Rapid detection method and kit for campylobacter jejuni based on specific molecular target glnp

Abstract

The invention discloses a method and a kit for rapidly detecting campylobacter jejuni based on a specific molecular target glnp. The sequence of the molecular target is as shown in SEQ ID NO. 1. The PCR / qPCR detection kit for detecting campylobacter jejuni is established based on the target glnp, has extremely high specificity, only has a specific amplification signal for nucleic acid of campylobacter jejuni, and does not have any cross reaction for other common food-borne pathogenic bacteria such as escherichia coli, salmonella and staphylococcus aureus. Meanwhile, the sensitivity is high, and the nucleic acid detection target can detect the campylobacter jejuni genome DNA as low as 132fg / mu L. The method has the advantages of short detection time, high specificity, high detection sensitivity, simplicity in operation and the like.

Description

Technical Field

[0001] The present invention relates to the field of microbial detection technology, and in particular to a new Campylobacter jejuni detection target and its application in foodborne pathogenic bacteria detection, food safety monitoring and public health prevention and control. Background Art

[0002] Campylobacter jejuni is an important foodborne pathogen that is widely distributed around the world and poses a serious threat to human health. After Campylobacter jejuni infects the human body, it mainly causes symptoms such as acute enteritis, diarrhea, abdominal pain, and fever. Some patients may also develop serious complications such as Guillain-Barré syndrome (GBS), which greatly affects the patient's quality of life and physical health.

[0003] At present, there are many detection methods for Campylobacter jejuni, but all of them have certain limitations. Although the traditional bacterial culture method is the "gold standard" for detecting Campylobacter jejuni, its operation process is cumbersome and requires multiple steps such as sample pretreatment, selective culture medium culture, and biochemical identification. The entire detection cycle usually takes 4-7 days, which is extremely unfavorable for timely detection and control of the spread of foodborne diseases. Immunological detection methods, such as enzyme-linked immunosorbent assay (ELISA) and immunochromatography, are relatively simple and rapid to operate, but their sensitivity and specificity are easily affected by factors such as antibody quality and cross-reaction. For example, in actual detection, the detection sensitivity of the ELISA method for Campylobacter jejuni is about 10 4 -10 5 CFU / mL, and there are cross reactions with other Campylobacter or enteric bacteria, leading to false positive results. Although nucleic acid-based detection methods, such as polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP), have high sensitivity and specificity, the existing detection targets are mostly concentrated on the 16S rRNA gene, mapA gene, etc. These targets have certain sequence variations between different strains, affecting the accuracy and reliability of the detection. In addition, impurities in some complex food matrices or environmental samples may also inhibit the nucleic acid amplification reaction, leading to false negative results.

[0004] In summary, the development of a new, highly sensitive, highly specific and interference-free Campylobacter jejuni detection target is of great practical significance for improving the detection efficiency of Campylobacter jejuni and ensuring food safety and public health safety. Summary of the invention

[0005] The present invention aims to provide a novel Campylobacter jejuni detection target glnp, as well as corresponding PCR and qPCR detection methods and kits, so as to overcome the defects of existing detection methods, improve the accuracy, sensitivity and specificity of Campylobacter jejuni detection, and achieve rapid and accurate detection of Campylobacter jejuni.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] Through a large amount of bioinformatics analysis and experimental verification, the present invention screens out a nucleic acid sequence as a specific molecular detection target for Campylobacter jejuni, named glnp. The molecular detection target glnp is a DNA fragment, and the nucleotide sequence of the molecular detection target is shown in SEQ ID NO.1.

[0008] Based on this nucleic acid detection target, a pair of primers is carefully designed. The upstream primer sequence is shown in SEQ ID NO.2, and its function is to specifically bind to the upstream region of the target nucleic acid and guide DNA polymerase to extend the DNA strand; the downstream primer sequence is shown in SEQ ID NO.3 and is used to bind to the downstream region of the target nucleic acid.

[0009] The present invention also provides the application of the above primers in the preparation of a kit for detecting Campylobacter jejuni.

[0010] The present invention also provides a kit for detecting Campylobacter jejuni, which includes the above primers, PCR / qPCR reaction Mix, and positive control DNA template.

[0011] The present invention also provides the application of the above primers or kit in the preparation of a reagent for detecting Campylobacter jejuni.

[0012] The present invention also provides a method for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, including the following steps:

[0013] (a) Extract genomic DNA from the sample to be tested;

[0014] (b) Using the genomic DNA as a template, perform PCR / qPCR amplification with the above primers to obtain an amplification product;

[0015] (c) For the PCR reaction product, use agarose gel electrophoresis, and use a gel imaging system to read the results, or based on a qPCR instrument, detect the qPCR fluorescence signal and read the sample results.

