, catalog number 4906845001) was added to extract total protein from the cells, and the protein concentration was measured using a BCA assay kit (Beijing Pulilai Gene Technology Co., Ltd., catalog number P1511).

[0074] In this experiment, a 10% separating gel and a 5% stacking gel were used, and the protein loading amount was 15 μg. After transferring the membrane, the PVDF membrane was incubated with NFAM1 antibody (Sigma-Aldrich, catalog number HPA031812, diluted 1:1250) overnight at 4°C. After washing three times with 1×TBS-T, coupled horseradish peroxidase goat anti-rabbit secondary antibody (Abcam, catalog number ab6721, diluted 1:5000) was added and incubated at room temperature for 1 hour. After washing three times with 1×TBS-T, exposure was performed using a Shanghai Qinxiang ChemiScope series chemiluminescence imaging system (3300mini) and an ECL detection kit (GE Healthcare, catalog number RPN2235), and β-actin was used as an internal reference to detect the expression level of NFAM1.

[0075] 4. Results

[0076] The present invention adopts the method of lentivirus infection. After adding resistance screening for one week, cells are inoculated into a 96-well plate at a concentration of 0.8 - 1 cell / well to screen for cell monoclonal. Combined with flow cytometry analysis, Western blot, and real-time fluorescence quantitative PCR methods, this method can obtain cell monoclonal with stable knockdown of the target protein within 3 - 4 weeks. Compared with the traditional method of limiting dilution, it saves more reagents and consumables. Approximately 30 monoclonal cell lines can be obtained from each 96-well plate, and the protein level expression is stable. In this experiment, through real-time fluorescence quantitative PCR( Figure 2 A), flow cytometry analysis( Figure 2 B), and Western blot( Figure 2 C), monoclonal U-937 cell lines with stable knockdown of NFAM1 were selected and identified for the research on the function and application of this protein.

[0077] Example 3. Effects of Inhibiting NFAM1 Expression on the Expression of Monocyte Chemokine Receptors

[0078] 1. Detection of the Transcription Level of Chemokine Receptors

[0079] The present invention uses real-time fluorescence quantitative PCR to detect the transcription levels of coronary heart disease-related chemokine receptors CCR2 and CCR5. In the experiment, TRIzol method (Thermo Fisher Scientific, USA, catalog number 15596 - 026) was used to extract total cellular RNA, which was reverse transcribed into cDNA( One-step cDNA synthesis kit, TransGen Biotech, Beijing, catalog number AT311), and qPCR kit (TransGen Biotech, Beijing, catalog number AQ142) was used. The gene expression level was detected by placing it in an ABI7900HT fluorescence quantitative PCR instrument (Applied Biosystems, USA). Using GAPDH as the internal reference, the relative expression level of the gene was calculated by the ΔΔCt method. The specific primers for amplifying CCR2 and CC5 were synthesized by Genewiz, Suzhou, and the sequences are as follows. The qPCR reaction system and reaction conditions are the same as those in Example 2.

[0080]

[0081]

[0082] 2. Detection of the Protein Level of Chemokine Receptors

[0083] Stable NFAM1-knockdown cells, negative control cells, and untransfected U-937 cells in the logarithmic growth phase were taken, counted, and 1×10 6Cells were centrifuged at 800 rpm for 4 minutes, and the supernatant was discarded. The cell pellet was washed twice with 1×PBS buffer, centrifuged at 800 rpm for 4 minutes each time. 100 μL of anti-human CD192 (CCR2) antibody conjugated with APC or anti-human CD195 (CCR5) antibody conjugated with PE / Cy7 (both from BioLegend) diluted 1:200 in PBS was added respectively, and incubated at 4°C for 40 minutes. The cells were washed twice with PBS, resuspended in 100 μL of PBS, filtered through a 40-μm filter into a flow tube, and the expression levels of chemokine receptors CCR2 and CCR5 were detected using a BD FACSMelody flow cytometer.

[0084] 3. Results

[0085] In the present invention, by inhibiting the expression of NFAM1 in monocytic cell lines, it was demonstrated that the chemokine receptors CCR2 and CCR5 related to coronary heart disease endogenously expressed in monocytes were significantly decreased at the transcriptional level ( Figure 3 in A) and protein level ( Figure 3 in B), with p < 0.0001. Compared with the negative control group, the CCR2 mRNA level decreased by 77.8%, the protein level decreased by 58.2%, the CCR5 mRNA level decreased by 64.4%, and the protein level decreased by 51.6%.

