SNP (Single Nucleotide Polymorphism) molecular marker related to milk fat percentage of dairy cow, detection product and application
By identifying the SNP molecular marker at the chr5:92772499 locus in the cow genome, the identification and selection of cows with high cream fat rate was achieved, and the shortcomings of the improvement of milk fat traits in the prior art were solved, and the milk fat rate and economic benefits were improved.
Patent Information
- Application Number
- CN202510747863.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-06
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-06-06
AI Technical Summary
In the prior art, the research results of SNP labeling related to milk fat rate of dairy cows are limited, and effective molecular markers are lacking for precise improvement of milk fat traits.
A SNP molecular marker related to milk fat rate of dairy cow is provided, located in genome chr5:92772499, with a polymorphism of T or C. It is amplified by PCR and sequenced to identify high-cream fat rate cows, designed specific primers for detection, and applied to cow assisted breeding.
The selection frequency of cows with high cream fat rate is improved, the population cream fat rate is improved, and economic benefits are increased, providing a basis for the genetic breeding improvement of high-yield dairy cows.
Smart Images

Figure CN120290749A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of molecular biology and genetic breeding, and particularly relates to an SNP molecular marker related to milk fat percentage in dairy cows, a detection product, and an application thereof. Background Art
[0002] Milk fat is the main carrier of fat-soluble vitamins (such as vitamins A and D) and essential fatty acids (such as conjugated linoleic acid) in milk. The higher the milk fat percentage, the richer the content of such nutrients usually is. The milk fat percentage also directly affects the viscosity and smoothness of milk. Milk with a high milk fat percentage has a more mellow taste and a strong milk fragrance, while milk with a low milk fat percentage has a relatively thin texture. Screening SNP markers related to milk fat percentage for regional cattle herds to provide tools for molecular assisted breeding can effectively promote the directional improvement of milk fat percentage.
[0003] Regarding GPAM Research on genes has found that three SNP loci (I18-652A>G, I18-726A>G, etc.) detected in the Chinese Holstein cattle population are significantly correlated with traits such as milk fat percentage and milk protein percentage. Further functional verification shows that this gene directly affects the triglyceride content in mammary gland cells by regulating the expression level of the AGPAT4 gene in the fat metabolism signaling pathway (Zhao Yaolu, Correlation Analysis and Functional Verification of Genetic Polymorphism of the gpam Gene and Milk Fat Traits in Dairy Cows, Master's Thesis of Jilin University, June 2017). Analysis of the Chinese Holstein cattle population shows that SNP loci are not only related to mastitis resistance but also can affect milk production traits such as milk fat percentage and milk protein percentage through the synergistic action of multiple genes (Lv Xiaoqing et al., Association Analysis of 3 SNP Loci in Chinese Holstein Cows with Mastitis and Milk Production Traits, China Dairy Cattle, February 2024: 11-15).
[0004] Previous studies have shown that SNP markers have important application potential in the genetic improvement of milk fat traits in dairy cows, but the research results are limited, and there are not many selectable SNP loci. It is still necessary to further explore and screen more SNP related to milk fat percentage to achieve precise improvement of milk fat traits. Summary of the Invention
[0005] The purpose of the present invention is to provide an SNP molecular marker related to milk fat percentage in dairy cows, a detection product, and an application thereof, so as to build a solid foundation for cultivating high-yield dairy cows.
[0006] The technical solution of the present invention is described in detail as follows: In the first aspect, the present invention provides an SNP molecular marker related to milk fat percentage in dairy cows. The SNP molecular marker is located at chr5:92772499 in the dairy cow genome, and the polymorphism is T or C. The coordinate position of the SNP molecular marker is based on the bovine reference genome ARS-UCD2.0.
[0007] Optionally, the above SNP molecular marker is the 47th nucleotide of SEQ ID NO:1 in the sequence listing, and the polymorphism is T or C.
[0008] In a second aspect, the present invention provides the application of the above SNP molecular marker in identifying high milk fat percentage cows. When the polymorphism of the SNP molecular marker is T, the milk produced by the cows has the trait of high milk fat percentage.
