SiRNA targeting rps4x gene, lamb3-pi3k-akt signal pathway inhibitor, ovarian cancer drug and application

Abstract

The present application relates to the technical field of RPS4X, and particularly relates to siRNA targeting RPS4X gene, LAMB3-PI3K-AKT signal pathway inhibitor, ovarian cancer drug and application. The siRNA targets and interferes with RPS4X gene expression. The siRNA and the LAMB3-PI3K-AKT signal pathway inhibitor are used on in-vitro ovarian cancer cells and in-vivo ovarian cancer tissues, and both have the effect of inhibiting proliferation, migration and invasion. The various siRNAs targeting RPS4X gene and the LAMB3-PI3K-AKT signal pathway inhibitors provided in the embodiments have the effects of promoting apoptosis of ovarian cancer cells and tissues and inhibiting tumor angiogenesis, have obvious ovarian cancer prevention and treatment effects, and have the application prospect of developing as ovarian cancer drugs.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of RPS4X, and particularly relates to siRNA targeting RPS4X gene, LAMB3-PI3K-AKT signal pathway inhibitor, ovarian cancer drug and application. BACKGROUND

[0002] RPS4X gene is located on X chromosome, specifically at Xp22.31 region. The protein encoded by RPS4X gene is X-chromosome homolog of ribosomal protein S4 (X-linked ribosomal protein S4, RPS4X), which is a component of ribosome and participates in protein synthesis process.

[0003] RPS4X is one of the components of the small subunit of ribosome and plays a key role in the assembly of ribosome. It participates in the formation of specific structure of ribosome, provides a platform for mRNA binding and translation, and is crucial for each stage of protein synthesis initiation, elongation and termination, ensuring normal synthesis and update of proteins in cells.

[0004] RPS4X gene indirectly affects cell growth and proliferation by participating in protein synthesis. Normal protein synthesis is the basis of cell growth, division and proliferation, and normal expression and function of RPS4X gene are necessary to maintain normal growth rate and proliferation capacity of cells. In each stage of cell cycle, RPS4X participates in synthesis of proteins to provide necessary material basis and regulatory signals.

[0005] Mutation or abnormal expression of RPS4X gene may be related to certain neurodevelopmental disorders such as intellectual disability and developmental delay. Due to its important role in brain development and neural cell function, changes in the gene may affect protein synthesis and function of neural cells, leading to abnormal neurodevelopment, manifested as decreased cognitive ability, learning disability, behavioral abnormalities and other symptoms. SUMMARY

[0006] The present application finds that RPS4X, as an RNA binding protein, drives ovarian cancer cell invasion and metastasis by activating LAMB3-PI3K-AKT signal pathway.

[0007] LAMB3-PI3K-AKT signaling pathway is a signal transduction pathway that plays an important role in cell biology, which is composed of LAMB3 (laminin beta 3), PI3K (phosphatidylinositol 3-kinase) and AKT (protein kinase B). LAMB3 is involved in the important component of the basement membrane, which can bind to the integrin receptor on the cell surface, thereby mediating the adhesion between cells and extracellular matrix, and further activating the intracellular signal transduction pathway. PI3K is a lipid kinase, which can be divided into type I, type II and type III. In the LAMB3-PI3K-AKT signaling pathway, type I PI3K is usually involved. PI3K can be activated by various cell surface receptors, such as integrin, growth factor receptor, etc. Activated PI3K can phosphorylate phosphatidylinositol-4,5-bisphosphate (PIP2) to generate phosphatidylinositol-3,4,5-trisphosphate (PIP3). AKT is a serine / threonine protein kinase, also known as PKB. AKT is an important downstream effector of PI3K, and PIP3 can recruit AKT to the cell membrane and activate it under the action of phosphoinositide-dependent kinase 1 (PDK1) and the like.

[0008] The present application finds that RPS4X can not only bind to a large number of oncogene mRNAs, but also bind to LAMB3 mRNA and activate its expression, thereby recruiting and activating PI3K. Activated PI3K catalyzes the conversion of PIP2 to PIP3, and PIP3 accumulates on the cell membrane to act as a second messenger. PIP3 binds to the PH domain of AKT, causing AKT to transfer from the cytoplasm to the cell membrane, and under the action of kinases such as PDK1 and mTORC2, the Thr308 and Ser473 sites of AKT are phosphorylated, thereby being completely activated. With the activation of the LAMB3-PI3K-AKT signaling pathway, it can promote the invasion and migration of ovarian cancer cells.

