Ewing sarcoma detection primer set, kit and application thereof

By designing primer sets A and B using multiplex fluorescent PCR and high-resolution capillary electrophoresis platforms, the problem of efficient and rapid detection of gene fusion variants in Ewing sarcoma was solved, achieving high sensitivity and high consistency detection of 24 gene fusion variant types in Ewing sarcoma.

CN120290729BActive Publication Date: 2025-11-25BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510576205.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-11-25
Estimated Expiration
2045-05-06

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and sensitively identifying characteristic gene fusion variants in Ewing sarcoma, especially for detecting multiple gene fusion types. Furthermore, existing methods such as fluorescence in situ hybridization and next-generation sequencing suffer from high costs, high complexity, and long detection cycles.

Method used

A multiplex fluorescent PCR method was designed to combine with a high-resolution capillary electrophoresis platform. Specific primer sets A and B were used to detect seven gene fusions in Ewing sarcoma, including 24 variant types. Rapid identification was achieved through fluorescence signal and electrophoretic analysis.

Benefits of technology

It achieves efficient and rapid detection of 24 gene fusion variants in Ewing sarcoma, with a detection limit as low as 10 copies and a detection time as short as 240 minutes. The results are 100% consistent with Sanger sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290729B_ABST
    Figure CN120290729B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological detection, and particularly relates to a Ewing sarcoma detection primer group, a kit and application thereof. The Ewing sarcoma detection primer group comprises primer group A and primer group B, and a total of 17 primer sequences. The primer group is designed, Ewing sarcoma characteristic variant genes are detected through multiplex fluorescence PCR and a high-resolution capillary electrophoresis instrument, 24 variation types of 7 kinds of gene fusions can be detected at one time, the minimum detection limit is 10 copies, and the shortest detection time is 240 minutes. The detection result of the primer group can be verified through Sanger sequencing, and is consistent with morphological diagnosis results, the methodological consistency reaches 100%, and a sensitive and efficient Ewing sarcoma genetic variation detection method is provided.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological detection, and particularly relates to a Ewing sarcoma detection primer group, a kit and application thereof. BACKGROUND

[0002] Ewing sarcoma is a malignant tumor that often occurs in children and adolescents, accounting for 10-15% of all osteosarcomas, including Ewing sarcoma family tumors, peripheral primitive neuroectodermal tumors, peripheral neuroepithelioma and chest wall small cell tumors. These sarcomas have similarities in histology and immunohistochemical features and are considered to originate from unique mesenchymal stem cells. Ewing sarcoma has a characteristic chromosomal translocation, forming a fusion gene encoding an abnormal transcription factor. 85% of tumors have t(11;22)(q24;q12) translocation, resulting in EWSR1::FLI1, EWSR1::ETV1, EWSR1::ETV4, EWSR1::FEV, FUS::ERG, FUS::FEV and the like.

[0003] Ewing sarcoma can occur in almost any bone or soft tissue, and the affected site is usually accompanied by pain and swelling, and the clinical manifestations lack specificity. Pathology is the gold standard for diagnosis. However, the histomorphological features and immunohistochemical expressions of Ewing sarcoma overlap with other small round blue cell tumors, including lymphoma, small cell osteosarcoma, mesenchymal chondrosarcoma, undifferentiated neuroblastoma, poorly differentiated synovial sarcoma, fibroblastic small round cell tumor, rhabdomyosarcoma, and sarcoma with CIC-DUX4 or BCOR gene changes. It is difficult to rely solely on histomorphology and immunohistochemical expression for differential diagnosis, and a sensitive and efficient genetic variation detection method is urgently needed.

[0004] The main methods for clinically detecting such genetic variations are fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR), and next-generation sequencing. Fluorescence in situ hybridization is suitable for detecting single fusion genes, but not for multiple variation screening. Next-generation sequencing based on RNA / DNA is costly, complex, and has a long detection period, making it difficult to be clinically applied. PCR is a method that amplifies specific nucleotide sequences using targeted primers, and detects specific genes using fluorescence signals or gel electrophoresis. It has the advantages of simplicity, high sensitivity, and good specificity, and has been widely used in the fields of tumor markers, molecular typing, and individualized treatment. SUMMARY

[0005] To solve the above technical problems, the application provides a multiplex fluorescence PCR method for developing an auxiliary diagnostic product for Ewing sarcoma, and uses a high-resolution capillary electrophoresis platform for qualitative analysis of target products.

