KASP molecular marker related to wheat scab resistance and application

The detection of SNP1 loci in the wheat genome by KASP marker solved the problem of lack of resistant molecular markers in wheat gibberellia, achieved rapid identification and breeding, and improved the screening efficiency of wheat disease-resistant varieties.

CN120290772APending Publication Date: 2025-07-11CROP RESOURCES RES INST OF HEILONGJIANG ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510520468.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-24
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The lack of molecular markers related to resistance to gibberellosis in the prior art makes it difficult to quickly select and breed high-resistant wheat varieties, and the lack of germplasm resources.

Method used

KASP (Kompetitive Allele-Specific PCR) marker was used to detect the polymorphism or genotype of the SNP1 site in the wheat genome, and specific primer compositions (P1 or P2) were used to identify or assist in the identification of wheat gibberellia resistance, and homozygous wheat with the SNP1 site T was selected as the parent for breeding through wheat breeding methods.

Benefits of technology

It has achieved rapid and accurate identification of wheat gibberellosis resistance, and can quickly screen out wheat varieties with strong resistance, improve breeding efficiency, and promote the cultivation of new disease-resistant wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290772A_ABST
    Figure CN120290772A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker related to wheat scab resistance and application, and belongs to the field of biochemistry. The invention aims to solve the technical problem of how to identify or assist in identifying the wheat scab resistance and assist in breeding according to the wheat scab resistance. One scheme of the invention is application of a composition for detecting polymorphism or genotype of an SNP1 site in a wheat genome in identification or auxiliary identification of wheat scab resistance. The SNP1 site is an SNP site in a wheat genome, the nucleotide type of the SNP1 site is A or G, and the SNP1 site is the 36th nucleotide in SEQ ID No.1. The polymorphism of the SNP1 is directly expressed in the form of DNA and can be detected in each tissue and each development stage of wheat, the wheat scab resistance can be predicted, and the breeding process of a new variety of disease-resistant wheat is accelerated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biochemistry, and particularly relates to a KASP molecular marker related to wheat scab resistance and its application. Background Art

[0002] Wheat scab ( Fusarium head blight,FHB ) is an ear disease caused by fungi of the genus Fusarium ( Fusarium ), and the harm to wheat ( Triticum aestivum L. ) production is becoming more and more serious. FHB widely occurs in warm, humid and semi-humid regions. During the wheat flowering period, in the air environment with high humidity, low solar radiation and low wind speed, the release concentration of ascospores of Fusarium graminearum will increase, resulting in serious occurrence of scab. When scab occurs, initially there will be water-soaked brown spots with unclear edges on the glumes, which gradually expand to the whole spikelet, and then the spikelet withers; when the humidity is high, pink mold layers will be produced at the lesion sites. The harms of scab include yield reduction, quality decline, toxin residue, etc. Scab can cause wheat sterility, reduced grain plumpness, yield decline, generally a 10%-15% reduction, and sometimes higher than 50%. The seed germination rate is low, and seedling rot and stalk rot occur, resulting in seedling shortage and yield reduction. Scab can reduce the protein content and the synthesis of other wheat grain storage substances, seriously affecting the flour quality. Fusarium can produce various toxins, such as deoxynivalenol (DON), etc. DON will cause symptoms such as dizziness, headache, nausea, vomiting, abdominal pain, diarrhea, fever, drowsiness, etc.