[0009] Therefore, the present application provides siRNA targeting RPS4X gene, LAMB3-PI3K-AKT signaling pathway inhibitor, ovarian cancer drug and application. The siRNA targets and interferes with the expression of RPS4X gene. The siRNA and the LAMB3-PI3K-AKT signaling pathway inhibitor act on in vitro ovarian cancer cells and in vivo ovarian cancer tissues, and both have the effect of inhibiting the proliferation, migration and invasion thereof. The various siRNAs targeting RPS4X gene and the LAMB3-PI3K-AKT signaling pathway inhibitors provided in the examples have the effects of promoting the apoptosis of ovarian cancer cells and tissues and inhibiting tumor angiogenesis, have obvious prevention and treatment effects on ovarian cancer, and have the application prospect of developing as ovarian cancer drugs.

[0010] The present application provides a biomarker associated with the prognosis of ovarian cancer in the first aspect, which comprises RPS4X.

[0011] The second aspect of the present application provides a kit for predicting the prognosis of ovarian cancer, comprising at least one of an RT-PCR reagent for detecting the relative expression amount of RPS4X mRNA and an RPS4X monoclonal antibody. The RT-PCR reagent for detecting the relative expression amount of RPS4X mRNA comprises a primer pair as shown in SEQ ID NO: 13 and SEQ ID NO: 14, and a primer pair as shown in SEQ ID NO: 15 and SEQ ID NO: 16.

[0012] The third aspect of the present application provides the use of at least one of the RT-PCR reagent for detecting the relative expression amount of RPS4X mRNA and the RPS4X monoclonal antibody in the second aspect in the preparation of a kit for detecting the prognosis of ovarian cancer.

[0013] The fourth aspect of the present application provides an RPS4X inhibitor, comprising at least one of an siRNA targeting the RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA.

[0014] The fifth aspect of the present application provides an LAMB3-PI3K-AKT signaling pathway inhibitor, comprising at least one of an siRNA targeting the RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA.

[0015] The sixth aspect of the present application provides an ovarian cancer drug, which takes at least one of an siRNA targeting the RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA as an active ingredient.

[0016] In specific embodiments, the siRNA targeting the RPS4X gene is at least one of an siRNA as shown in SEQ ID NO: 1 and 2, an siRNA as shown in SEQ ID NO: 3 and 4, an siRNA as shown in SEQ ID NO: 5 and 6, or an siRNA as shown in SEQ ID NO: 7 and 8.

[0017] In specific embodiments, the recombinant lentivirus vector comprising the siRNA is a GV493 plasmid (Jikai Biological) carrying a nucleotide sequence as shown in at least one of an siRNA as shown in SEQ ID NO: 1 and 2, an siRNA as shown in SEQ ID NO: 3 and 4, an siRNA as shown in SEQ ID NO: 5 and 6, or an siRNA as shown in SEQ ID NO: 7 and 8.

[0018] In specific embodiments, the recombinant lentivirus vector comprising the siRNA is a lentivirus carrying a nucleotide sequence as shown in at least one of the siRNA as shown in SEQ ID NO: 1 and 2, the siRNA as shown in SEQ ID NO: 3 and 4, the siRNA as shown in SEQ ID NO: 5 and 6, or the siRNA as shown in SEQ ID NO: 7 and 8.

[0019] It should be understood that the general description above and the detailed description below are merely exemplary and explanatory, and are not limiting of the present application.

[0020] The beneficial technical effects of the present application are:

[0021] The present application provides interfering RNAs capable of interfering with the expression of RPS4X in ovarian cancer cells, and through detection, it is found that these interfering RNAs can also inhibit the LAMB3-PI3K-AKT signaling pathway in ovarian cancer cells, and further inhibit the migration and invasion of ovarian cancer cells.

[0022] The present application finds that the interfering effect of the interfering RNAs provided in the examples on ovarian cancer cells is significantly better than that of the comparative examples. Moreover, the inhibitory effect of the interfering RNAs provided in the examples on the LAMB3-PI3K-AKT signaling pathway of ovarian cancer cells, the migration and invasion of ovarian cancer cells are all better than those of the comparative examples.

[0023] In addition, the present application finds through in vivo tests that the lentivirus carrying the interfering RNA sequence provided in the examples can inhibit the growth of tumor volume in ovarian cancer tumor mice, and can inhibit the expression of NRP-2, RAD51C and VEGF in ovarian cancer tissues, inhibit genomic instability in tumor tissues, inhibit angiogenesis, and inhibit lymphatic metastasis of tumor cells, thereby inhibiting the growth, metastasis and invasion of ovarian cancer cells. Moreover, the lentivirus carrying the interfering RNA sequence provided in the examples has obvious inhibitory effect on NRP-2, RAD51C and VEGF in ovarian cancer tissues in vivo, and has application prospect for developing into an ovarian cancer drug. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1A RPS4X expression in ovarian cancer tissues and para-cancer tissues (red for ovarian cancer group, blue for control group).