[0006] The purpose of the application is to provide a Ewing sarcoma detection primer group.

[0007] Still another object of the present application is to provide a kit containing the above primer set.

[0008] Still another object of the present application is to provide use of the above kit.

[0009] The Ewing sarcoma detection primer set according to the embodiment of the present application includes at least one of primer set A and primer set B, wherein,

[0010] Primer set A includes upstream primers SEQ ID NO. 1-2 and downstream primers SEQ ID NO. 3-11,

[0011] SEQ ID NO. 1: 5'- CCAAGTCAATATAGCCAACAG -3';

[0012] SEQ ID NO. 2: 5'- GCGAGGTGGCTTCAATAAG -3';

[0013] SEQ ID NO. 3: 5'- TACACAGTTCCTTGCCATC -3';

[0014] SEQ ID NO. 4: 5'- GCCGTTGCTCTGTATTCT -3';

[0015] SEQ ID NO. 5: 5'- CAGGAGGAATTGCCACAG -3';

[0016] SEQ ID NO. 6: 5'- TGGTCCAAGAATCTGATAAGG -3';

[0017] SEQ ID NO. 7: 5'- GTTTGCTCTTCCGCTCTC -3';

[0018] SEQ ID NO. 8: 5'- CGACCAGTCCAGGCAATA -3';

[0019] SEQ ID NO. 9: 5'- GGACAACGCAGACATCAT -3';

[0020] SEQ ID NO. 10: 5'- TGAGCTTGAACTCCATTCC -3';

[0021] SEQ ID NO. 11: 5'- GTCCGTGAGCTTGAACTC -3';

[0022] Primer set B: including upstream primers SEQ ID NO. 12-14 and downstream primers SEQ ID NO. 15-17,

[0023] SEQ ID NO. 12: 5'-TACAACAGCAGCAGTGGT-3';

[0024] SEQ ID NO. 13: 5'-ACCGTGGTGGCTTCAATA-3';

[0025] SEQ ID NO. 14: 5'-TTTGATGACCCACCTTCAG-3';

[0026] SEQ ID NO. 15: 5'-ACTGTGGAAGGAGATGGT-3';

[0027] SEQ ID NO. 16: 5'-ATCCGTCATCTTGAACTCC-3';

[0028] SEQ ID NO. 17: 5'-GTCCGTGAGCTTGAACTC-3'.

[0029] Among them, primer set A can detect 16 variation types of 5 kinds of gene fusions:

[0030] EWSR1::FLI1 gene fusion (including 7 types: Exon10::Exon5, Exon10::Exon6, Exon10::Exon8, Exon7::Exon4, Exon7::Exon5, Exon7::Exon6, Exon7::Exon7);

[0031] EWSR1::ERG gene fusion (including 5 types: Exon10::Exon9, Exon7::Exon9, Exon7::Exon10, Exon7::Exon11, Exon7::Exon12);

[0032] EWSR1::ETV1 gene fusion (including 1 type: Exon7::Exon11);

[0033] EWSR1::ETV4 gene fusion (including 2 types: Exon7::Exon9, Exon7::Exon11);

[0034] EWSR1::FEV gene fusion (including 1 type: Exon7::Exon2).

[0035] The primer set B can detect 8 variation types of the class 2 gene fusion:

[0036] FUS::ERG gene fusion (including 5 types: Exon5::Exon8, Exon5::Exon9, Exon7::Exon7, Exon7::Exon11, Exon7::Exon12);

[0037] FUS::FEV gene fusion (including 3 types: Exon5::Exon2, Exon7::Exon2, Exon10::Exon2).

[0038] Therefore, the primer set A and B can detect 24 variation types of the above-mentioned 7 classes of gene fusion in one time.

[0039] Preferably, the Ewing sarcoma detection primer set of the present application comprises the primer set A and the primer set B.

[0040] According to the Ewing sarcoma detection primer set of the embodiment of the present application, the downstream primer is further labeled with a fluorescent group.