[0003] In recent years, domestic and foreign scholars have carried out a series of studies on aspects such as disease-resistant gene discovery and germplasm resource identification. In terms of disease-resistant gene discovery, more than 60 scab-related QTLs have been mapped on wheat chromosomes 1A, 1D, 2A, 2B, 2D, 3A, 3B, 4B, 5B, 5D, 6A, 6B and 6D. At present, some genes have been cloned, such as FHB1 、 FHB7etc. However, the small number of identified major disease-resistant genes, the lack of molecular markers, and the scarcity of disease-resistant sources available for breeding remain the main problems faced by current disease-resistant breeding work. Wheat resistance to Fusarium head blight is mainly achieved by activating corresponding defense response genes through the salicylic acid (SA) and jasmonic acid (JA) signaling pathways. Existing research has shown that there are few germplasm resources resistant to Fusarium head blight in wheat, and no immune materials have been found. From the previous research results, it can be seen that the resistance of wheat to Fusarium head blight does not conform to the classical 'gene-for-gene' hypothesis and belongs to a typical basal disease resistance response. Therefore, although great progress has been made in wheat breeding for resistance to Fusarium head blight, it is difficult to quickly breed highly resistant wheat varieties through conventional breeding techniques. It is necessary to deeply study the molecular mechanism of pathogen infection and the disease resistance mechanism of the host, as well as improve the methods and techniques for the utilization of disease resistance, in order to construct a more efficient disease-resistant breeding strategy and explore new ways for disease-resistant breeding.

[0004] KASP (Kompetitive Allele-Specific PCR) markers have been widely used to detect SNP loci in crops such as wheat, rice, and maize, enabling rapid high-throughput genotyping. By using the genotype data of wheat SNP chips for QTL (Quantitative Trait Locus) mapping and genome-wide association analysis, and converting linked SNPs into KASP markers, they can be directly applied to marker-assisted selection breeding. Summary of the Invention

[0005] One technical problem to be solved by the present invention is how to identify or assist in the identification of wheat resistance to Fusarium head blight.

[0006] To solve the above technical problems, the present invention provides any one of the following applications A1 - A3 and method A4: A1. The application of a composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome in identifying or assisting in the identification of wheat resistance to Fusarium head blight; the SNP1 locus is a SNP locus in the wheat genome, its nucleotide type is T or C, and it is the 36th nucleotide of SEQ ID No.1; the composition contains the PCR primers, and the PCR primers are P1 or P2: P1. The PCR primer is a primer group composed of single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.2, single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.3, and single-stranded DNA with a nucleotide sequence of SEQ ID No.4; P2. The PCR primer is a primer set composed of single-stranded DNA with a nucleotide sequence of SEQ ID No.2, single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and single-stranded DNA with a nucleotide sequence of SEQ ID No.4.

[0007] A2. Use of a composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome in the preparation of a product for identifying or assisting in the identification of wheat scab resistance; the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains the above PCR primer, and the PCR primer is the above P1 or the above P2.

[0008] A3. Use of a composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome in wheat breeding or in the preparation of wheat breeding products; the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains the above PCR primer, and the PCR primer is the above P1 or the above P2.

[0009] The purpose of the breeding includes breeding wheat resistant to scab.

[0010] A4. A method for identifying or assisting in the identification of wheat scab resistance, including detecting the genotype of the wheat to be tested, and identifying or assisting in the identification of wheat scab resistance according to the genotype of the wheat to be tested; the genotype is the genotype of the SNP1 locus in the wheat genome; the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the detection is carried out using the above PCR primer, and the PCR primer is the above P1 or the above P2.

[0011] Another technical problem to be solved by the present invention is how to carry out wheat breeding.

[0012] To solve the above technical problems, the present invention provides the following technical solutions: B1. Use of the method described in A4 in wheat breeding.

[0013] The purpose of the breeding includes breeding wheat resistant to scab.

[0014] B2. A method for wheat breeding, including: detecting the polymorphism described in A1 of the wheat genome, and selecting wheat with a homozygous type of T at the SNP1 locus in the wheat genome as a parent for breeding. QFHBR.haas-2D

[0015] ​The purposes of the breeding include selecting wheat resistant to Fusarium head blight.