[0016] In step (b), the PCR amplification reaction system is 10 μL, including 5 μL of PCR Mix, 0.2 μL each of forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double-distilled water; the PCR reaction conditions are: incubation at 95 °C for 5 min; the amplification stage is 95 °C for 30 s, 54.9 °C for 30 s, 72 °C for 5 s, for a total of 35 cycles, and then extension for 5 min.

[0017] In step (b), the qPCR amplification reaction system is 10 μL, including 5 μL of qPCR Mix, 0.4 μL each of forward and reverse primers, 1 μL of DNA template, and 3.2 μL of sterile double-distilled water; the qPCR reaction conditions are: incubation at 95 °C for 60 s; the amplification stage is 95 °C for 10 s, 60 °C for 30 s, for a total of 45 cycles.

[0018] In step (c), if a single band appears at the 193 bp position in the PCR amplification product, it is determined that the sample contains Campylobacter jejuni; if no band of the target size appears, it is determined that the sample does not contain Campylobacter jejuni.

[0019] The present invention has the following beneficial effects: The nucleic acid detection target of the present invention has extremely high specificity. The nucleic acid target has been strictly sequence-aligned and verified, and has specific amplification signals only for the nucleic acid of Campylobacter jejuni, and has no cross-reaction with other common foodborne pathogenic bacteria, such as Escherichia coli, Salmonella, Staphylococcus aureus, etc. At the same time, the present invention has high sensitivity, and the nucleic acid detection target can detect Campylobacter jejuni genomic DNA as low as 132 fg / μL; based on the detection target and detection technology integration scheme of the present invention, nucleic acid detection can be completed within 1-2 hours, and compared with the traditional bacterial culture method, the detection time is greatly shortened, and it can meet the needs of rapid screening and emergency detection. Description of the Drawings

[0020] Figure 1 It is a PCR verification molecular detection target. 1-55 are Campylobacter jejuni DNA, B is a blank control, all strains are preserved in this laboratory, and the target band size is 193 bp.

[0021] Figure 2 It is the specificity of the PCR verification molecular detection target. 1-7 are Campylobacter jejuni, B is a blank control, 9-35 are bacteria of other species, and the specific strain information is shown in Table 1.

[0022] Figure 3 It is the qPCR reliability verification, the positive control is Campylobacter jejuni, blank is the blank control, and the other unlabeled strains are non-target strains. The detailed information of the non-target strains is shown in Table 1, with a total of 27 strains.

[0023] Figure 4It is the sensitivity detection of the PCR kit. The DNA of the positive strain is serially diluted and detected by PCR. The results are detected by gel electrophoresis. Among them, 1-8 represent dilution 10 1 -10 8 , and B is the blank control.

[0024] Figure 5 It is the sensitivity detection of the qPCR kit. The DNA of the positive strain is serially diluted and detected by qPCR. The results are detected by a fluorescence quantitative PCR instrument. Among them, 10 1 -10 8 is the dilution factor, and blank is the blank control.

[0025] Figure 6 It is the cq value corresponding to different concentrations of DNA measured by qPCR.

[0026] Figure 7 It is the drawing of the standard curve of the qPCR kit.

[0027] Figure 8 It is the qPCR detection of artificially contaminated samples. Among them, 0-7 are the serial dilution multiples, 0 is the undiluted solution, and 1-7 are diluted 10 1 -10 7 times. Specific implementation mode

[0028] The following examples are further illustrations of the present invention, rather than limitations on the present invention.

[0029] Example 1 Mining the species-specific molecular target of Campylobacter jejuni

[0030] Mainly obtain the molecular targets unique to Campylobacter jejuni according to the results of pan-genome analysis. Using the NCBI database, download the genomes of common Campylobacter, perform pan-genome analysis on common Campylobacter, screen out the core genes unique to Campylobacter jejuni, and further screen through a local perl script. As a result, a molecular detection target with a length of 657bp was screened out, as shown in SEQ ID NO.1.

[0031] Example 2 Verifying the species-specific target of Campylobacter jejuni

[0032] Based on the Campylobacter jejuni - specific species target of the nucleotide sequence shown in SEQ ID NO.1, primers SEQ ID NO.2 and SEQ ID NO.3 were designed, and the specificity of the target was verified by PCR using the DNA of Campylobacter jejuni and non - Campylobacter jejuni. The PCR amplification reaction system was 10 μL, including: 5 μL of PCR Mix, 0.2 μL each of forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double - distilled water. The PCR reaction conditions were: incubation at 95 °C for 5 min; amplification at 95 °C for 30 s, 54.9 °C for 30 s, 72 °C for 5 s, for a total of 35 cycles, and then extension for 5 min. The results are as Figure 1 and Figure 2 shown. All Campylobacter jejuni could amplify the target band (193 bp), and all non - Campylobacter jejuni could not amplify the target band. That is, the nucleotide sequence shown in SEQ ID NO.1 can be used as a detection target for Campylobacter jejuni.