[0041] Preferably, the fluorescent group is selected from FAM, VIC, TAMRA or ROX.

[0042] Preferably, the present application provides the following combinations of fluorescent groups and downstream primers:

[0043] Downstream primer 3: 5'-TACACAGTTCCTTGCCATC-FAM-3';

[0044] Downstream primer 4: 5'-GCCGTTGCTCTGTATTCT-FAM-3';

[0045] Downstream primer 5: 5'-CAGGAGGAATTGCCACAG-FAM-3';

[0046] Downstream primer 6: 5'-TGGTCCAAGAATCTGATAAGG-VIC-3';

[0047] Downstream primer 7: 5'-GTTTGCTCTTCCGCTCTC-VIC-3';

[0048] Downstream primer 8: 5'-CGACCAGTCCAGGCAATA-TAMRA-3';

[0049] Downstream primer 9: 5'-GGACAACGCAGACATCAT-TAMRA-3';

[0050] Downstream primer 10: 5'-TGAGCTTGAACTCCATTCC-TAMRA-3';

[0051] Downstream primer 11: 5'-GTCCGTGAGCTTGAACTC-TAMRA-3';

[0052] Downstream primer 15: 5'-ACTGTGGAAGGAGATGGT-VIC-3';

[0053] Downstream primer 16: 5'-ATCCGTCATCTTGAACTCC-VIC-3';

[0054] Downstream primer 17: 5'-GTCCGTGAGCTTGAACTC-TAMRA-3'.

[0055] The Ewing sarcoma detection kit according to the embodiment of the present application comprises the Ewing sarcoma detection primer set described above.

[0056] The Ewing sarcoma detection kit according to the embodiment of the present application further comprises a positive control, a negative control, a PCR reaction buffer, a nucleic acid template and ddH2O.

[0057] Preferably, the negative control is pure water.

[0058] Preferably, the positive control is a plasmid comprising a fusion gene, and the sequence of the fusion gene is SEQ ID NO. 20 or SEQ ID NO. 21.

[0059] The gene sequence of EWSR1::FLI1 (Exon7::Exon6) fusion is SEQ ID NO. 20:

[0060] 5'-ctattcctctacacagccgactagttatgatcagagcagttactctcagcagaacacctatgggcaaccgagcagctatggacagcagagtagctatggtcaacaaagcagctatgggcagcagcctcccactagttacccaccccaaactggatcctacagccaagctccaagtcaatatagccaacagagcagcagctacgggcagcagaacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaa-3'.

[0061] The gene sequence of FUS::ERG (Exon7::Exon12) fusion is SEQ ID NO. 21:

[0062] 5'-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggcttcaataaatttggtggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgacttccacgggatcgcccaggccc-3'.

[0063] According to the Ewing sarcoma detection kit of the embodiment of the present application, the kit further comprises primers of the internal reference gene HPRT1.

[0064] Preferably, the primer sequence of the internal reference gene HPRT1 is as follows:

[0065] SEQ ID NO. 18: 5'-CCCTGGCGTCGTGATTAGTG-3';

[0066] SEQ ID NO. 19: 5'-GAGCACACAGAGGGCTACAA-3'.

[0067] The beneficial effects of the present application are as follows:

[0068] The present application designs a primer set, which can detect 24 types of variation of 7 types of gene fusions by multiplex fluorescence PCR and high-resolution capillary combined application of detection of Ewing sarcoma characteristic variant genes, the minimum detection limit is 10 copies, and the shortest detection time is 240 minutes.

[0069] The primer set of this invention was used to test 16 formalin-fixed paraffin-embedded tumor samples. The detection results were verified by Sanger sequencing and were completely consistent with the morphological diagnostic results, with a methodological consistency of 100%. Attached Figure Description

[0070] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0071] Figure 1 The results showed that the EWSR1::FLI1 fusion gene had good detection performance in the range of 10-1000 copies, with the lowest detection limit being 10 copies.

[0072] Figure 2 The kit shows that sample E6 has EWSR1::ERG fusion (A), and the Sanger sequencing results are verified (B).

[0073] Figure 3 The kit shows that sample E7 has EWSR1::FLI1 fusion (A), and the Sanger sequencing results are verified (B).

