Rapid campylobacter jejuni detection method and kit based on specific molecular target rpoZ

By adopting PCR/qPCR detection methods with rpoZ targets and specific primers, the problem of insufficient sensitivity and specificity of Campylobacter jejuni detection is solved, and rapid and accurate Campylobacter jejuni detection is achieved, which is suitable for food safety and public health prevention and control.

CN120290758APending Publication Date: 2025-07-11SOUTH CHINA UNIV OF TECH +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510401770.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing Campylobacter jejuni detection methods have problems such as low sensitivity, insufficient specificity and slow detection speed, which are difficult to meet the needs of rapid response to sudden outbreaks, especially in food safety incidents or public health crises.

Method used

RpoZ is used as a new detection target for Campylobacter jejuni, specific primers are designed, combined with PCR and qPCR detection methods, and kits suitable for conventional PCR and real-time fluorescence quantitative PCR are developed, including components such as Taq DNA polymerase, dNTPs, MgCl2, SYBR Green I dyes, etc., to achieve high specificity and high sensitivity detection.

Benefits of technology

It realizes efficient, accurate and rapid detection of Campylobacter jejuni, has high specificity and sensitivity, and can detect DNA as low as 132fg/μL. It is suitable for rapid detection in laboratories and on-site, and is compatible with different equipment conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290758A_ABST
    Figure CN120290758A_ABST
Patent Text Reader

Abstract

The invention discloses a campylobacter jejuni rapid detection method and a kit based on a specific molecular target rpoZ. The sequence of the molecular target is as shown in SEQ ID NO. 1. The PCR / qPCR detection kit for detecting campylobacter jejuni is established on the basis of the target rpoZ, has extremely high specificity, only has specific amplification signals for nucleic acid of campylobacter jejuni, and has no cross reaction for other common food-borne pathogenic bacteria such as escherichia coli, salmonella and staphylococcus aureus. Meanwhile, the sensitivity is high, and the nucleic acid detection target can detect the campylobacter jejuni genome DNA as low as 132fg / mu L. The method can effectively detect campylobacter jejuni in samples such as food, is high in specificity, good in accuracy and simple to operate, and can be applied to the fields of food safety and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial detection, and particularly relates to a specific detection target for Campylobacter jejuni and its related detection methods, which are applicable to the fields of detection of foodborne pathogenic bacteria, food safety monitoring, and public health early warning, etc. Background Art

[0004] At present, the detection methods for Campylobacter jejuni mainly include traditional bacterial culture methods, immunological detection techniques, and molecular biology methods, and each method has certain limitations in practical applications. The traditional bacterial culture method is regarded as the "gold standard" for laboratory diagnosis. The target strain is isolated through a selective medium, and then confirmed by combining morphological observation and biochemical characteristics. However, this method needs to be cultured under microaerophilic conditions (usually 5% O2, 10% CO2, and 85% N2), and it also needs to go through steps such as sample pre-enrichment, streak plating, and subsequent identification. The whole process usually takes 4 to 7 days. In addition, the growth requirements of Campylobacter jejuni are harsh. If the sample is not properly processed or the bacterial amount is too low, it may lead to separation failure and reduce the detection sensitivity. This time-dependence and operational complexity make it difficult to meet the rapid response requirements of sudden outbreaks, especially in food safety incidents or public health crises.

[0005] In recent years, nucleic acid-based molecular detection techniques have developed rapidly in the detection of Campylobacter jejuni. Among them, polymerase chain reaction (PCR), real-time fluorescence quantitative PCR (qPCR), and loop-mediated isothermal amplification (LAMP) have received wide attention due to their high sensitivity and rapidity. These methods achieve detection by amplifying target DNA fragments, and usually select conserved genes of Campylobacter jejuni as targets. However, there are still deficiencies in the selection and design of existing targets. For example, some methods detect the 16S rRNA gene, but the sequence differences of this gene within the genus Campylobacter are relatively small, and it is difficult to completely distinguish Campylobacter jejuni from other related species. In addition, although some functional genes (such as hipO or cadF) have certain specificities, there may be variations among different strains, resulting in inconsistent amplification efficiencies. Although the LAMP technique does not require a thermal cycler, its stability in complex samples still needs to be optimized, and the complexity of its primer design also limits its popularization and application.