[0033] >SEQ ID NO.1

[0034] ATGCTTGAACTTTTAAATACCGATACGCTTTTAAGACTCTGGCAAGGGCTTTTTGTCAC

[0035] TCTTGAAATTTCATTTATCAGCATTATTATTACTTCGATAGGTGGGTTATTTTTAGGAATT

[0036] TTAATGAGTTTTAAAAATACCTATATCTATGCTTTTTGTCGTTTGGGTTTAGAATTTGTGC

[0037] GTGTTATGCCACTTTTAGTATGGCTTTTTGTGGTGTATTTTGGTTTTCCTAGATGGTTTG

[0038] GGTGGGATTTGAGTTCTGTAAGTGCAGCTATTATTGTTTTTAGCATTTGGGGTTGTTTTG

[0039] AGATGATGGATTTGGTGCGTGTTTCCTTGCAGAGTATTCCAAAACATCAGTATGAAAGT

[0040] GCATCATCTTTAGGTTTAAATACGGTGCAAAGTTTTGCTTATGTTATTATTCCACAAGCT

[0041] ATGCGTCGTTTAACTCCTATGAGCATGAATTTACTTACTCGTATGATTAAAAGTACAACC

[0042] TTTGCTTATTTAATCGGAGCGGTAGAGCTTGTAAAAGTAGGGCAACAAATTATAGAATT

[0043] TCATAATAGAAATGATTTTGCACCTTTTATTATTTATGGTTTGATTTTTTTTATCTTTTTTAT

[0044] ACTTTGTTATCCTATCACTTTATATTCAAGAAAATTAGAGAAAAAATGGAGCTAA

[0045] >SEQ ID NO.2

[0046] GATTTGGTGCGTGTTTCCT。

[0047] >SEQ ID NO.3

[0048] CCGCTCCGATTAAATAAGCA。

[0049] Table 1 List of strains for specificity verification

[0050]

[0051]

[0052] Example 3 Preparation of the kit

[0053] Prepare the kit according to the conditions described in Example 2. The kit includes PCR amplification reaction PCR Mix and qPCR amplification reaction qPCR Mix, and PCR / qPCR primers; the PCR reaction tubes are individually packaged, and each reaction tube contains 5 μL of PCR Mix, 0.2 μL of each forward and reverse primer, and 4.1 μL of sterile double-distilled water; the qPCR reaction tubes are individually packaged, including: 5 μL of qPCR Mix, 0.4 μL of each forward and reverse primer, and 3.2 μL of sterile double-distilled water.

[0054] Specific usage method: Take 0.5 μL of the extracted DNA and add it to the PCR reaction tube, or take 1 μL of the extracted DNA and add it to the qPCR reaction tube, and mix well. The PCR reaction conditions are as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 54.9 °C for 30 s, extension at 72 °C for 10 s, for a total of 35 cycles; finally, extension at 72 °C for 5 min. The qPCR reaction conditions are as follows: incubation at 95 °C for 60 s; amplification at 95 °C for 10 s, 60 °C for 30 s, for a total of 45 cycles. During the reaction process, a fluorescence quantitative PCR instrument can be used for observation.

[0055] The forward primer sequence of the PCR / qPCR primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.

[0056] Example 4 Detection of the reliability of the kit

[0057] Using the DNA of Campylobacter jejuni and non-Campylobacter jejuni, the reliability of the qPCR kit was determined. It is required that the target bacteria can have a fluorescence signal and peak earlier. The non-target bacteria have no fluorescence signal, or a fluorescence signal appears after 33 cycles. The results are as Figure 3 shown. The target strain had a strong signal at 10 cycles, while the non-target strain peaked or had no signal after 33 cycles, indicating that the kit can be used for the detection of Campylobacter jejuni.

[0058] Example 5 Identification of the sensitivity of the kit

[0059] Using the pure DNA of Campylobacter jejuni to detect the sensitivity of PCR in the kit, the initial concentration of the DNA used was 13.2 ng / μL, and the kit and method described in Example 3 were used for PCR detection, and the amplified products were detected by agarose gel electrophoresis. The results are as Figure 4 shown. After diluting the DNA to 10 4 , a band could still be detected, and the detection sensitivity could reach 1.32 pg / μL.