[0025] Figure 1B RPS4X expression in TCGA ovarian cancer data classification analysis graph (p-value < 0.001).

[0026] Figure 1C RPS4X expression in TCGA ovarian cancer data period analysis graph (p-value < 0.001).

[0027] Figure 1D Prognostic map for RPS4X expression in ovarian cancer.

[0028] Figure 2 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the expression of RPS4X mRNA in SKOV3 cells and Anglne cells. “*” indicates p-value <0.05, “**” indicates p-value <0.01, “***” indicates p-value <0.05, “ns” indicates no significant difference.

[0029] Figure 3 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the expression of RPS4X protein in SKOV3 cells and Anglne cells.

[0030] Figure 4 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the expression of PI3K, P-PI3K, AKT and P-AKT protein in SKOV3 cells.

[0031] Figure 5 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the migration of SKOV3 cells and Anglne cells. “*” indicates p-value <0.05, “**” indicates p-value <0.01, “***” indicates p-value <0.05, “ns” indicates no significant difference.

[0032] Figure 6 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the invasion of SKOV3 cells and Anglne cells. “*” indicates p-value <0.05, “**” indicates p-value <0.01, “ns” indicates no significant difference.

[0033] Figure 7 Fig. siRNA-1, siRNA-2, siRNA-3, siRNA-4, siNC1, siNC2, siNC3 respectively interfere with the expression of NRP-2, RAD51C and VEGF protein in ovarian cancer tissue of ovarian cancer mice.

[0034] Figure 8For Figure 7 The statistical chart is shown in Figure 1. "**" indicates p-value < 0.01, "***" indicates p-value < 0.05, and "ns" indicates no significant difference. DETAILED DESCRIPTION

[0035] In order to make the purposes, technical solutions and advantages of the present application more clear, the present application is further described in detail below in combination with examples. It should be understood that the specific examples described herein are only used to explain the present application and do not limit the present application. The reagents not described in detail in the present application are conventional reagents and can be obtained from commercial channels; the methods not described in detail are conventional experimental methods and can be known from the prior art.

[0036] 1. Analysis of RPS4X expression in ovarian cancer tissues and normal tissues in TCGA public database

[0037] The proteomic data of ovarian cancer in the TCGA public database were systematically analyzed, and the ovarian cancer and control samples were analyzed by the research group. It was found that the protein expression level of RPS4X in the ovarian cancer data in the TCGA database was analyzed in terms of expression, disease stage and classification, and it was found that RPS4X was highly expressed in ovarian cancer tissues Figure 1A ); the clinical stage and classification results of ovarian cancer showed that the expression of RPS4X in patients with 1, 2 and 3 stage / class ovarian cancer was significantly up-regulated Figure 1B and 1C ), and it was found that the prognosis of patients with ovarian cancer was poor when RPS4X was highly expressed Figure 1D ).

[0038] 2. Targeted interference of RPS4X expression

[0039] (1) siRNA

[0040] The present application realizes the inhibition of RPS4X expression in ovarian cancer cells based on the siRNA mode. For this purpose, the present application provides siRNA for interfering RPS4X. These siRNAs can be synthesized by chemical or biological methods.

[0041] Among them, the sense strand of siRNA-1 for interfering RPS4X is: 5'-GAGGAACAGACUUAAGUAUTT-3', SEQ ID NO: 1. The antisense strand is: 5'-AUACUUAAGUCUGUUCCUCTT-3', SEQ ID NO: 2.

[0042] The sense strand of siRNA-2 interfering with RPS4X is: 5'-GUGCUAACCUAGGAAGAAUTT-3', SEQ ID NO: 3. The antisense strand is: 5'-AUUCUUCCUAGGUUAGCACTT-3', SEQ ID NO: 4.

[0043] The sense strand of siRNA-3 interfering with RPS4X is: 5'-CCACUCGACUUUCCAACAUTT-3', SEQ ID NO: 5. The antisense strand is: 5'-AUGUUGGAAAGUCGAGUGGTT-3', SEQ ID NO: 6.

[0044] The sense strand of siRNA-4 interfering with RPS4X is: 5'-AGCAUCUGAAGCGGGUGGCUUCAAGAGA-3', SEQ ID NO: 7. The antisense strand is: 5'-GCCACCCGCUUCAGAUGCUUUUUU-3', SEQ ID NO: 8.

[0045] As a control, the present application also provides the sense strand of siRNA (siNC1) interfering with RPS4X: 5'-UUCUCCGAACGUGUCACGUTT-3', SEQ ID NO: 9. The antisense strand is: 5'-ACGUGACACGUUCGGAGAATT-3', SEQ ID NO: 10.