[0006] In summary, exploring a new detection target for Campylobacter jejuni with high sensitivity, high specificity, and no interference, and developing a new specific detection target for Campylobacter jejuni and its supporting detection system can not only improve the detection efficiency, but also provide more reliable technical support for food safety assurance, epidemic tracing, and public health prevention and control, which has important scientific significance and application prospects. Summary of the Invention

[0007] The present invention aims to provide a novel Campylobacter jejuni detection target rpoZ, as well as PCR and qPCR detection methods and kits based on this target, so as to overcome the deficiencies of existing detection methods in terms of sensitivity, specificity, and detection speed, and the problem of few specific molecular targets, thereby achieving efficient, accurate, and rapid detection of Campylobacter jejuni.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] Through systematic bioinformatics analysis and experimental verification, the present invention screens out a specific nucleic acid sequence from the Campylobacter jejuni genome as a molecular detection target, named rpoZ. This target rpoZ is a DNA fragment encoding the nucleic acid sequence shown in SEQ ID NO.1, with a length of 225bp. This sequence is located in a specific conserved region of the Campylobacter jejuni genome. Through multiple sequence alignment and interspecies difference analysis, it is confirmed that it is highly conserved in Campylobacter jejuni, but significantly different from other common foodborne pathogenic bacteria, ensuring the high specificity of the target.

[0010] Based on this nucleic acid detection target, a pair of primers is carefully designed. The upstream primer sequence is shown in SEQ ID NO.2, which functions to specifically bind to the upstream region of the target nucleic acid and guide the DNA polymerase to extend the DNA strand; the downstream primer sequence is shown in SEQ ID NO.3 and is used to bind to the downstream region of the target nucleic acid.

[0011] The present invention also provides the application of the above primers in the preparation of a kit for detecting Campylobacter jejuni.

[0012] The present invention also provides a kit for detecting Campylobacter jejuni, which includes the above primers, PCR / qPCR reaction Mix, and positive control DNA template.

[0013] PCR mix: contains Taq DNA polymerase, dNTPs, MgCl2, and buffer system;

[0014] qPCR mix: contains SYBR Green I dye, hot-start Taq enzyme, dNTPs, and optimized buffer;

[0015] Positive control DNA template: provided in the form of Campylobacter jejuni genomic DNA or recombinant plasmid, containing the sequence of SEQ ID NO.1, and is used to verify the performance of the kit;

[0016] This kit is compatible with both conventional PCR and real-time fluorescence quantitative PCR detection, meeting the application requirements under different laboratory conditions.

[0017] The present invention also provides the use of the above primers or kits in the preparation of reagents for detecting Campylobacter jejuni.

[0018] The present invention also provides a method for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, comprising the following steps:

[0019] (a) Extract genomic DNA from the sample to be tested;

[0020] (b) Using the genomic DNA as a template, perform PCR or qPCR amplification with the above primers to obtain an amplification product;

[0021] (c) For qPCR reaction, detect the fluorescence signal based on a qPCR instrument and read the result;

[0022] (d) For PCR reaction, analyze the amplification product by agarose gel electrophoresis and read the result through a gel imaging instrument.

[0023] In step (b), the PCR amplification reaction system is 10 μL, including 5 μL of PCR Mix, 0.2 μL each of the forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double-distilled water; the PCR reaction conditions are: pre-denaturation: 95°C, 5 min; amplification cycle: 95°C for 30 s, 54.9°C for 30 s, 72°C for 5 s, 35 cycles; extension: 72°C, 5 min.

[0024] In step (b), the qPCR amplification reaction system is 10 μL, including 5 μL of qPCR Mix, 0.4 μL each of the forward and reverse primers, 1 μL of DNA template, and 3.2 μL of sterile double-distilled water; the qPCR reaction conditions are: pre-denaturation: 95°C, 60 s; amplification cycle: 95°C for 10 s, 60°C for 30 s, 45 cycles.

[0025] In step (c), qPCR result analysis: Use a qPCR instrument to monitor the fluorescence signal in real time and judge the presence of Campylobacter jejuni in the sample through the Ct value.

[0026] In step (d), PCR result verification: For the PCR amplification product, perform 1%-2% agarose gel electrophoresis, observe the 205 bp specific band, and record the result using a gel imaging instrument.