[0074] Figure 4 The kit shows that sample E12 has EWSR1::FEV fusion (A), and the Sanger sequencing results are verified (B). Detailed Implementation

[0075] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0076] Example 1: The detection kit of the present invention

[0077] This invention compiles data on fusion genes from 391 cases of Ewing sarcoma reported in the literature and tested in local laboratories, uses a unified reference gene transcript, and summarizes 24 variant combinations of 7 common gene fusions (EWSR1::FLI1, EWSR1::ERG, EWSR1::ETV1, EWSR1::ETV4, EWSR1::FEV, FUS::ERG, and FUS::FEV) in Ewing sarcoma (see Table 1).

[0078] According to the above-mentioned variation types, they are grouped into an EWSR1-related fusion gene group and a FUS-related fusion gene group, and primer group A and primer group B are set, wherein primer group A is used for detecting EWSR1-related fusion genes, and primer group B is used for detecting FUS-related fusion genes. Further, specific upstream and downstream primers of each primer group are designed and combined and tested, and the primer group needs to meet the following requirements:

[0079] ①In each primer group, the primer sequence can amplify all target fragments in the group; ②The total number of primers is as small as possible to reduce unnecessary cross-reaction; ③The difference between each primer and the amplified product is greater than or equal to 2 bp to meet the resolution requirement of high-resolution capillary electrophoresis instrument; ④Each amplified fragment needs to be greater than 100 bp to avoid primer dimer interference, and as small as possible to be less than or equal to 250 bp to adapt to the most common clinical paraffin tumor specimen highly degraded nucleic acid; ⑤Each tube primer combination has no non-specific amplification with genomic DNA.

[0080] According to the above-mentioned principles, the present application designs and optimizes a plurality of groups of Ewing sarcoma primer combinations, and finally the multiple primer combinations of Ewing sarcoma characteristic variation fusion genes combined with specific fluorescent groups can detect 24 types of gene fusions of 7 types of genes (see Table 1) at one time, primer group A detects EWSR1::FLI1, EWSR1::ERG, EWSR1::ETV1, EWSR1::ETV4 and EWSR1::FEV fusion; primer group B detects FUS::ERG and FUS::FEV; primer group C detects the expression of the internal reference gene HPRT1 for quality control of nucleic acid quality.

[0081]

[0082] In combination with the above-mentioned primer groups, the present application provides a specific PCR detection system, as shown in Table 2,

[0083] Table 2 Each tube reaction system (26 μL is taken as an example)

[0084]

[0085] Note: The 2x PCR reaction buffer contains Taq enzyme, Mg 2+ , PCR buffer, dNTPs, etc.

[0086] The primer groups A, B and C are respectively arranged in different tubes, the primer group A is arranged in the A tube, the primer group B is arranged in the B tube, and the primer group C is arranged in the C tube.

[0087] The kit also includes a positive control tube and a negative control tube, the negative control being pure water and the positive control being a fusion gene plasmid (1000 copies / μΐ). The gene mutation corresponding to each tube positive control and its nucleotide sequence are shown below:

[0088] Tube A contains EWSR1 ::FLI1 (Exon7::Exon6) fusion gene:

[0089] 5'-ctattcctctacacagccgactagttatgatcagagcagttactctcagcagaacacctatgggcaaccgagcagctatggacagcagagtagctatggtcaacaaagcagctatgggcagcagcctcccactagttacccaccccaaactggatcctacagccaagctccaagtcaatatagccaacagagcagcagctacgggcagcagaacccttcttatgactcagtcagaagaggagcttggggcaataacatgaattctggcctcaacaaaagtcctccccttggaggggcacaaacgatcagtaagaatacagagcaacggccccagccagatccgtatcagatcctgggcccgaccagcagtcgcctagccaaccctggaagcgggcagatccagctgtggcaattcctcctggagctgctctccgacagcgccaacgccagctgtatcacctgggaggggaccaacggggagttcaaaatgacggaccccgatgaggtggccaggcgctggggcgagcggaaaagcaagcccaacatgaattacgacaagctgagccgggccctccgttattactatgataaaa-3'.