[0046] The present application also provides the sense strand of siRNA (siNC2) interfering with RPS4X: 5'-CAGATCTTTGTACGTAATTAA-3', SEQ ID NO: 11. The antisense strand is: 5'-CGGGAGAGAATTTCCGTCTGA-3', SEQ ID NO: 12.

[0047] The present application also provides siRNA (siNC3) interfering with RPS4X: Catalog# AM16708, Thermo Fisher.

[0048] (2) Transfection of ovarian cancer cells with siRNA

[0049] The present application transfects ovarian cancer cells with the above-mentioned double-stranded siRNA, which not only interferes with the expression of RPS4X of ovarian cancer cells, but also inhibits the LAMB3-PI3K-AKT signaling pathway, thereby inhibiting the proliferation, migration and invasion of ovarian cancer cells, promoting the apoptosis of ovarian cancer cells and tissues, and inhibiting tumor angiogenesis, and has obvious preventive and therapeutic effects on ovarian cancer, and has application prospects as an ovarian cancer drug.

[0050] The present application provides a method for interfering with the expression of RPS4X in ovarian cancer cells or inhibiting the LAMB3-PI3K-AKT signaling pathway. The method comprises: mixing at least one of the siRNA interfering with RPS4X and the siRNA interfering with KRAS with a transfection reagent to form a complex of siRNA and transfection reagent; co-culturing the complex with ovarian cancer cells; harvesting and screening positive cells from the co-culture, wherein the positive cells are ovarian cancer cells with inhibited LAMB3-PI3K-AKT signaling pathway.

[0051] In some embodiments, the method for interfering with the expression of RPS4X in ovarian cancer cells or inhibiting the LAMB3-PI3K-AKT signaling pathway specifically comprises:

[0052] 1) Chemically synthesize the above-mentioned siRNA interfering with RPS4X or siRNA interfering with KRAS, and dissolve them in RNase-free water to 20 μM.

[0053] 2) SKOV3 cells (human ovarian cancer cells, CC-Y1473, Shanghai Zymo Biological Technology) or Anglne cells (human ovarian cancer cells, BTCC-1255) in the logarithmic growth phase are inoculated in a 6-well plate at 2×10 6 cells / well, 2 ml of complete culture medium containing 10% fetal bovine serum is added to each well, and the cells are cultured at 37°C and 5% CO2 until they adhere and reach 50% confluence.

[0054] 3) Transfection complex preparation: follow the instructions of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, 100 μL of 50 pmol siRNA in serum-free medium solution is incubated for 5 min. 5 μL of transfection reagent is diluted with serum-free medium to 100 μL, gently mixed, and incubated at room temperature for 5 min. Then mix the diluted siRNA and transfection reagent, gently mix, and incubate at room temperature for 20 min to form a complex of siRNA and transfection reagent.

[0055] 4) Cell transfection: the original culture medium in the 6-well plate is aspirated, and 800 μL of Opti-MEM medium is added to each well. Then the complex of siRNA and transfection reagent is added dropwise to the cell culture well, and the culture plate is gently shaken to evenly distribute the complex. The culture plate is returned to the incubator and cultured at 37°C and 5% CO2 for 6 h, then the complete culture medium is replaced and cultured for another 48 h. Positive cells are screened from the culture, and the positive cells are ovarian cancer cells with interfered RPS4X and / or inhibited LAMB3-PI3K-AKT signaling pathway.

[0056] (3) Transfection of ovarian cancer cells with siRNA-carrying lentivirus or vector

[0057] The embodiments also provide a lentiviral vector carrying the siRNA described above, which is used to mediate the interference of RPS4X. Specifically, the recombinant lentiviral vector is a GV493 plasmid (Jikai Biotechnology) carrying the siRNA clone sequence described above.

[0058] Specifically, the method for preparing the recombinant lentiviral vector comprises: obtaining a linearized GV493 fragment by enzyme digestion, connecting the DNA molecule of any one of SEQ ID NO: 1-6 with the linearized GV493 fragment to obtain a recombinant fragment; transforming the recombinant fragment into E. coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0059] The step of obtaining the linearized GV493 fragment comprises: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37°C for 3h, and recovering the linearized GV493 fragment from the agarose gel after digestion. The plasmid digestion reaction solution contains 2μg of lenti-CRISPRv2, 1μL of 10U / μL AgeI, 1μL of 10U / μL EcoRI, 5μL of 10×CutSmartBuffer, and the balance of water, by 50μL.

[0060] The step of connecting the DNA molecule of any one of SEQ ID NO: 1-8 with the linearized GV493 fragment to obtain a recombinant fragment comprises: preparing a ligation reaction solution, and reacting the ligation reaction solution at 20°C for 1h. The ligation reaction solution contains 100ng of the linearized GV493 fragment, 100ng of the DNA molecule of any one of SEQ ID NO: 1-8, 2μL of 10×T4 DNA Ligation Buffer, 1μL of T4 DNA Ligase, and the balance of water, by 20μL.