[0027] In step (d), if a single band appears at the 205 bp position in the PCR amplification product, it is determined that the sample contains Campylobacter jejuni; if no band of the target size appears, it is determined that the sample does not contain Campylobacter jejuni.

[0028] The present invention has the following beneficial effects: The nucleic acid detection target of the present invention has extremely high specificity. The nucleic acid target undergoes strict sequence alignment and verification, and has a specific amplification signal only for the nucleic acid of Campylobacter jejuni, and has no cross-reaction with other common foodborne pathogenic bacteria, such as Escherichia coli, Salmonella, Staphylococcus aureus, etc. At the same time, the present invention has high sensitivity, and the nucleic acid detection target can detect Campylobacter jejuni genomic DNA as low as 132 fg / μL; the kit integrates all necessary components, and users only need to provide sample DNA to carry out the detection, which is suitable for laboratory and on-site rapid detection. The double compatibility of PCR and qPCR further expands its application scope under different equipment conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is to verify the specificity of the molecular target by Blastn online.

[0030] Figure 2 It is Campylobacter with unidentified species in the Blastn comparison results of ANI analysis.

[0031] Figure 3 It is the optimization of the Tm value of the PCR reaction, where the Tm values corresponding to 1-8 are 50.3 °C, 51.4 °C, 52.9 °C, 54.9 °C, 57.2 °C, 59.2 °C, 60.7 °C, and 61.8 °C.

[0032] Figure 4 It is to verify the molecular detection target by PCR. 1-55 are Campylobacter jejuni DNA, B is the blank control, all strains are stored in this laboratory, and the size of the target band is 205 bp.

[0033] Figure 5 It is to verify the specificity of the molecular detection target by PCR. 1-7 are Campylobacter jejuni, B is the blank control, and 9-35 are bacteria of other species. The specific strain information is shown in Table 1.

[0034] Figure 6 It is the verification of the reliability of qPCR. The positive control is Campylobacter jejuni, blank is the blank control, and the other unlabeled curves are non-target strains. The specific information is shown in Table 1, a total of 27 strains.

[0035] Figure 7 It is the sensitivity detection of the PCR kit. The DNA of the positive strain is serially diluted and detected by PCR. The results are detected by gel electrophoresis. Among them, 1-8 represent dilution 10 1 -10 8 , B is the blank control.

[0036] Figure 8It is the sensitivity detection of the qPCR kit. The DNA of the positive strain is serially diluted and detected by qPCR, and the detection is implemented using a real-time fluorescence quantitative PCR instrument. Among them, 10 1 -10 8 is the dilution factor, and blank is the blank control.

[0037] Figure 9 It is the cq value corresponding to different concentrations of DNA measured by qPCR. ND indicates that no signal is detected, and the value is set to 40 and marked as ND.

[0038] Figure 10 It is the drawing of the standard curve of the qPCR kit.

[0039] Figure 11 It is the qPCR detection of artificially contaminated samples. Among them, 0-7 are the serial dilution multiples, 0 is the undiluted sample, and 1-7 are diluted 10 1 -10 7 times. Specific implementation mode

[0040] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0041] Example 1 Mining species-specific molecular targets of Campylobacter jejuni

[0042] Mainly obtain the molecular targets unique to Campylobacter jejuni according to the results of pan-genome analysis. Using the NCBI database, download the genomes of common Campylobacter species, perform pan-genome analysis on the common Campylobacter species, screen out the core genes unique to Campylobacter jejuni, and further screen through a local perl script. As a result, a molecular detection target with a length of 225bp is screened out, as shown in SEQ ID NO.1. Use the online database of NCBI to align it, set the core_nt of the database, and exclude Campylobacter jejuni from the alignment results. The results are as Figure 1 shown. Only a few undefined Campylobacter species can be aligned, and there are no strains of other species. Perform ANI analysis on the aligned Campylobacter species. The nucleic acid similarity with the standard strain NCTC11168 of Campylobacter jejuni exceeds 95%, and it is identified as Campylobacter jejuni, which further proves the good specificity of the target.