[0016] Any one of the following products 1)-3) of a composition containing a polymorphism or genotype (i.e., allele) detecting the SNP1 locus in the wheat genome also belongs to the protection scope of the present invention: 1) A product for detecting a single nucleotide polymorphism or genotype related to wheat resistance to Fusarium head blight; 2) A product for identifying or assisting in identifying wheat resistance to Fusarium head blight; 3) A product for wheat breeding.

[0017] In the above applications, methods and products, the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1. The detection of the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome can specifically be the detection of the nucleotide type of the SNP1 locus. The genotype of the SNP1 locus in the wheat genome can be CC, TT or TC. The CC is the homozygous type where the SNP1 locus in the wheat genome is C, the TT is the homozygous type where the SNP1 locus in the wheat genome is T, and the TC is the heterozygous type where the SNP1 locus in the wheat genome is T and C.

[0018] In the method described in A4, the identification or assistance in identifying the wheat resistance to Fusarium head blight according to the genotype of the wheat to be tested can be that the wheat to be tested with the genotype of TT has stronger or candidate stronger resistance to Fusarium head blight than the wheat to be tested with the genotype of GG.

[0019] In the above applications, methods and products, the wheat breeding is to cultivate wheat resistant to Fusarium head blight.

[0020] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome can be determined by at least one of the following methods QFHBR.haas-2D The reagents and / or instruments required for the polymorphism or genotype: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and a chip based on fluorescent molecule-DNA binding reaction.

[0021] In the above applications, methods and products, the composition for detecting the polymorphism or genotype (i.e., allele) of the SNP1 locus in the wheat genome is as follows 1), 2) or 3): D1) The composition for detecting the polymorphism or genotype of SNP1 locus in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1 locus; D2) The composition for detecting the polymorphism or genotype of SNP1 locus in the wheat genome is a PCR reagent containing the PCR primers; D3) A kit containing the PCR primers described in D1) or the PCR reagent described in D2).

[0022] In the above applications, methods and products, the PCR primers can be labeled with a labeling agent. The labeling agent refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labeling agents include, but are not limited to, dyes; radioactive labels such as 32 P; binding moieties such as biotin; haptens such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and individual fluorescent dyes or fluorescent dyes combined with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, optionally, can be charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the label is detectable. In some embodiments, nucleic acids are directly detected without a label (e.g., directly reading the sequence). For example, the PCR primers can be a primer set composed of single-stranded DNA with a nucleotide sequence of SEQ ID No.2, single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and single-stranded DNA with a nucleotide sequence of SEQ ID No.4. SEQ ID No.2 in the sequence listing consists of 41 nucleotides, with the 1st - 21st nucleotides being the FAM linker sequence (as a labeling agent), and the 22nd - 41st nucleotides being the specific sequence; SEQ ID No.3 in the sequence listing consists of 41 nucleotides, with the 1st - 21st nucleotides being the HEX linker sequence (as a labeling agent), and the 22nd - 41st nucleotides being the specific sequence.

[0023] In the above applications, methods, and products, the product may be a reagent, a kit, or a system. The system may include a combined product of a reagent or a kit, an instrument, and analysis software, such as a product composed of PCR primers, PARMS master mix reagent, a microplate reader, and the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), or a combined product composed of PCR primers, PARMS master mix reagent, the online software SNP decoder, and a real-time fluorescence quantitative PCR instrument. The product may include the composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome as described above.

