KASP molecular marker related to bitter gourd fruit weight character and application of KASP molecular marker

By developing KASP molecular markers and their amplification primers on chromosome 8 of the bitter melon genome, the problem of high-throughput rapid identification and screening of weight traits of bitter melon fruits was solved, and high-effect real-weight detection and breeding support in the seedling stage was achieved.

CN120290775AActive Publication Date: 2025-07-11INST OF VEGETABLES GUANGDONG PROV ACAD OF AGRI SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510531233.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-07-11
Estimated Expiration
2045-04-25

AI Technical Summary

Technical Problem

The lack of KASP molecular markers closely linked to the weight traits of bitter melon fruits in the prior art makes it difficult to achieve high-throughput rapid identification and screening of bitter melon fruits.

Method used

A KASP molecular marker and its amplification primer located at position 27048107 of chromosome 8 of the bitter gourd genome were developed. Through PCR amplification and genotyping, the weight of bitter gourd fruit was detected using the SNP site of base T or C, and fluorescent primers of HEX and FAM tags were designed for efficient detection.

Benefits of technology

It realizes high-throughput, rapid and accurate identification and screening of the weight of bitter gourd fruit during the seedling stage, supports bitter gourd molecular breeding, and improves the screening efficiency of fruit weight traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290775A_ABST
    Figure CN120290775A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker related to bitter gourd fruit weight traits and application of the KASP molecular marker, the KASP molecular marker is located at the 27048107 site of a No. 8 chromosome of a bitter gourd genome, and the basic group at the site is T or C. It is found that the KASP molecular marker is related to the bitter gourd fruit weight character, by means of the KASP molecular marker and an amplification primer of the KASP molecular marker, high-throughput, rapid and accurate identification of the bitter gourd fruit weight type and screening of bitter gourd germplasm resources with different fruit weights can be achieved in the seedling stage, effective technical support is provided for bitter gourd molecular breeding, and important application value is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of crop genetic breeding. Specifically, the present invention relates to a KASP molecular marker closely linked to the major QTL locus of bitter gourd fruit weight and its application. Background Art

[0002] Bitter gourd is a vegetable crop with medicinal value, widely cultivated in China, India, Malaysia, Africa and South America. It is rich in bioactive substances such as vitamins, minerals, saponins and flavonoids, and has functions such as antioxidant, hypoglycemic and hypolipidemic effects. Bitter gourd fruit is the main edible organ, and the single fruit weight varies greatly. The single fruit weight of light-fruited bitter gourd is only about 10 g, while the single fruit weight of heavy-fruited bitter gourd can reach more than 600 g, which is more than 60 times that of light-fruited bitter gourd.

[0003] Fruit weight is the main factor contributing to the yield of bitter gourd, one of the important breeding target traits, and also an important economic trait. At present, researchers have detected 16 fruit weight QTLs using different parental materials, and their genetic contributions vary. Only 3 QTLs exceed 20%. There is no report on the KASP molecular marker closely linked to the major QTL of fruit weight.

[0004] Therefore, the development of a KASP molecular marker closely linked to the bitter gourd fruit weight trait has important guiding significance for bitter gourd molecular marker-assisted breeding, helps to achieve high-throughput and rapid identification and screening of materials with target bitter gourd fruit weight at the seedling stage, and has important application value. Summary of the Invention

[0005] Based on this, the purpose of the present invention is to provide a KASP molecular marker related to the bitter gourd fruit weight trait and its application; the KASP molecular marker of the present invention can accurately detect the bitter gourd fruit weight to be measured and screen bitter gourd germplasm resources with different fruit weights.

[0006] The specific technical solutions for achieving the above invention purposes are as follows.

[0007] In the first aspect of the present invention, there is provided an application of a KASP molecular marker related to the bitter gourd fruit weight trait in detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights, wherein the KASP molecular marker is located at position 27048107 of chromosome 8 of the bitter gourd genome, and the base is T or C at this position.

[0008] In the second aspect of the present invention, there is provided an amplification primer for a KASP molecular marker related to the bitter gourd fruit weight trait, including an upstream primer F1 with a sequence as shown in SEQ ID NO:1, an upstream primer F2 with a sequence as shown in SEQ ID NO:2, and a downstream primer R with a sequence as shown in SEQ ID NO:3.

[0009] In the third aspect of the present invention, there is provided an application of amplification primers of KASP molecular markers related to the bitter gourd fruit weight trait in detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights.

[0010] In the fourth aspect of the present invention, there is provided a kit for detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights, including the above-mentioned amplification primers of KASP molecular markers related to the bitter gourd fruit weight trait.