[0009] Optionally or preferably, in the above application, the method for identifying high milk fat percentage cows includes the following steps: (1) Extract the genomic DNA of the cow to be identified; (2) Using the genomic DNA obtained in step (1) as a template, and using the nucleotide sequences shown in SEQ ID NO:2-3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker. The amplification product is 113 bp, and the 47th position is the SNP molecular marker; (3) Sequence the amplification product. The genotype combinations of the SNP molecular marker from high to low milk fat percentage are TT, TC, and CC in turn.
[0010] In a third aspect, the present invention provides the application of the above molecular marker in the assisted breeding of cows. When the polymorphism of the SNP molecular marker is T, the milk produced by the cows has the trait of high milk fat percentage.
[0011] In a fourth aspect, the present invention provides a product for detecting the above SNP molecular marker. The product is a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are as shown in SEQ ID NO:2-3.
[0012] In a fifth aspect, the present invention provides a product for detecting the above SNP molecular marker. The product is a detection kit, and the detection kit includes a primer pair for detecting the genotype or polymorphism of the SNP molecular marker, and the nucleotide sequences are as shown in SEQ ID NO:2-3.
[0013] In a sixth aspect, the present invention provides the application of the above detection product in identifying high milk fat percentage cows. When the polymorphism of the SNP molecular marker is T, the milk produced by the cows has the trait of high milk fat percentage.
[0014] In a seventh aspect, the present invention provides the application of the above detection product in the assisted breeding of cows. When the polymorphism of the SNP molecular marker is T, the milk produced by the cows has the trait of high milk fat percentage.
[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an SNP molecular marker related to milk fat percentage in dairy cows, which is located at chr5:92772499 of the dairy cow genome, with polymorphisms of T or C. After analysis and verification, its dominant allele is T. Through this SNP molecular marker, breeding managers can select and retain the dominant genotype through molecular biology-related technologies, increase the frequency of the high-yield dominant SNP containing this molecular marker in the dairy cow population, thereby increasing the milk fat percentage of the population and increasing economic benefits. It can also be used for genetic breeding improvement of high-yield dairy cows. Description of the Drawings
[0016] Figure 1 It is the polymorphism sequencing peak map of the chr5:92772499 (T>C) locus. Detailed Embodiments
[0017] In order to enable those skilled in the art to better understand the solutions of this application, the following will describe this application clearly and completely in conjunction with the embodiments and the drawings. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all from commercial channels unless otherwise specified.
[0018] Example 1 1. DNA sample collection and gene data analysis (1) Collect blood or hair follicle samples of 1915 Holstein cows in 6 large-scale farms Collect Holstein cattle samples in 6 pastures across the country. The locations of the pastures and the number of samples collected from each pasture are shown in Table 1.
[0019] Table 1 Locations of pastures where samples are collected and the number of samples collected (2) Use the Illumina BovineSNP50 chip to determine the genotypes of the collected samples. The determination of genotypes was performed by Neogene Biotechnology (Shanghai) Co., Ltd., and a total of 47,843 SNP marker loci genotypes were obtained.
[0020] (3) Estimate the genomic estimated breeding value of milk fat percentage for each individual according to the genotype. The genomic estimated breeding value is provided by the Council on Dairy Cattle Breeding (CDCB) in the United States.
[0021] Genomic Estimated Breeding Value (GEBV) is a genetic potential prediction index calculated by the Council on Dairy Cattle Breeding (CDCB) in the United States by integrating genomic data, production performance records, and multi-dimensional genetic evaluation models.
[0022] (4) Using the GEMMA software, a genome-wide association analysis was performed on the genomic breeding value of milk fat percentage based on genotype data. The analysis model used a mixed linear model, with the farm and the age of the cattle in months as covariates. The FDR method was used for multiple test correction. The results of the association analysis showed the most significant 1 SNP locus (chr5:92772499T>C)), and the significant P value after FDR correction was 0.0015.
[0023] 2. Identification of the dominant allele Among the 1915 Holstein cattle collected, the present invention compared the genomic estimated breeding values of milk fat percentage for different genotypes of the SNP locus chr5:92772499 (T>C), and the results are shown in Table 2.