[0043] Example 2 Verification of species-specific targets of Campylobacter jejuni

[0044] Based on the Campylobacter jejuni specific species target of the nucleotide sequence shown in SEQ ID NO.1, primers SEQ ID NO.2 and SEQ ID NO.3 were designed. The PCR amplification reaction system was 10 μL, including: 5 μL of PCR Mix, 0.2 μL each of the forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double-distilled water. The PCR reaction conditions were: incubation at 95 °C for 5 min; amplification at 95 °C for 30 s, Tm for 30 s, 72 °C for 5 s, for a total of 35 cycles, and then extension for 5 min. Tm is one of 50.3 °C, 51.4 °C, 52.9 °C, 54.9 °C, 57.2 °C, 59.2 °C, 60.7 °C, 61.8 °C. The PCR products were identified by gel electrophoresis, and the results are as Figure 3 shown. The optimal Tm value was 54.9 °C, and this temperature was used for subsequent reactions. The DNA of Campylobacter jejuni and non-Campylobacter jejuni (Table 1) was used for PCR to verify the specificity of the target. The results are as Figure 4 and 5 shown. All Campylobacter jejuni could amplify the target band (205 bp), and all non-Campylobacter jejuni could not amplify the target band. That is, the nucleotide sequence shown in SEQ ID NO.1 can be used as a Campylobacter jejuni detection target.

[0045] >SEQ ID NO.1

[0046] ATGGATAAAAGAATAGAAGAAGTAGCGGCAAAAGCTTTGGAAAAAATGGGTAATGATAGATATCGCCTTTCTTTAGTGGTAGCAAAAAGAGCGGAACAATTGGCAAATGGAGCAACCCCTTTGGTAGACTTTGATAAAAATAAAAATAAACTTGCAGATATAGCTTTATATGAAATTGCAGAAAATAAAATCACTTTAGAGGGTTTAGTTGAAACCAATCGATGA

[0047] >SEQ ID NO.2

[0048] GAAGAAGTAGCGGCAAAAGC。

[0049] >SEQ ID NO.3

[0050] GATTGGTTTCAACTAAACCCTCT。

[0051] Table 1 List of strains for specificity verification

[0052]

[0053]

[0054] Preparation of the Kit in Example 3

[0055] Prepare the kit according to the conditions described in Example 2. The kit includes PCR amplification reaction PCR Mix and qPCR amplification reaction qPCR Mix, and PCR / qPCR primers; the PCR reaction tubes are individually packaged, and each reaction tube contains 5 μL of PCR Mix, 0.2 μL of each forward and reverse primer, and 4.1 μL of sterile double-distilled water; the qPCR reaction tubes are individually packaged and include: 5 μL of qPCR Mix, 0.4 μL of each forward and reverse primer, and 3.2 μL of sterile double-distilled water.

[0056] Specific usage method: Take 0.5 μL of the extracted DNA and add it to the PCR reaction tube, or take 1 μL of the extracted DNA and add it to the qPCR reaction tube, and mix well. The PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 54.9°C for 30 s, extension at 72°C for 10 s, for a total of 35 cycles; finally, extension at 72°C for 5 min. The qPCR reaction conditions are: incubation at 95°C for 60 s; amplification at 95°C for 10 s, 60°C for 30 s, for a total of 45 cycles. During the reaction process, a fluorescence quantitative PCR instrument can be used for observation.

[0057] The forward primer sequence of the PCR / qPCR primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.

[0058] Reliability Detection of the Kit in Example 4

[0059] Use the DNA of Campylobacter jejuni and non-Campylobacter jejuni to determine the reliability of the qPCR kit. It is required that the target bacteria can have a fluorescence signal and peak earlier. The non-target bacteria have no fluorescence signal or have a fluorescence signal after 30 cycles. The results are as Figure 6 shown. The target strain has a strong signal at 14 cycles, while the non-target bacteria peak or have no signal after 33 cycles, indicating that the kit can be used for the detection of Campylobacter jejuni.

[0060] Sensitivity Identification of the Kit in Example 5

[0061] Use the pure DNA of Campylobacter jejuni to detect the sensitivity of PCR in the kit. The initial concentration of the DNA used is 13.2 ng / μL, and use the kit and method described in Example 3 for PCR detection, and perform agarose gel electrophoresis detection on the amplification products. The results are as Figure 7 shown. Dilute the DNA to 10 4After that, bands can still be detected, and the detection sensitivity can reach 1.32 pg / μL.