[0011] In the fifth aspect of the present invention, there is provided a method for detecting the bitter gourd fruit weight trait, including the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0012] In the sixth aspect of the present invention, there is provided a method for screening bitter gourd germplasm resources with different fruit weights, including the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers. When the genotype is CC, the bitter gourd to be tested is a heavy-fruit bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruit bitter gourd variety.

[0013] In the present invention, an F2 segregation population is created from bitter gourd resources with heavy fruits and bitter gourd resources with light fruits. Pooled sequencing is performed on 20 plants with extreme phenotypes in the F2 population, and the difference Δ(SNP-index) in the SNP-index of the two offspring pools is calculated. The bitter gourd fruit weight QTL is located within an interval of approximately 1.9 Mb (99% confidence level) on chromosome 8; KASP markers are designed at both ends and inside this interval, and the F2 population is expanded for genotyping. Combining with the phenotypic data, it is located within an interval of approximately 274.3 kb; based on the whole-genome resequencing of the F2 parents, SNP variation sites within this mapped interval are searched. A SNP site variation T / C is found at position 27048107 on chromosome 8 of the bitter gourd, and the base T is closely linked to the light-fruit trait, while the base C is closely linked to the heavy-fruit trait. Therefore, this SNP site is a KASP molecular marker related to the bitter gourd fruit weight trait. Using this KASP molecular marker and its amplification primers, it is possible to achieve high-throughput, rapid, and accurate identification of the bitter gourd fruit weight type at the seedling stage, screen bitter gourd germplasm resources with different fruit weights, and provide effective technical support for bitter gourd molecular breeding, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the F2 fruit weight frequency distribution diagram in Example 1 of the present invention.

[0015] Figure 2 It is the distribution diagram of two offspring Δ(SNP-index) on the chromosome in Example 1 of the present invention.

[0016] Figure 3 This is the linkage analysis result of the weight of bitter gourd fruits in Example 1 of the present invention.

[0017] Figure 4 This is the genotyping result of 168 F2 single plants and the genotyping result of 203 natural populations in Example 2 of the present invention. Detailed implementation manners

[0018] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0019] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0020] If not otherwise specified, the embodiments are all carried out under conventional experimental conditions, such as those in the molecular cloning experimental manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2013), or according to the conditions recommended by the manufacturer's instructions.

[0021] In some embodiments of the present invention, the application of a KASP molecular marker related to the bitter gourd fruit weight trait in detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights is disclosed. The KASP molecular marker is located at position 27048107 on chromosome 8 of the bitter gourd genome, and the base at this position is T or C.

[0022] In other embodiments of the present invention, amplification primers for a KASP molecular marker related to the bitter gourd fruit weight trait are disclosed, including an upstream primer F1 with a sequence as shown in SEQ ID NO: 1, an upstream primer F2 with a sequence as shown in SEQ ID NO: 2, and a downstream primer R with a sequence as shown in SEQ ID NO: 3.

[0023] In some of these embodiments, the 5' end of the upstream primer F1 is modified with a HEX group, and the 5' end of the upstream primer F2 is modified with a FAM group.

[0024] In some other embodiments of the present invention, there is disclosed the application of the amplification primers of the KASP molecular marker related to the bitter gourd fruit weight trait in detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights.

[0025] In some other embodiments of the present invention, there is disclosed the application of the amplification primers of the KASP molecular marker related to the bitter gourd fruit weight trait in the assistant breeding of bitter gourd varieties with different fruit weights.

[0026] In some other embodiments of the present invention, there is disclosed the application of the amplification primers of the KASP molecular marker related to the bitter gourd fruit weight trait in the preparation of a kit for detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights.

[0027] In some other embodiments of the present invention, there is disclosed a kit for detecting the bitter gourd fruit weight trait or screening bitter gourd germplasm resources with different fruit weights, including the above-mentioned amplification primers of the KASP molecular marker related to the bitter gourd fruit weight trait.

[0028] In some other embodiments of the present invention, there is disclosed a method for detecting the bitter gourd fruit weight trait, including the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, and then analyzing the genotyping data.

[0029] In some of these embodiments, the analysis of the genotyping data includes the following steps: when the genotype is CC, the bitter gourd to be tested is a heavy-fruit bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruit bitter gourd variety.

[0030] In some other embodiments of the present invention, there is disclosed a method for screening bitter gourd germplasm resources with different fruit weights, including the following steps: using the DNA of the bitter gourd to be tested as a template, performing PCR amplification with the above-mentioned amplification primers, when the genotype is CC, the bitter gourd to be tested is a heavy-fruit bitter gourd variety; when the genotype is TT or TC, the bitter gourd to be tested is a light-fruit bitter gourd variety.