[0061] The recombinant lentiviral vector obtained based on the above method is used to transfect cells, so that the recombinant lentivirus carrying the nucleotide sequence of any one of SEQ ID NO: 1-8 can be synthesized in vivo.

[0062] The method for preparing the recombinant lentivirus carrying the nucleotide sequence of any one of SEQ ID NO: 1-8 comprises:

[0063] 1) planting 4×10 6 HEK293T cells in a 10cm dish, and growing to 80% confluence;

[0064] 2) Mix 30 μg of recombinant lentivirus vector carrying any one of the nucleotide sequences of SEQ ID NO: 1-8, 15 μg of pHelperl.0, and 10 μg of pHelper2.0 into 1.5 mL of Opti-MEM to obtain a plasmid diluent;

[0065] 3) Add 80 μL of Lipo-2000 into 1.5 mL of Opti-MEM, and incubate at room temperature for 10 min to obtain a Lipo-2000 diluent;

[0066] 4) Mix the plasmid diluent with the Lipo-2000 diluent, and incubate at room temperature for 30 min to obtain a complex formed by the sufficient combination of the plasmid and Lipo-2000.

[0067] 5) Remove the culture medium in the 10 cm dish, and add the plasmid-liposome complex dropwise into the dish, and gently shake the dish to uniformly distribute the complex on the cell surface. Add an appropriate amount of complete medium to 10 mL, and return to the incubator for continued culture.

[0068] 6) 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube, centrifuge at 3000 rpm for 15 min to remove cell debris, and perform virus concentration by ultracentrifugation.

[0069] 7) The collected virus solution needs to be determined for titer. Common methods include fluorescence quantification (for lentivirus with fluorescent labeling), TCID 50 , and the like, to determine the infection ability of the virus and the required amount of virus for subsequent experiments.

[0070] The recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NO: 1-8 obtained by the above embodiment is transferred into an ovarian cancer cell, and an RPS4X-knocked-down ovarian cancer cell can be obtained.

[0071] Therefore, the present application discloses a method for preparing an RPS4X-knocked-down ovarian cancer cell or an LAMB3-PI3K-AKT signaling pathway-inhibited cell. The method comprises: obtaining an ovarian cancer cell and a recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NO: 1-8; mixing the recombinant lentivirus solution with the culture solution of the ovarian cancer cell for transfection, and culturing the transfected solution to screen an RPS4X-knocked-down ovarian cancer cell.

[0072] In some embodiments, the method for preparing an RPS4X-knocked-down ovarian cancer cell or an LAMB3-PI3K-AKT signaling pathway-inhibited cell specifically comprises:

[0073] 1) One day before transfection, inoculate about 2-5 x 104 Cells, add the appropriate amount of complete medium, so that the cells to reach 40% confluence when transfection, then put the plate back in the incubator for continued culture.

[0074] 2) MOI is 10 and the number of cells per well is 5 x 10 4 6, the titer of lentivirus is 1 x 10 8 TU / mL, then 5 μL of lentivirus stock solution needs to be added to each well, and then diluted to 200 μL with serum-free medium.

[0075] 3) Add 2 μL of 8 mg / mL polybrene solution to the virus dilution solution for 200 μL, mix gently, and incubate at room temperature for 20 min to improve the infection efficiency of the lentivirus.

[0076] 4) Aspirate the original culture medium in the cell culture plate, wash the cells with PBS once, then add the virus dilution solution containing polybrene to the cell culture well, gently shake the plate to evenly distribute the virus solution. Put the plate back in the incubator for continued culture.

[0077] 5) After 18 hours of transfection, aspirate the virus-containing medium, add an appropriate amount of fresh complete medium, and continue to culture the cells to reduce the toxicity to the cells.

[0078] 6) After 48 hours of infection, add puromycin for screening, kill the cells that have not been successfully infected, and the cells that have been successfully infected will survive. Puromycin needs to be added to the medium all the time.

[0079] 7) After 2 days of puromycin screening, WB or Real-time PCR can be used to verify the knockdown or knockdown of RPS4X.

[0080] 3, RT-PCR detection

[0081] Trizol reagent was used to extract total RNA from fresh ovarian cancer cells before and after transfection, NANODROP2000 was used to determine the concentration of total RNA, and agarose gel electrophoresis was used to analyze the quality of RNA. The total RNA of determined concentration and quality was reverse transcribed into cDNA, and the transcription system was 10 μL, containing 2 μL RT Master Mix (5 x), 100 ng-1 μg total RNA and the rest Nuclease-free water.