[0024] The present invention discloses a new KASP marker for detecting the resistance to Fusarium head blight in wheat. The specific primer set provided by the present invention is composed of the single-stranded DNA shown in SEQ ID No.2, the single-stranded DNA shown in SEQ ID No.3, and the single-stranded DNA shown in SEQ ID No.4, wherein the single-stranded DNAs shown in SEQ ID No.2 and SEQ ID No.3 carry fluorescently labeled adapters. In one embodiment of the present invention, the above-mentioned primer set with fluorescently labeled adapters is used to amplify the genomic DNA of wheat including the SNP1 locus in two groups of multiple samples, and fluorescence signal processing is performed to determine the nucleotide type of the SNP1 locus and measure the resistance to Fusarium head blight of each sample to be tested. Experiments have proved that in a population composed of 108 wheat varieties, the disease index of the wheat varieties with the homozygous type of T at the SNP1 locus is significantly lower than that of the wheat varieties with the homozygous type of C at the SNP1 locus, indicating that the resistance to Fusarium head blight of the wheat varieties with the homozygous type of T at the SNP1 locus is significantly stronger than that of the wheat varieties with the homozygous type of C at the SNP1 locus. It shows that SNP1 is an SNP molecular marker related to the resistance to Fusarium head blight in wheat. The specific primer set provided by the present invention can be used for identifying or assisting in identifying the resistance to Fusarium head blight in wheat, can be used for screening wheat varieties resistant to Fusarium head blight, can be used for wheat molecular marker-assisted breeding, and can be used for the breeding and cultivation of wheat resistant to Fusarium head blight. The polymorphism of SNP1 is directly manifested in the form of DNA and can be detected in various tissues and at various developmental stages of wheat, which is beneficial for conveniently and quickly predicting the resistance to Fusarium head blight in wheat, can quickly screen out wheat varieties (germplasms) with strong resistance to Fusarium head blight, and thus accelerate the breeding process of new disease-resistant wheat varieties. In practical applications, in order to improve the accuracy, substances for detecting the polymorphism and genotype of the SNP1 locus can be combined with other substances (such as substances for detecting other single nucleotide polymorphisms or genotypes related to the resistance to Fusarium head blight in wheat) to prepare products for identifying wheat varieties resistant to Fusarium head blight. The present invention has important theoretical significance and economic value for using molecular marker-assisted selection of disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 shows the genotyping results of 108 wheat varieties with KASP markers in Example 1 of the present invention QFHBR.haas-2D Among them, the genotype TT is marked blue, which is an excellent allele; the genotype CC is marked red, which is a non-excellent allele, and the genotype TC is marked black. Detailed implementation manners

[0026] The present invention will be further described in detail below in conjunction with the specific implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0027] In the following embodiments, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0028] In the following embodiments, unless otherwise specified, the experimental methods are all conventional methods. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0029] In the following embodiments, SPSS 11.5 statistical software is used to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0030] Sumai 3 in the following embodiments is a wheat variety bred by the Institute of Agricultural Sciences of the Lixiahe Region in Jiangsu. It has good resistance to Fusarium head blight. This material is recorded in the non-patent literature "Ren Lijuan, Zhang Xu, Zhou Miaoping, etc. Analysis of the major gene + polygene mixed model for resistance to Fusarium head blight in Sumai 3 [J]. Jiangsu Journal of Agricultural Sciences, 2008, 24(06): 774-779.", and the public can obtain it from the applicant.

[0031] In the following examples, the synthetic wheat PS5 / V975 is a moderately scab-susceptible material introduced from Russia. It is a wheat obtained by artificial hybridization with Persian wheat PS5 as the female parent and Aegilops tauschii V975 as the male parent. Among them, V975 is recorded in the non-patent literature "Martin, S., Morrison III, W. & Akin, D. Fermentation of Maize Bran, Oat Bran, and Wheat Bran by Bacteroides ovatus V975. Curr Microbiol 36, 90–95 (1998). https: / / doi.org / 10.1007 / s002849900285", and PS5 is recorded in the non-patent literature "Zhu Z, Zhou R, Kong X, Dong Y, Jia J. Microsatellite markers linked to 2 powdery mildew resistance genes introgressed from Triticum carthlicum accession PS5 into common wheat. Genome. 2005 Aug;48(4):585-90. doi: 10.1139 / g05-016. PMID: 16094424.", and the public can obtain it from the applicant.