[0031] In some of these embodiments, the reaction system of the PCR amplification includes: 2xKASP master mix 2.5 ± 0.1 μL, 8 μM - 10 μM upstream primer F1 0.075 ± 0.01 μL, 8 μM - 12 μM upstream primer F2 0.075 ± 0.01 μL, 10 μM downstream primer R 0.2 ± 0.05 μL, DNA template 10 ng - 100 ng, and ddH2O is added to 5 μL.

[0032] In some of these embodiments, the reaction program of the PCR amplification is: 94°C, 15 min; 94°C, 20 s, 65 - 57°C, 1 min, 10 cycles; 94°C, 20 s, 57°C, 1 min, 30 cycles.

[0033] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0034] Example 1 Development of KASP Molecular Markers Closely Linked to QTL for Fruit Weight Traits in Momordica charantia

[0035] It includes the following steps:

[0036] 1. Use K13-1-1 (heavy fruits, average single fruit weight 579.9 g, advanced inbred line, preserved in the applicant's laboratory) and 22MB4 (light fruits, average single fruit weight 132.7 g, advanced inbred line purified from resources introduced from Vietnam, preserved in the applicant's laboratory) as parents to construct F2. The frequency distribution of its fruit weight is as Figure 1 shown. It can be seen from Figure 1 that the fruit weight shows a skewed distribution, indicating that the light fruit weight is dominant.

[0037] 2. Pooled sequencing was performed on 20 plants with extreme phenotypes in the F2 population, and the difference Δ(SNP-index) in SNP-index of the two offspring pools was calculated. The distribution of the two offspring Δ(SNP-index) on the chromosome is as Figure 2 shown. Select 1 Mb as the window and 1 kb as the step size, calculate the average value of Δ(SNP-index) in each window to reflect the distribution of Δ(SNP-index), and locate the QTL for Momordica charantia fruit weight within the interval of about 1.9 Mb (99% confidence level) on chromosome 8.

[0038] 3. Design KASP markers at both ends and inside this interval, expand the F2 population for genotyping, and combine the phenotypic data to locate it within an interval of about 274.3 kb. The results of linkage analysis are as Figure 3 shown, and its contribution rate is 44.3%.

[0039] 4. According to the F2 parents, whole-genome resequencing (Bitter gourd(OHB3-1)v2 Genome) was performed to search for SNP variation sites within this mapped interval. A SNP site variation T / C was found at position 27048107.

[0040] 5. According to the sequences of 300 bp upstream and downstream of the above SNP locus, use the primer premier 5.0 software to design amplification primers for KASP markers: including forward primer F1, forward primer F2, and reverse primer R. The ends of the two forward primers are allelic variant bases T / C. The 5'-ends of the forward primers are connected with fluorescent tag sequences A and B. Among them, the 5'-end of F1 is the fluorescent tag sequence A (5'-GAAGGTGACCAAGTTCATGCT-3') connected with the HEX group, and the 5'-end of F2 is the fluorescent tag sequence B (5'-GAAGGTCGGAGTCAACGGATT-3’) connected with the FAM group. The primer sequences are as follows:

[0041] F1 (SEQ ID NO:1):

[0042] GAAGGTGACCAAGTTCATGCTCACCCGACGGTTACAAAAATAG C

[0043] F2 (SEQ ID NO:2):

[0044] GAAGGTCGGAGTCAACGGATTCACCCGACGGTTACAAAAATAG T

[0045] R (SEQ ID NO:3): TCGATAATTACACGCTAGCGAGAA

[0046] Example 2 Verification of the KASP molecular marker in Example 1

[0047] Take the young leaves of the F2 population sample, obtain the genomic DNA of bitter gourd by the CTAB extraction method, and perform PCR amplification using the primer set in Example 1. The PCR reaction system is 5 μL, which contains 2.5 μL of 2×KASP master mix, 0.075 μL of forward primer F1 (10 μM), and 0.075 μL of forward primer F2 (10 μM). ,Reverse primer R (10 μM) 0.2 μL, DNA (10 ng - 100 ng) 1 μL, ddH2O 3.3 μL. The PCR reaction program is as follows: 94°C for 15 min; 94°C for 20 s, 65°C - 57°C (Touch down) for 1 min, 10 cycles; 94°C for 20 s, 57°C for 1 min, 30 cycles. The fluorescence signal is read using a TECAN infinite M1000 microplate reader, and the fluorescence signal is analyzed and converted using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping map. Among them, the samples aggregated on the X-axis are homozygous A genotypes (fluorescent tag sequence A, orange), and the corresponding base sequence is CC; the samples aggregated on the Y-axis are homozygous B genotypes (fluorescent tag sequence B, blue), and the corresponding base sequence is TT; the samples aggregated in the middle are heterozygous H genotypes (green), and the corresponding base sequence is CT.