[0024] Table 2 Genomic estimated breeding values of milk fat percentage for cows with different genotypes of chr5:92772499 (T>C) For chr5:92772499 (T>C), the genomic estimated breeding values of milk fat percentage were C / C: 0.024, C / T: 0.049, and T / T: 0.06 respectively. Since the larger the genomic estimated breeding value of milk fat percentage indicates the higher the milk fat percentage, the dominant allele at the chr5:92772499 (T>C) locus is T.
[0025] 3. Sequence amplification (1) Collection of bovine tail vein blood Holstein cattle were selected as the experimental materials, and the tail vein blood of the cattle was collected.
[0026] (2) Genomic DNA extraction Take 500 μL of whole blood, add 500 μL of STE lysis buffer, and sequentially add 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / ml). Incubate at 56 °C for about 3 h until the lysate becomes clear. Add an equal volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1) (250 μL), gently shake for 20 min, and centrifuge at 12,000 rpm for 10 min. Take the supernatant and repeat the above steps until there is no protein layer between the aqueous and organic phases. Take the supernatant, add an equal volume of chloroform / isoamyl alcohol, gently shake for 20 min, and centrifuge at 12,000 rpm for 10 min. Take the supernatant, add 1 / 10 volume of 3 M NaAc (pH 5.2) and 2 volumes of cold absolute ethanol, shake well, let stand at -20 °C for 20 min, and centrifuge at 12,500 rpm for 20 min. Precipitate the nucleic acid at the bottom of the tube. Discard the supernatant, wash the precipitate with 70% ethanol. Collect the precipitate and air-dry it until all the ethanol has evaporated. Add 20 μL of TE (containing RNase A) to dissolve the DNA, let stand at 37 °C for about 30 min, and then store at 4 °C. Detect the DNA sample by 1% agarose gel electrophoresis and detect the concentration and purity by ultraviolet spectrophotometer.
[0027] (3)Primer Design Design a pair of specific primers according to the target gene sequence where the SNP site is located. Among them, Forward primer F is: 5’- TGGTTTGTCTTTTGACCCAGTT-3’ (SEQ ID NO:2), Reverse primer R is: 5’-CCAAAGTGACAGCACAGAGGG-3’ (SEQ ID NO:3).
[0028] (4)Polymerase Chain Reaction Perform PCR amplification with the above primers. The reaction system is as follows: 1 μL of 10× Buffer, 0.8 μL of dNTP with a concentration of 2.5 mM, 0.6 μL of MgCl2 with a concentration of 2.5 mM, 0.1 μL of forward primer F (10 μM), 0.5 μL of reverse primer R (10 μM), 0.1 μL of Taq enzyme (5 U / μL), 0.5 μL of template, 0.7 μL of LC Green saturated fluorescent dye, and add H2O to make up to 10 μL.
[0029] The amplification reaction is completed on an Applied Biosystem PCR system. The reaction conditions are as follows: 95 °C for 5 min; 95 °C for 30 s, 59 °C for 30 s, 72 °C for 1 min; 35 cycles; 72 °C for 5 min. Determine the genotype of the PCR product by Sanger sequencing.
[0030] The amplified product is 113 bp, and the specific nucleotide sequence is as follows: 5’-TGGTTTGTCTTTTGACCCAGTTTAAAGCTAATGGATTTGTGTTCGC T ACTTTTATATCCTCAGATATCTTCCCTGAATCATGTGATTTTTTCCCCTCTGTGCTGTCACTTTGG-3’ (SEQ ID NO:1), where the 47th position (underlined) is the SNP locus, and the polymorphism is T or C. The sequencing peak map of the polymorphism at the chr5:92772499 (T>C) locus is shown in Figure 1 .
[0031] Select individuals from the core dairy cattle population, use the above-mentioned molecular biology-related technologies to detect the genotypes at the chr5:92772499 (T>C) locus, select favorable individuals for breeding, which can improve the milk fat percentage trait of the dairy cattle population, improve breeding efficiency, reduce breeding costs, increase breeding income, and lay a foundation for cultivating excellent new dairy cattle strains with high milk fat percentage.
[0032] Example 2 To verify the relationship between the chr5:92772499 (T>C) locus and the milk fat percentage of Holstein cattle, the genotypes at the chr5:92772499 (T>C) locus in a total of 195 Holstein dairy cows in a Holstein cattle population were identified by Sanger sequencing method, and the milk fat percentages of individuals with different genotypes were compared. The results are shown in Table 3.