[0032] Using PS5 / V975 as the female parent and Sumai 3 as the male parent to construct an RIL population, the PS5 / V975 / / Sumai 3 RIL population is obtained. This population is recorded in the non-patent literature "Zhu Zhanwang. Discovery of Fusarium head blight resistance genes QTL and development of their KASP markers by using genome-wide linkage analysis and association analysis [D]. Chinese Academy of Agricultural Sciences, 2020. DOI: 10.27630 / d.cnki.gznky.2020.000236.", and the public can obtain it from the applicant.

[0033] The Fusarium graminearum in the following examples has been disclosed in the literature "Xu Lingling. (2022). Research progress on wheat scab and Fusarium graminearum. South China Agriculture (16), 32-35. doi: 10.19415 / j.cnki.1673-890x.2022.16.011.", and the public can obtain it from the applicant.

[0034] Example 1 Discovery of Fusarium head blight resistance gene QTL and acquisition of its KASP markers I. Obtaining phenotypes The 215 families of the Sumai 3 RIL population and their parents were planted at the experimental sites in Harbin, Heilongjiang and Gongzhuling, Heilongjiang from 2018 to 2019 and from 2021 to 2022. A completely randomized block design was used with 2 replicates. The single-row plots had a row spacing of 0.4 m and a row length of 1.0 m. 50 seeds were evenly dibbled in each row. Field management was carried out according to local practices.

[0035] Inoculation was carried out by the method of single-flower drip irrigation in the field: during the flowering stage of wheat, 10 μl of the prepared Fusarium graminearum spore suspension (1 μl containing 100 conidia) was injected into the 5th spikelet from top to bottom of each spike. 10 spikes of each line were inoculated, and after inoculation, atomized moisture was maintained for 3 d. At 21 d after inoculation, the number of diseased spikes, the number of spikelets per spike, and the number of diseased spikelets were investigated.

[0036] Fusarium head blight index (FHB index) = incidence × severity / 100 Among them, the incidence was the ratio of the number of diseased spikes to the total number of spikes, and the severity was the average value of the ratio of the number of diseased spikelets per spike to the number of spikelets, both expressed as a percentage (Reference: STACK R W, MCMULLEN M P, 1994. A visual scale to estimate severity of Fusarium head blight in Wheat. North Dakota State University Extension Service: 1095.).

[0037] The genomic DNA of the young leaves of 215 families was extracted by the modified CTAB method. The DNA concentration was measured with a NanoDrop2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / μl. Then, the DNA quality was detected by 0.8% agarose gel, and the DNA with qualified quality was subjected to SNP genotyping. SNP analysis was carried out using a 50K SNP chip from Affymetrix Axiom.

[0038] II. Linkage map construction The 50K SNP chip contained a total of 54,680 markers, and 11,489 markers were different between the parents. After removing the markers with heterozygosity and a deletion rate greater than 10% between the parents, 9,863 markers remained. After using the IciMapping 4.1 bin function to remove redundant markers, a high-density genetic map was constructed, which contained 1,158 markers.

[0039] III. QTL analysis QTL analysis was performed using the IciMapping 4.1 ICIM-ADD method with an LOD value of 3.0, and a new stable Fusarium head blight resistance QTL was mapped on chromosome 2D, named QFHBR.haas-2D , which was tightly linked to AX-109975392 (450.0 Mb) and could explain 6.24 - 6.86% of the phenotypic variation. There was a SNP locus in the flanking marker sites of the wheat Fusarium head blight resistance QTL QFHBR.haas-2D , called SNP1. SNP1 corresponded to the 36th position of SEQ ID No.1, and its nucleotide was either T or C, represented by the letter Y. One allele genotype of this SNP locus was TT (i.e., the homozygous type with the 36th nucleotide of SEQ ID No.1 being T); the other allele genotype was CC (i.e., the homozygous type with the 36th nucleotide of SEQ ID No.1 being C); the third allele genotype was TC (i.e., the heterozygous type with the 36th nucleotide of SEQ ID No.1 being T and C) 。