[0062] The sensitivity of qPCR in the kit was detected using pure DNA of Campylobacter jejuni. The initial concentration of the DNA used was 13.2 ng / μL, and qPCR detection was performed using the kit and method described in Example 3. The experimental results were read in real time using a fluorescence quantitative PCR instrument. The results were as Figure 8-9 shown. After diluting the DNA to 10 5 times, it was still separated from the signal of the blank control. As Figure 8 shown, the detection sensitivity could reach 132 fg / μL. Similarly, we found that the qPCR kit could be used for quantitative analysis. In the range of 10 1 -10 4 dilution, the cq value was linearly correlated with the DNA concentration. The linear equation was y = 5.443X + 7.840, and R2 = 0.9993, indicating a high degree of fitting ( Figure 10 ).

[0063] Example 6 Artificial contamination experiment

[0064] Campylobacter jejuni was cultured under microaerophilic conditions for about 24 hours. A cotton swab was used to resuspend the bacterial lawn on the blood agar plate into physiological saline, and gradient dilution was performed. The plate count was (2.6×10 9 CFU / mL). At the same time, 1 g of chicken was soaked in bacterial solutions of different dilutions for about 1 h. The chicken was taken out, washed with 9 mL of PBS, and 2 mL of the washing solution was taken to extract DNA. qPCR detection was performed using the kit provided by the present invention. The results were as Figure 11 shown. It could still be detected after diluting the bacterial solution 10 6 times. That is, the sensitivity for artificially contaminated samples was 2.6×10 3 CFU / mL.

[0065] In summary, the new Campylobacter jejuni detection target and detection technology integration solution provided by the present invention has the advantages of high specificity, high sensitivity, rapid detection, and strong anti-interference ability, and has broad application prospects in the fields of detection of foodborne pathogenic bacteria, food safety monitoring, and public health prevention and control.

[0066] The above is only the preferred embodiment of the present invention. It should be noted that the above preferred embodiment should not be regarded as a limitation of the present invention. The protection scope of the present invention should be subject to the scope defined by the claims. For those of ordinary skill in the art, without departing from the spirit and scope of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A specific molecular detection target rpoZ of Campylobacter jejuni, characterized in that, The nucleotide sequence of the specific molecular detection target rpoZ is shown as SEQ ID NO.

1.

2. A pair of primers for detecting the Campylobacter jejuni-specific molecular detection target rpoZ described in claim 1, characterized in that, The nucleotide sequences of the primers are shown as SEQ ID NO.2-3.

3. Use of the primer according to claim 2 in the preparation of a kit for detecting Campylobacter jejuni.

4. A kit for detecting Campylobacter jejuni, characterized in that, The kit includes the primer according to claim 2.

5. The kit according to claim 4, wherein The kit further includes a PCR / qPCR reaction Mix and a positive control DNA template.

6. Use of the primer according to claim 2 or the kit according to claim 4 in the preparation of a reagent for detecting Campylobacter jejuni.

7. A method for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that, Comprising the following steps: (a) Extracting genomic DNA from the sample to be tested; (b) Using the genomic DNA as a template and performing PCR or qPCR amplification with the primer according to claim 2 to obtain an amplification product; (c) For the qPCR reaction, detecting the fluorescence signal based on a qPCR instrument and reading the result; (d) For the PCR reaction, analyzing the amplification product by agarose gel electrophoresis and reading the result through a gel imager.

8. The detection method according to claim 7, characterized in that In step (b), the PCR amplification reaction system is 10 μL, containing 5 μL of PCR Mix, 0.2 μL each of the forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double-distilled water; the PCR reaction conditions are: pre-denaturation: 95°C, 5 min; amplification cycle: 95°C for 30 s, 54.9°C for 30 s, 72°C for 5 s, 35 cycles; extension: 72°C, 5 min.

9. The detection method according to claim 7, wherein In step (b), the qPCR amplification reaction system is 10 μL, containing 5 μL of qPCR Mix, 0.4 μL each of the forward and reverse primers, 1 μL of DNA template, and 3.2 μL of sterile double-distilled water; the qPCR reaction conditions are: pre-denaturation: 95°C, 60 s; amplification cycle: 95°C for 10 s, 60°C for 30 s, 45 cycles.

10. The detection method according to claim 7, wherein, In step (d), if a single band appears at the 205 bp position in the PCR amplification product, it is determined that the sample contains Campylobacter jejuni; if no band of the target size appears, it is determined that the sample does not contain Campylobacter jejuni.