[0086] Example 4. Effect of inhibiting NFAM1 expression on monocyte chemotaxis

[0087] In this example, a chamber (Corning) was used to detect the chemotactic ability of monocytes. One day before the experiment, stably knocked-down NFAM1 cells and negative control U-937 cells in the logarithmic growth phase were taken, and the cell concentration was adjusted to 1×10 6 / mL and starved for 24 hours in RPMI-1640 medium containing 0.5% fetal bovine serum. On the day of the experiment, 600 μL of RPMI-1640 medium containing 0.5% fetal bovine serum and 100 ng / mL recombinant human MCP-1 (i.e., CCL2, product number 300-04) or 100 ng / mL recombinant human RANTES (i.e., CCL5, product number 300-06) (both purchased from PeproTech) was added to the lower chamber of the chamber (diameter 6.5 mm, polycarbonate semi-permeable membrane pore size 5.0 μm). A blank medium without chemokine was used as a negative control for migration background and placed in a 37°C incubator to equilibrate. 100 μL of 2×10 5 cells was added to the upper chamber, placed in a 37°C incubator for 4 hours, the cells in the lower chamber were collected, centrifuged, resuspended in PBS, and the number of cells migrated to the lower chamber was detected using a BD FACSMelody flow cytometer. The relative migration rate of the cells was calculated.

[0088] Relative migration rate = number of cells migrated to the lower chamber under the action of chemokine / number of cells migrated to the lower chamber in the negative control.

[0089] The results showed ( Figure 4 ), NFAM1 was closely related to monocyte chemotaxis. After knocking down its expression, the chemotactic ability of monocytes under the action of human recombinant chemokines MCP-1 and CCL5 decreased by 81% (p < 0.0001) and 42.4% (p = 0.0003), respectively.

[0090] Example 5, Effect of inhibiting NFAM1 expression on the activation of p38 MAPK pathway induced by chemokines

[0091] In this example, the effect of inhibiting NFAM1 expression on the p38 MAPK signaling pathway was detected by Western blot.

[0092] One day before the experiment, stable NFAM1-knockdown cells and negative control U-937 cells in the logarithmic growth phase were taken, and the cell concentration was adjusted to 1×10 6 / mL and starved in serum-free RPMI-1640 medium for 24 hours. On the day of the experiment, serum-free FBS RPMI-1640 medium containing 100 ng / mL recombinant human MCP-1 (i.e., CCL2, product number 300-04) or 100 ng / mL recombinant human RANTES (i.e., CCL5, product number 300-06) (both purchased from PeproTech) was added to the cells and placed in a 37°C incubator for equilibration. Cells were collected at 0, 10, 30, 60, 120, and 240 minutes after the action of chemokines. The specific implementation steps of cell lysis, total protein extraction and determination, and Western blot were the same as those in Example 3. The primary antibodies included phosphorylated-p38 MAPK rabbit monoclonal antibody (product number 4511) and p38 MAPK rabbit monoclonal antibody (product number 8690) (both purchased from CST). β-actin mouse monoclonal antibody (TransGen Biotech, product number HC201-01) was used as an internal reference. The corresponding secondary antibodies were horseradish peroxidase-labeled goat anti-rabbit secondary antibody (Abcam, product number ab6721) or horseradish peroxidase-labeled goat anti-mouse secondary antibody (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., product number ZB2305), diluted 1:5000. The bands were exposed using a Shanghai Qinxiang ChemiScope series chemiluminescence imaging system (3300mini) and an ECL detection kit (GE Healthcare, product number RPN2235), and gray-scale analysis was performed using Image J software.

[0093] The results showed ( Figure 5) The expression of phosphorylated p38 MAPK in monocytes gradually increased over time with the stimulation of chemokines MCP-1 and CCL5. After 30 minutes of MCP-1 stimulation, the activation level of the p38 MAPK pathway in NFAM1 knockdown cells showed a significant inhibitory trend compared with the control group, with a 58.2% decrease in the activation level (p = 0.047). After 60 minutes, it was inhibited by 49.8% (p = 0.036), and the highest inhibitory level reached 69.1% at 120 minutes (p < 0.0001). After inhibiting NFAM1 expression, the activation of the p38 MAPK pathway under CCL5 stimulation also showed an inhibitory trend, which was inhibited by 52.8% after 120 minutes (p = 0.0008) and reached 56.6% at 240 minutes (p = 0.0006).