[0040] SEQ ID No.1: AACAACCTCTTCAGTGGGACCCGTCTTCTTGCTCTYCGTCAACAGAATAGGTTGGGAGTTCAGCATGCCGC Principle of KASP: Three primers are required for amplification, two forward competitive primers (the 5'-ends of the primers have base sequences complementary to the fluorescent groups HEX and FTM, and the other sequences only differ at the SNP and InGel at the 3'-ends) and one reverse common primer; the PGR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (MTsAer Mix is provided by LGG Company). Therefore, the forward primer can specifically bind to the GNT with the same genotype as it. The two forward primers can emit two different colors of light. If the site on the template strand is homozygous, a single, matching fluorescence is emitted. If it is heterozygous, two fluorescences can be emitted simultaneously.

[0041] According to the principle of KASP, KASP primers were designed for SNP1 at the flanking marker of the wheat Fusarium head blight resistance QAL QFHBR.haas-2D , and this molecular marker was called KASP_2D_FHBR. The primer sequences are shown in Table 1.

[0042] Table 1 KASP primer sequence table for detecting Fusarium head blight resistance QAL QFHBR.haas-2D

[0043] The single-stranded DNA molecules shown in SEQ IG No.2 and SEQ IG No.4 amplify the fragment of SEQ IG No.1 with the 36th nucleotide being C. The fluorescence signal of the fluorophore bound to the FTM sequence can be read using a microplate reader or a real-time fluorescence PGR instrument. The single-stranded DNA molecules shown in SEQ IG No.3 and SEQ IG No.4 amplify the fragment of SEQ IG No.1 with the 36th nucleotide being T. The fluorescence signal of the fluorophore bound to the HEX sequence can be read using a microplate reader or a real-time fluorescence PGR instrument.

[0044] For the KASP marker PGR amplification system, each 4 μl reaction system is as follows: 0.048 μl Primer Mix, 2.0 μl MTsAer Mix, 1.952 μl AemplTAe GNT (50 nG / μl). MTsAer Mix is purchased from LGG Company. The ratio of Primer Mix is: 12% HEX primer (upstream primer 2), 12% FTM primer (upstream primer 1), 30% Gommon primer (downstream primer). The primers are synthesized by Shanghai Sangon Biotech Co., Ltd. Amplification is carried out using a 384-well PGR instrument (AIO-RTG, S1000AMAhermTlGyGler).

[0045] The amplification program is as follows: 94°C for 15 min; 94°C for 20 s, 63 - 55°C for 1 min (decreasing 1°C per cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 32 cycles.

[0046] The PGR amplification products are placed in an automatic focusing fluorescence multifunctional microplate reader (PHERTsATrplus SNP, AMGLTAAEGH) to read the final fluorescence data, and then the data is imported into KlusAerGTller v3.4 software (LGG, HoGGesGon, UK) for genotyping.

[0047] IV. Utilization of primer pairs The experimental materials are 108 wheat varieties, as shown in Table 3 specifically.

[0048] Each experimental material was planted at the experimental site in Xinxiang, Henan in the 2018 - 2019 and 2021 - 2022 growing seasons. A completely randomized block design was adopted, with 2 replicates, single-row plots, row spacing of 0.4 m, row length of 1.0 m, and 50 seeds sown evenly in each row. Field management was carried out according to local practices. Inoculation was carried out by single-flower drip method in the field. The inoculation method and phenotype identification method were the same as those in the first part.

[0049] All experimental materials were detected using the primer sequences in Table 1 above and the KASP marker PGR amplification system and amplification program.