[0090] Tube B contains FUS::ERG (Exon7::Exon12) fusion gene:

[0091] 5'-gtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggaggtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggcggtggtggttacaaccgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggcttcaataaatttggtggcagtggccagatccagctttggcagttcctcctggagctcctgtcggacagctccaactccagctgcatcacctgggaaggcaccaacggggagttcaagatgacggatcccgacgaggtggcccggcgctggggagagcggaagagcaaacccaacatgaactacgataagctcagccgcgccctccgttactactatgacaagaacatcatgaccaaggtccatgggaagcgctacgcctacaagttcgacttccacgggatcgcccaggccc-3'.

[0092] The PCR amplification procedure used is shown in Table 3 below:

[0093] Table 3 Amplification procedure

[0094]

[0095] Take 1 μL of the resulting PCR amplification product, add 10 μL of HiDi and 0.5 μL of Liz600 internal standard, mix well, and then perform electrophoresis on a high-resolution capillary electrophoresis instrument (ABI 3500), and analyze using Gene Mapper software. According to the product peak fluorescence color and molecular weight size, the fusion gene type is determined, which in turn helps to determine whether it is Ewing's sarcoma.

[0096] Table 4 Result interpretation criteria

[0097]

[0098] The result judging standard is shown in Table 4. First, see whether the C tube has a 190 bp ROX amplification peak. If not, it is judged that the nucleic acid quality control fails, and the nucleic acid needs to be extracted again for experiment. If yes, the nucleic acid quality control is passed.

[0099] Second, see whether the A tube or the B tube has an amplification peak of corresponding fluorescence color and size:

[0100] The FAM fluorescent 240 / 173 / 138 / 160 / 225 / 158 / 184 bp product peaks of the A tube correspond to T1 / T2 / T3 / T4 / T5 / T6 / T7 type EWSR1::FLI1 fusion, the VIC fluorescent 206 / 191 / 121 / 241 / 194 bp product peaks correspond to T8 / T9 / T10 / T11 / T12 type EWSR1::ERG fusion, and the TAMRA fluorescent 180 / 171 / 200 / 226 bp product peaks correspond to T13 / T14 / T15 / T16 type EWSR1::ETV1, EWSR1::ETV4 or EWSR1::FEV fusion;

[0101] The VIC fluorescent 207 / 135 / 273 / 182 / 134 bp product peaks of the B tube correspond to T17 / T18 / T19 / T20 / T21 type FUS::ERG fusion, and the TAMRA fluorescent 225 / 209 / 228 bp product peaks correspond to T22 / T23 / T24 type FUS::FEV fusion.

[0102] If the A and B tubes do not have the above product peaks, it is judged as negative, and no related gene fusion is detected.

[0103] Example 2

[0104] The kit provided in Example 1 is subjected to performance detection. Taking EWSR1::FLI1 (Exon7::Exon6) as an example, a plasmid inserted with the corresponding fragment is used as a fusion gene detection standard, and is prepared into a standard solution (1, 10, 100, 1000 copies / μl) of corresponding concentration to serve as an amplification template. The kit and its detection procedure of Example 1 are used.

[0105] The detection result is shown in Table 5. Figure 1 The EWSR1::FLI1 fusion gene has good detection effect in the range of 10-1000 copies, and the minimum detection limit is 10 copies. The detection range and minimum detection limit of other types of fusion genes meet the requirements.

[0106] Example 3

[0107] Using 16 cases of real formalin-fixed paraffin-embedded tumor samples (8 cases of Ewing sarcoma, 8 cases of Ewing-like sarcoma including 4 cases of CIC rearrangement sarcoma and 4 cases of BCOR genetic abnormality sarcoma), 5 μm paraffin sections were cut from each sample, and the sample nucleic acid was extracted and reverse transcribed into cDNA, and the detection was performed using the method described in Example 1, and the detection performance of the test kit was tested.

[0108] All samples passed nucleic acid quality control, and a total of 6 cases of EWSR1::FLI1 fusion, 1 case of EWSR1::ERG fusion and 1 case of EWSR1::FEV fusion were detected. The PCR amplification product of the positive sample was subjected to agarose gel electrophoresis and gel purification, and the corresponding upstream and downstream primers were used to directly make sequencing primers, and the ABI 3500 gene analyzer was used for Sanger sequencing. The product sequence was compared with the human genome, and the type and breakpoint of the fusion gene were determined.