[0060] Using the pure DNA of Campylobacter jejuni to detect the sensitivity of qPCR in the kit, the initial concentration of the DNA used was 13.2 ng / μL, and the kit and method described in Example 3 were used for qPCR detection, and a fluorescence quantitative PCR instrument was used to read the experimental results in real time. The results are as Figures 5 - 6 shown. After diluting the DNA to 10 5 , it was still separated from the signal of the blank control, as Figure 5 shown. The detection sensitivity could reach 132 fg / μL. Similarly, we found that the qPCR kit can be used for quantitative analysis, at 10 1 -10 5Within the dilution range, the cq value is linearly correlated with the DNA concentration. The linear equation is y = 4.727X + 10.62, and R2 = 0.9969, indicating a high degree of fitting ( Figure 7 ).

[0061] Example 6 Artificial Contamination Experiment

[0062] Culture Campylobacter jejuni under microaerophilic conditions for about 24 hours. Use a cotton swab to resuspend the bacterial lawn from the blood agar plate into physiological saline and perform serial dilutions. Spread plate counting (2.6×10 9 CFU / mL). At the same time, soak 1 g of chicken in bacterial solutions of different dilutions for about 1 h. Take out the chicken, wash the chicken with 9 mL of PBS, and take 2 mL of the washing solution to extract DNA. Then use the kit provided by the present invention for qPCR detection. The results are as Figure 8 shown. It can still be detected after diluting the bacterial solution by 10 7 . That is, the sensitivity for artificially contaminated samples is 2.6×10 2 CFU / mL.

[0063] In summary, the new Campylobacter jejuni detection target and detection technology integration solution provided by the present invention have the advantages of high specificity, high sensitivity, rapid detection, and strong anti-interference ability, and have broad application prospects in the fields of detection of foodborne pathogenic bacteria, food safety monitoring, and public health prevention and control.

[0064] The above is only the preferred embodiment of the present invention. It should be noted that the above preferred embodiment should not be construed as a limitation of the present invention. The protection scope of the present invention should be determined by the scope defined by the claims. For those of ordinary skill in the art in this technical field, without departing from the spirit and scope of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A specific molecular detection target glnp of Campylobacter jejuni, characterized in that, The nucleotide sequence of the specific molecular detection target glnp is shown in SEQ ID NO.

1.

2. A pair of primers for detecting the Campylobacter jejuni-specific molecular detection target glnp described in claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.2-3.

3. Use of the primer according to claim 2 in the preparation of a kit for detecting Campylobacter jejuni.

4. A kit for detecting Campylobacter jejuni, characterized in that, The kit includes the primer according to claim 2.

5. The kit according to claim 4, wherein The kit further includes a PCR / qPCR reaction Mix and a positive control DNA template.

6. Use of the primer according to claim 2 or the kit according to claim 4 in the preparation of a reagent for detecting Campylobacter jejuni.

7. A method for detecting Campylobacter jejuni for non-disease diagnosis and treatment purposes, characterized in that, Comprising the following steps: (a) Extracting genomic DNA of the sample to be tested; (b) Using the genomic DNA as a template and performing PCR / qPCR amplification with the primer according to claim 2 to obtain an amplification product; (c) For the PCR reaction product, using agarose gel electrophoresis, reading the result with a gel imaging instrument, or based on a qPCR instrument, detecting the qPCR fluorescence signal and reading the sample result.

8. The detection method according to claim 7, wherein In step (b), the PCR amplification reaction system is 10 μL, containing 5 μL of PCR Mix, 0.2 μL of each of the forward and reverse primers, 0.5 μL of DNA template, and 4.1 μL of sterile double-distilled water; the PCR reaction conditions are: incubation at 95°C for 5 min; the amplification stage is 95°C for 30 s, 54.9°C for 30 s, 72°C for 5 s, for a total of 35 cycles, and then extension for 5 min.

9. The detection method according to claim 7, characterized in that, In step (b), the qPCR amplification reaction system is 10 μL, containing 5 μL of qPCR Mix, 0.4 μL of each of the forward and reverse primers, 1 μL of DNA template, and 3.2 μL of sterile double-distilled water; the qPCR reaction conditions are: incubation at 95°C for 60 s; the amplification stage is 95°C for 10 s, 60°C for 30 s, for a total of 45 cycles.

10. The detection method according to claim 7, characterized in that, In step (c), if a single band appears at the 193 bp position in the PCR amplification product, it is determined that the sample contains Campylobacter jejuni; if no band of the target size appears, it is determined that the sample does not contain Campylobacter jejuni.

Images