[0082] cDNA samples were obtained by reverse transcription and then subjected to qPCR. The qPCR reaction volume (20 μL) contained 1 μL cDNA, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 10 μL 1×TSING Master SYBR Green I qPCR Mix-UDG (Without ROX), and the remainder double-distilled water. The qPCR reaction steps were: 50℃, 2 min; 95℃, 2 min; 95℃, 15 s; 40 cycles; 60℃, 1 min. RNA expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. Data analysis was performed using Bio-Rad CFX96 Manager software.

[0083] The upstream primers for detecting RPS4X mRNA were: F1: CAAGGTCCGAACTGATATAAC (SEQ ID NO: 13); R1: CCTCAGGTGTAATACGATGT (SEQ ID NO: 14).

[0084] The upstream primers for detecting GAPDH mRNA were: F2: as shown in SEQ ID NO:15, GGTCGGAGTCAACGGATTTG. R2: as shown in SEQ ID NO:16, GGAAGATGGTGATGGGATTTC.

[0085] like Figure 2 As shown, the relative expression level of RPS4X mRNA in SKOV3 cells or Anglne cells transfected with siRNA-1, siRNA-2, siRNA-3, and siRNA-4 was significantly lower than that in the control group (NC) SKOV3 cells without siRNA transfection, while the relative expression level of RPS4X mRNA in SKOV3 cells transfected with siNC1 and siNC3 was not significantly different from that in the control group. This indicates that the siRNA-1, siRNA-2, siRNA-3, and siRNA-4 provided by this invention have an interfering effect on RPS4X expression in SKOV3 cells or Anglne cells, with siRNA-4 showing the best interfering effect on RPS4X in SKOV3 cells or Anglne cells.

[0086] 4. Western blot (WB) detection

[0087] The ovarian cancer cells before and after transfection were lysed with RIPA lysis buffer, total protein was extracted, and the protein concentration was detected by BCA method. SDS-PAGE electrophoresis was performed, and the gel was transferred to a PDVF membrane using a transmembrane instrument, and was blocked at room temperature for 1-2 h. The primary antibody was incubated at 4°C for 12 hours, and the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG, TBST dilution) was added after washing, and was incubated at room temperature for 2 h, and was developed. The protein expression level was analyzed by ImageJ software with β-Actin as a control. The primary antibody was RPS4X antibody, 14799-1-AP, Proteintech, dilution ratio was 1:1000; or PI3K antibody, sc-365290, Santa Cruz Biotechnology, Inc, 1:1000 dilution; or AKT antibody, 60203-2-Ig, 1:5000 dilution; or Phospho-PI3 Kinase p85 (Tyr458) / p55 (Tyr199) antibody, #4228, Cell Signaling Technology, Inc., dilution ratio was 1:1000; or Phospho-Akt (Ser473) antibody, #9271, Cell Signaling Technology, Inc., dilution ratio was 1:1000.

[0088] As shown in Figure 3 The relative expression amount of RPS4X protein of Anglne cells into which siRNA-1, siRNA-2, siRNA-3 and siRNA-4 were transferred was significantly lower than that of the control group (NC) Anglne cells without transfection of siRNA, and the relative expression amount of RPS4X protein of Anglne cells into which siNC1, siNC2 and siNC3 were transferred had no significant difference with the control group. Therefore, it is proved that the siRNA-1, siRNA-2, siRNA-3 and siRNA-4 provided by the application have interference effect on the expression of RPS4X of SKOV3 cells, and the interference effect of siRNA-4 on RPS4X of SKOV3 cells is the best.

[0089] As shown in Figure 4As shown, the expression of PI3K protein, AKT protein, p-PI3K protein and p-AKT protein of the SKOV3 cells transfected with siRNA-1, siRNA-2, siRNA-3 and siRNA-4 is significantly lower than that of the SKOV3 cells without transfection of siRNA (NC), while the expression of PI3K protein, AKT protein, p-PI3K protein and p-AKT protein of the SKOV3 cells transfected with siNC1, siNC2 and siNC3 has no obvious difference with the control group or only has significant difference in individual protein. Therefore, the siRNA-1, siRNA-2, siRNA-3 and siRNA-4 provided by the application have interference effect on the expression of PI3K protein, AKT protein, p-PI3K protein and p-AKT protein of SKOV3 cells, and the interference effect of siRNA-4 on the PI3K protein, AKT protein, p-PI3K protein and p-AKT protein of SKOV3 cells is the best.