[0094] Example 6: Example of Using NFAM1 as a Target in Screening Compounds that Regulate NFAM1 Expression

[0095] In this example, the regulatory effects of a series of compounds on NFAM1 expression were detected by Western blot method, as an example of the application of using NFAM1 as a target in searching for or screening drugs or biological agents for preventing and treating coronary heart disease and coronary heart disease-related diseases.

[0096] One day before the experiment, U-937 cells in the logarithmic growth phase were taken and the cell concentration was adjusted to 1×10 6 / mL and starved overnight in serum-free RPMI-1640 medium. On the day of the experiment, the specific inhibitor of AMPK, compound C (20 μM / L), was added to the cells respectively. After incubating in a cell culture incubator at 37°C for 2 h, DMSO (Sigma-Aldrich, catalog number D2650), AICAR (Topscience Biotech Co., Ltd., Shanghai, catalog number T1477, 1 mmol / L), A-769662 (Topscience Biotech Co., Ltd., Shanghai, catalog number T2468, 100 μmol / L), M1 (100 μmol / L), 119 (100 μmol / L), and MP (1 μmol / L) were added to each well. Among them, M1 is the main metabolite of the novel AMPK agonist IMM-H007 developed by the Institute of Materia Medica, Chinese Academy of Medical Sciences. MP is the metabolite and main active molecule of M1, and 119 is a homolog of IMM-H007. M1, 119, and MP were synthesized by the Institute of Materia Medica, and their structures are as Figure 6 shown. After adding the compounds, the cells were collected after incubating in a cell culture incubator at 37°C for 24 hours.

[0097] The specific implementation steps of cell lysis, total protein extraction and determination, and Western blot were the same as those in Example 3. The primary antibody was a rabbit polyclonal antibody against NFAM1 (Sigma-Aldrich, catalog number HPA031812, diluted 1:1250), and a mouse monoclonal antibody against β-actin (TransGen Biotech, catalog number HC201-01) was used as an internal reference. The primary antibody was incubated overnight at 4°C. The corresponding secondary antibody was a horseradish peroxidase-labeled goat anti-rabbit secondary antibody (Abcam, catalog number ab6721) or a horseradish peroxidase-labeled goat anti-mouse secondary antibody (Zhongshan Golden Bridge Biotechnology Co., Ltd., catalog number ZB2305), diluted 1:5000. The bands were exposed using a ChemiScope series chemiluminescence imaging system (3300mini) from Shanghai Qinxiang and an ECL detection kit (GE Healthcare, catalog number RPN2235), and gray-scale analysis was performed using Image J software.

[0098] The results are as Figure 7 shown. The compound used in this example had no significant effect on the protein expression level of NFAM1 in U-937 monocytes. However, the experimental method adopted in this example can be used as an application example for searching or screening drugs or biological agents for the prevention and treatment of coronary heart disease and coronary heart disease-related diseases with NFAM1 as a target.

[0099] The above description is only a general description and a preferred implementation of the present invention, and does not limit the present invention. Any modification, equivalent replacement, or improvement made without departing from the spirit and principle of the present invention falls within the scope of protection required by the present invention.

Claims

1. Use of NFAT activating protein NFAM1 with ITAM motif 1 in the preparation of a kit for assessing the risk of coronary heart disease.

2. The application according to claim 1, characterized in that, The assessment includes any one or more of early warning, early diagnosis, and / or prognosis assessment.

3. The application according to claim 1, wherein The coronary heart disease includes stable coronary heart disease and / or acute coronary syndrome.

4. The application according to claim 1, characterized in that The assessment of the risk of coronary heart disease is by measuring the expression of NFAM1 in monocytes in a blood sample of an individual and determining whether the expression level of NFAM1 is increased compared to a control group.

5. The application according to claim 1, characterized in that The reagent for measuring the expression of NFAM1 in monocytes in the blood sample of the individual includes any one or more of primers, probes, and antibodies for detecting NFAM1.

6. Use of a reagent that inhibits the expression of NFAM1 protein in the preparation of a drug for inhibiting the migration and / or spread of lymphoma cells.

7. An shRNA that specifically inhibits the expression of the NFAM1 gene, characterized in that, The nucleotide sequence of the shRNA is as shown in SEQ ID No.1.

Images