[0050] The results are shown in Table 2 and Figure 1 : Table 2 Genotype detection results and disease index of 108 wheat varieties

[0051] Among the 108 wheat varieties, 51 varieties showed the same genotype TT as Sumai 3, and the average Fusarium head blight disease index was 41.6. 55 varieties showed the same genotype CC as PS5 / V975, and the average Fusarium head blight disease index was 49.6; 2 varieties showed the genotype TC. Statistical tests showed that QFHBR.haas-2D the gene effects reached significant differences ( P < 0.05). The Fusarium head blight disease index of wheat varieties with the SNP1 genotype TT was significantly lower than that of wheat varieties with the SNP1 genotype CC, indicating that the Fusarium head blight resistance of wheat with the SNP1 genotype TT (excellent allele) was significantly stronger than that of wheat with the SNP1 genotype CC (non-excellent allele).

[0052] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made by conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. Use of a composition for detecting the polymorphism or genotype of SNP1 locus in wheat genome in identifying or assisting in identifying wheat scab resistance; characterized in that: The SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains PCR primers, and the PCR primers are P1 or P2: P1. The PCR primer is a primer group composed of a single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence from the 22nd to 41st positions of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.4; P2. The PCR primer is a primer group composed of a single-stranded DNA with a nucleotide sequence of SEQ ID No.2, a single-stranded DNA with a nucleotide sequence of SEQ ID No.3, and a single-stranded DNA with a nucleotide sequence of SEQ ID No.

4.

2. Use of a composition for detecting the polymorphism or genotype of SNP1 locus in wheat genome in the preparation of a product for identifying or assisting in identifying wheat scab resistance; characterized in that: The SNP1 is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains PCR primers, and the PCR primers are P1 or P2 as claimed in claim 1.

3. Use of a composition for detecting the polymorphism or genotype of SNP1 locus in wheat genome in wheat breeding or in the preparation of wheat breeding products, characterized in that: The SNP1 is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the composition contains PCR primers, and the PCR primers are P1 or P2 as claimed in claim 1.

4. A method for identifying or assisting in the identification of wheat scab resistance, including detecting the genotype of the wheat to be tested, and identifying or assisting in the identification of wheat scab resistance according to the genotype of the wheat to be tested; characterized in that: The genotype is the genotype of the SNP1 locus in the wheat genome; the SNP1 locus is a SNP locus in the wheat genome, and its nucleotide type is T or C, which is the 36th nucleotide of SEQ ID No.1; the detection is carried out using PCR primers, and the PCR primers are P1 or P2 as claimed in claim 1.

5. Use of the method according to claim 4 in wheat breeding.

6. A method for wheat breeding, characterized in that: The method includes: detecting the polymorphism of SNP1 as claimed in claim 1 in the wheat genome, and selecting homozygous wheat with the SNP1 locus being A in the wheat genome as a parent for breeding.

7. A product containing a composition for detecting the polymorphism or genotype of the SNP1 locus as claimed in claim 1 in the wheat genome, which is any one of the products in 1)-3): 1) A product for detecting single nucleotide polymorphisms or genotypes related to wheat scab resistance; 2) A product for identifying or assisting in identifying wheat scab resistance; 3) A product for wheat breeding.

8. The application according to any one of claims 1 - 3 and 5, the method according to claim 4 or 6, or the product according to claim 7, characterized in that: The wheat breeding is to breed wheat resistant to scab.

9. The application according to any one of claims 1-3, 5 and 8, the method according to claim 4, 6 or 8, or the product according to claim 7 or 8, characterized in that: The composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome is any one of the following D1), D2) or D3): D1. The composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome contains PCR primers for amplifying a wheat genomic DNA fragment including the SNP1 locus; D2. The composition for detecting the polymorphism or genotype of the SNP1 locus in the wheat genome is a PCR reagent containing the PCR primers; D3. A kit containing the PCR primers as described in D1) or the PCR reagent as described in D2).

10. The application, method or product according to claim 9, characterized in that: The PCR primer is a primer group composed of the single-stranded DNA shown in SEQ ID No.1 in the sequence listing, the single-stranded DNA shown in SEQ ID No.2 in the sequence listing, and the single-stranded DNA shown in SEQ ID No.3 in the sequence listing.