[0090] 5. Cell phenotype detection

[0091] (1) Detection step

[0092] The ovarian cancer SKOV3 cells or Anglne cells before and after transfection were respectively cultured in a complete culture medium containing 10% fetal bovine serum at 37°C and 5% CO2 to the logarithmic phase, the culture medium was removed, the cells were washed with PBS, and then the cells were trypsinized for 1-3 min and blown into single cells with a pipette gun. 15 μL of the cell suspension was taken for counting.

[0093] The Matrigel in the Transwell chamber was diluted 1:8, incubated at 37°C for 2 h until the Matrigel solidified, and then the excess supernatant was removed for subsequent experiments. The Transwell chamber was not treated. The above-mentioned cells to be tested were centrifuged to remove the culture medium, washed with PBS for 1-2 times, and resuspended in serum-free medium.

[0094] 200 μL of resuspended SK-OV-3 cells (invasion: 150,000 cells / chamber; migration: 50,000 cells / chamber) or 200 μL of resuspended Anglne cells (invasion: 200,000 cells / chamber; migration: 100,000 cells / chamber) were added to the Transwell chamber, 600 μL of medium containing 10% FBS was added to the lower chamber of the 24-well plate, and then the Transwell chamber was taken out after 48 h of culture at 37°C. The culture medium in the hole was removed, washed with PBS for 2 times, fixed with 4% PFA for 20 min, washed with PBS for 2 times, stained with 0.1% crystal violet for 10 min, washed with PBS for 2 times, and then the cells in the upper chamber were wiped off with a cotton swab. The migrated cells were observed under a microscope, 3 fields of view representing the distribution of cells in the whole chamber were randomly selected for photography, and the number of migrated and invaded cells was counted.

[0095] AsFigure 5 As shown, the number of SKOV3 cells or Anglne cells transfected with siRNA-1, siRNA-2, siRNA-3, and siRNA-4 migrated significantly less than the control group. The number of SKOV3 cells or Anglne cells transfected with siNC1, siNC2, and siNC3 migrated slightly less than the control group but significantly more than the SKOV3 cells or Anglne cells transfected with siRNA-1, siRNA-2, siRNA-3, and siRNA-4. Furthermore, the number of SKOV3 cells or Anglne cells transfected with siRNA-4 was the lowest. This indicates that the siRNA provided by this invention can inhibit the migration of ovarian cancer cells, especially siRNA-4.

[0096] like Figure 6 As shown, the number of invasive SKOV3 cells or Anglne cells transformed with siRNA-1, siRNA-2, siRNA-3, and siRNA-4 was significantly lower than that of the control group. The number of invasive SKOV3 cells or Anglne cells transformed with siNC1, siNC2, and siNC3 was slightly lower than that of the control group but significantly higher than that of SKOV3 cells or Anglne cells transformed with siRNA-1, siRNA-2, siRNA-3, and siRNA-4. Furthermore, the number of invasive SKOV3 cells or Anglne cells transformed with siRNA-4 was the lowest. This indicates that the siRNA provided by this invention can inhibit the invasion of ovarian cancer cells, especially siRNA-4.

[0097] 6. In vivo experiments

[0098] (1) Experimental animals

[0099] Female Balb / c nude mice (4 weeks old, SPF-grade housing, purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.). This animal experiment was approved by the Ethics Committee of the Affiliated Cancer Hospital of Xinjiang Medical University (Approval No.: K-2024179), and all experiments complied with the requirements of the Declaration of Helsinki. SKOV3 cells (human ovarian cancer cells, CC-Y1473, Shanghai Enzyme Research Biotechnology Co., Ltd.)

[0100] (2) Group Experiment

[0101] Female Balb / c nude mice were housed at room temperature of 20–26°C, humidity of 40%–70%, and under 12h / 12h light / dark conditions. Logarithmic growth phase SKOV3 cells were harvested and the cell density was adjusted to 1×10⁻⁶. 80.1 mL, and were divided into a model group (NC), a control group, and an interference group. The mice in the interference group were injected with 50 μL of 1 x 10 8 The mice in the control group were injected with 50 μL of 1 x 108 TU / mL of siNC1-3 lentivirus containing the above siNC1-3 at an interval of one day, for a total of three injections. The mice in the model group were injected with the same volume of normal saline. The length and width of the tumor were measured every 3 days, and the tumor volume was calculated after 1 month of observation.

[0102] The tumor volume of the mice in the model group on the 10th day was 715.2 mm 3 . In the interference group, the tumor volumes of the mice interfered by siRNA-1-4 lentivirus on the 10th day were 674.3 mm 3 , 519.8 mm 3 , 551.8 mm 3 , and 258.5 mm 3 , respectively. In the control group, the tumor volumes of the mice interfered by siNC1-3 lentivirus on the 10th day were 674.2 mm 3 , 694.3 mm 3 , and 701.3 mm 3 , respectively. This shows that the ovarian cancer model was successfully constructed by implanting SKOV3 cells into the mice. The siRNA-1-4 lentivirus can interfere with the growth of the tumor to some extent, and the siRNA-4 lentivirus has the best infection effect.