[0109] The Sanger sequencing results were completely consistent with the detection results of the kit, as shown in Table 2. Figures 2-4

[0110] The histological types of the samples were analyzed, and the histological diagnoses of all 8 cases of fusion gene detection were consistent with Ewing sarcoma (see Table 5), and the detection results of CIC rearrangement sarcoma and BCOR genetic abnormality sarcoma were negative. In summary, the kit detection results of 16 tumor patient samples were consistent with the morphological diagnosis results, and the method consistency reached 100%.

[0111]

[0112] The above is only a specific embodiment of the present application, but the protection scope of the present application is not limited thereto, and any skilled person in the art can easily think of changes or replacements within the technical scope disclosed by the present application, which should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.​

Claims

1. A detection kit for Ewing sarcoma, characterized in that, The kit includes a primer set for Ewing sarcoma detection, comprising primer set A and primer set B, wherein... Primer set A: upstream primers SEQ ID NO.1-2 and downstream primers SEQ ID NO.3-11. SEQ ID NO.1: 5'-CCAAGTCAATATAGCCAACAG-3'; SEQ ID NO.2: 5'-GCGAGGTGGCTTCAATAAG-3'; SEQ ID NO.3: 5'- TACACAGTCCTTGCCATC -3'; SEQ ID NO.4: 5'- GCCGTTGCTCTGTATTCT -3'; SEQ ID NO.5: 5'-CAGGAGGAATTGCCACAG-3'; SEQ ID NO.6: 5'-TGGTCCAAGAATCTGATAAGG-3'; SEQ ID NO.7: 5'-GTTTGCTCTTCCGCTCTC -3'; SEQ ID NO.8: 5'-CGACCAGTCCAGGCAATA-3'; SEQ ID NO.9: 5'-GGACAACGCAGACATCAT-3'; SEQ ID NO.10: 5'- TGAGCTTGAACTCCATTCC -3'; SEQ ID NO.11: 5'-GTCCGTGAGCTTGAACTC-3'; Primer set B: upstream primers SEQ ID NO.12-14 and downstream primers SEQ ID NO.15-17. SEQ ID NO.12: 5'- TACAACAGCAGCAGTGGT -3'; SEQ ID NO.13: 5'-ACCGTGGTGGCTTCAATA-3'; SEQ ID NO.14: 5'-TTTGATGACCCACCTTCAG-3'; SEQ ID NO.15: 5'- ACTGTGGAAGGAGATGGT - 3'; SEQ ID NO.16: 5'- ATCCGTCATCTTGAACTCC - 3'; SEQ ID NO.17: 5'-GTCCGTGAGCTTGAACTC-3', The downstream primer is also labeled with a fluorescent group. The fluorescent group is selected from FAM, VIC, TAMRA or ROX.

2. The detection kit for Ewing's sarcoma according to claim 1, characterized in that, The kit also includes a positive control, a negative control, a PCR reaction buffer, a nucleic acid template, and ddH2O.

3. The detection kit for Ewing's sarcoma according to claim 2, characterized in that, The negative control was pure water.

4. The detection kit for Ewing's sarcoma according to claim 2, characterized in that, The positive control is a plasmid containing the fusion gene, the sequence of which is SEQ ID NO.20 or SEQ ID NO.

21.

5. The detection kit for Ewing's sarcoma according to claim 1, characterized in that, The kit also includes primers for the internal reference gene HPRT1.

6. The detection kit for Ewing sarcoma according to claim 5, characterized in that, The primer sequences for the internal reference gene HPRT1 are as follows: SEQ ID NO.18:5'-CCCTGGCGTCGTGATTAGTG-3'; SEQ ID NO. 19: 5'-GAGCACACAGAGGGCTACAA-3'.

Citation Information

Patent Citations

  • Sarcoma fusion gene and / or mutation joint detection primer group and kit

    CN112094915A

  • Composition for simultaneously detecting multiple gene fusion of sarcoma and application of composition

    CN117904294A

  • Primer group and kit for detecting EWSR1 non-ETS fused round cell sarcoma and application of primer group and kit

    CN120249492A