[0033] Table 3 Average milk fat percentages of individuals with different genotypes at the chr5:92772499 (T>C) locus in the verification population The detection results show that there are 3 genotypes in the detected Holstein dairy cattle population; in all detected populations, the daily average milk fat percentage of T / T genotype dairy cows is 4.22%, the daily average milk fat percentage of T / C genotype dairy cows is 4.04%, and the daily average milk fat percentage of C / C genotype dairy cows is 3.79%. This result is consistent with the conclusion in Example 1 that the milk fat percentage of TT genotype individuals is the highest, that of TC genotype individuals is the second, and that of CC genotype individuals is the lowest.
[0034] Through one-way ANOVA, it was found that there were significant differences in the mean milk fat percentages among different genotypes, and the significance P value was 6.41-E42 (Table 4).
[0035] Table 4. Results of one-way ANOVA of milk fat percentages of individuals with different genotypes at the chr5:92772499 (T>C) locus in the verification population One-way ANOVA was performed on the average milk fat percentage of individuals with three genotypes at the chr5:92772499 (T>C) locus in the validation population in Table 3. It was found that there were significant differences in the means among different groups, indicating that the polymorphism at the chr5:92772499 (T>C) locus was significantly correlated with the average milk fat percentage trait.
[0036] The present invention identified an SNP locus related to the milk fat percentage of dairy cows, detected the genotype of individual dairy cows at this locus through molecular biology-related techniques, and through the association analysis with the estimated breeding value of the milk fat percentage trait of dairy cows, selected individuals with favorable genotypes for breeding, which can increase the frequency of advantageous milk fat percentage alleles in the dairy cow population, reduce the feeding cost of the ranch, improve the breeding efficiency, and provide a new method for the genetic improvement of the milk fat percentage trait of dairy cows.
[0037] In this article, specific examples were used to elaborate on the inventive concept in detail. The description of the above embodiments is only for helping to understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent substitutions or other improvements made without departing from the inventive concept shall be included within the protection scope of the present invention.
Claims
1. A SNP molecular marker related to the milk fat percentage of dairy cows, characterized in that, The SNP molecular marker is located at chr5:92772499 in the dairy cow genome, with polymorphisms of T or C, and the coordinate position is based on the reference genome ARS-UCD2.
0.
2. The SNP molecular marker according to claim 1, wherein The SNP molecular marker is the 47th nucleotide of SEQ ID NO:1 in the sequence listing, with polymorphisms of T or C.
3. Use of the SNP molecular marker according to claim 1 or 2 in identifying dairy cows with high milk fat percentage, characterized in that, When the polymorphism of the SNP molecular marker is T, the milk produced by dairy cows has the trait of high milk fat percentage.
4. The application according to claim 3, wherein The method for identifying dairy cows with high milk fat percentage includes the following steps: (1) Extract the genomic DNA of the dairy cow to be identified; (2) Using the genomic DNA obtained in step (1) as a template, and using the nucleotide sequences shown in SEQ ID NO:2~3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker. The amplification product is 113bp, and the 47th position is the SNP molecular marker; (3) Sequence the amplification product. The SNP molecular marker genotype combinations from high to low milk fat percentage are TT, TC, and CC in turn.
5. Use of the molecular marker according to claim 1 or 2 in the assisted breeding of dairy cows, characterized in that, When the polymorphism of the SNP molecular marker is T, the milk produced by dairy cows has the trait of high milk fat percentage.
6. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that, The product is a primer pair, and the nucleotide sequence is as shown in SEQ ID NO:2~3.
7. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that, The product is a detection kit, including a primer pair, and the nucleotide sequence of the primer pair is as shown in SEQ ID NO:2~3.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker of gene LDHB related to milk production character of dairy cow and application of SNP molecular marker
CN117187409A
SNP (Single Nucleotide Polymorphism) molecular marker related to milk yield of dairy cow and application thereof
CN119193866A
Method for detecting milk production properties of dairy cows using APOM gene snps molecular marker and use
WO2024098242A1