[0103] (3) WB detection of tumor tissue of nude mice

[0104] Take 50 mg of tumor tissue, add RIPA lysis buffer, grind with grinder, extract total protein. 4℃ high speed centrifuge (12000r / min) centrifuge for 10min, take supernatant, total protein quantification uses BCA protein quantification kit. Denature the protein sample, (SDS-PAGE) gel electrophoresis for 1.5h. Block PVDF membrane (millipore) with skimmed milk powder, incubate the primary antibody at 4℃ overnight, the next day incubate the PVDF membrane with secondary antibody at room temperature for 2h, immerse the PVDF membrane with luminescence solution, develop using ultra-high sensitivity chemiluminescence imaging system. The antibodies used and the corresponding dilution ratio are as follows: 1:1000 (Rabbit Anti RAD51C, Rabbit Anti VEGF, Rabbit Anti-NRP-2) and 1:1200 (HRP conjugated Goat Anti-Mouse IgG (H+L), HRP conjugated Goat Anti-Mouse IgG (H+L), Mouse Anti-β-Actin).

[0105] Figure 7 WB diagram of tumor tissue of each group of mice, Figure 8 For Figure 7 The protein expression level statistics chart in each group. It can be seen from Figure 7 and Figure 8 that in the interference group, siRNA-1-3 lentivirus does not have inhibitory effect on NRP-2 and RAD51C of tumor cells, and only has inhibitory effect on VEGF, while siRNA-4 lentivirus has inhibitory effect on NRP-2, RAD51C and VEGF of tumor cells. siNC1-3 lentivirus does not have inhibitory effect on NRP-2 and RAD51C of tumor cells, and only has inhibitory effect on VEGF. Therefore, it is proved that the siRNA-4 lentivirus provided by the application has inhibitory effect on NRP-2, RAD51C and VEGF of ovarian cancer cells.

[0106] RAD51C has been proved to be a susceptible gene of ovarian cancer, and its overexpression or mutation can destroy the homologous recombination repair ability, cause genomic instability, and thus cause tumor occurrence. Studies have shown that RAD51C is closely related to various malignant tumors. The level of VEGF in tumor can predictably evaluate the growth, proliferation and development of tumor, and high expression can significantly promote the growth and metastasis of tumor. By inhibiting the generation of VEGF or blocking its receptor, the growth and metastasis of tumor can be effectively inhibited. NRP-2 is a lymphatic endothelial cell receptor, which is widely expressed in tumor tissue, and can promote lymphatic metastasis of tumor cells by combining with lymphatic endothelial cell growth factor.

[0107] RAD51C, VEGF and NRP-2 all play a key role in regulating tumor cell proliferation, migration and apoptosis, are associated with tumor infiltration, invasion and metastasis, and are potential targets for targeted therapy of malignant tumors.

[0108] Therefore, the siRNA and related lentiviral vector and lentivirus provided by the application can interfere with the expression of RAD51C, VEGF and NRP-2 genes in ovarian cancer tissues, inhibit genomic instability in tumor tissues, inhibit angiogenesis, and inhibit lymphatic metastasis of tumor cells, thereby inhibiting the growth, metastasis and invasion of ovarian cancer cells.

[0109] The above is only a preferred specific embodiment of the application, but the protection scope of the application is not limited to this, any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the application, which should be covered within the protection scope of the application.

Claims

1. An RPS4X inhibitor characterized in that, The at least one of an siRNA targeting an RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA is an siRNA as set forth in SEQ ID NOs: 7 and 8.

2. An inhibitor of the LAMB3-PI3K-AKT signaling pathway, characterized in that, The at least one of an siRNA targeting an RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA is an siRNA as set forth in SEQ ID NOs: 7 and 8.

3. An ovarian cancer medicament, which comprises as an active ingredient at least one of an siRNA targeting an RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA, the siRNA targeting the RPS4X gene being an siRNA as set forth in SEQ ID NOs: 7 and 8.

4. The ovarian cancer medicament according to claim 3, characterized by, The recombinant lentivirus vector comprising the siRNA is a GV493 plasmid carrying a nucleotide sequence of the siRNA as set forth in SEQ ID NOs: 7 and 8.

5. Use of at least one of an siRNA targeting an RPS4X gene, a recombinant lentivirus comprising the siRNA, and a recombinant lentivirus vector comprising the siRNA in the preparation of an ovarian cancer medicament, the siRNA targeting the RPS4X gene being an siRNA as set forth in SEQ ID NOs: 7 and 8.

Images