[0048] The detection results of 168 F2 individual plants are shown in Figure 4 A in. It can be seen from the figure that there are three genotypes A, B, and H in the F2 population, A:B:H = 42 plants:46 plants:80 plants. Combining the phenotypic and genotypic analysis of the tested materials, it was found that among the 168 individual plants in the F2 population, the average fruit weight of the A genotype was 273.5 g, the average fruit weight of the B genotype was 108.0 g, the average fruit weight of the H genotype was 165.9 g, and the p-value was 4.0E-20 < 0.01, indicating a highly significant difference.

[0049] Therefore, for this SNP variation site discovered in the present invention, the base T is closely linked to the light fruit trait, and the base C is closely linked to the heavy fruit trait. This KASP molecular marker can be used to detect the fruit weight trait of bitter gourd, and the primer pair designed for this site can be used to effectively detect the target bitter gourd fruit weight.

[0050] The molecular marker was further used to detect 203 natural population materials, and the results are shown in Figure 4 B in. It can be seen from the figure that A:B:H = 168 plants:25 plants:10 plants. Combining the phenotypic and genotypic analysis of the tested materials, it was found that the average fruit weight of the A genotype was 396.1 g, the average fruit weight of the B genotype was 278.3 g, the average fruit weight of the H genotype was 210.1 g, and the p-value was 4.4E-11 < 0.01, indicating a highly significant difference.

[0051] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.

[0052] The above-described embodiments merely represent several implementation manners of the present invention. The description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. Application of a KASP molecular marker related to the fruit weight trait of Momordica charantia in detecting the fruit weight trait of Momordica charantia or screening germplasm resources of Momordica charantia with different fruit weights. The KASP molecular marker is located at position 27048107 on chromosome 8 of the Momordica charantia genome, and the base at this position is T or C.

2. An amplification primer for a KASP molecular marker related to the fruit weight trait of Momordica charantia, characterized in that, It includes the upstream primer F1 with the sequence shown in SEQ ID NO:1, the upstream primer F2 with the sequence shown in SEQ ID NO:2, and the downstream primer R with the sequence shown in SEQ ID NO:

3.

3. The amplification primer of the KASP molecular marker related to the bitter gourd fruit weight trait according to claim 2, characterized in that The 5' end of the upstream primer F1 is modified with a HEX group, and the 5' end of the upstream primer F2 is modified with a FAM group.

4. Application of the amplification primer of the KASP molecular marker related to the fruit weight trait of Momordica charantia according to claim 2 or 3 in detecting the fruit weight trait of Momordica charantia or screening germplasm resources of Momordica charantia with different fruit weights.

5. Application of the amplification primer of the KASP molecular marker related to the fruit weight trait of Momordica charantia according to claim 2 or 3 in preparing a kit for detecting the fruit weight trait of Momordica charantia or screening germplasm resources of Momordica charantia with different fruit weights.

6. A kit for detecting the weight of bitter gourd fruits or screening bitter gourd germplasm resources with different fruit weights, characterized in that, It includes the amplification primer of the KASP molecular marker related to the fruit weight trait of Momordica charantia according to claim 2 or 3.

7. A method for detecting the weight trait of bitter gourd fruits, characterized in that, It includes the following steps: Using the DNA of the Momordica charantia to be tested as a template, performing PCR amplification with the amplification primer according to claim 2 or 3, and then analyzing the genotyping data.

8. The method for detecting the weight trait of bitter gourd fruits according to claim 7, characterized in that, The analysis of the genotyping data includes the following steps: when the genotype is CC, the Momordica charantia to be tested is a heavy-fruit Momordica charantia variety; when the genotype is TT or TC, the Momordica charantia to be tested is a light-fruit Momordica charantia variety.

9. A method for screening bitter gourd germplasm resources with different fruit weights, characterized in that, It includes the following steps: Using the DNA of the Momordica charantia to be tested as a template, performing PCR amplification with the amplification primer according to claim 2 or 3. When the genotype is CC, the Momordica charantia to be tested is a heavy-fruit Momordica charantia variety; when the genotype is TT or TC, the Momordica charantia to be tested is a light-fruit Momordica charantia variety.

10. The method according to any one of claims 7 to 9, characterized in that The reaction system of the PCR amplification includes: 2xKASP mastermix 2.5 ± 0.1 μL, 8 μM - 10 μM upstream primer F1 0.075 ± 0.01 μL, 8 μM - 12 μM upstream primer F2 0.075 ± 0.01 μL, 10 μM downstream primer R 0.2 ± 0.05 μL, DNA template 10 ng - 100 ng, ddH2O added to 5 μL; The reaction program of the PCR amplification is: 94 °C, 15 min; 94 °C, 20 s, 65 - 57 °C, 1 min, 10 cycles; 94 °C, 20 s, 57 °C, 1 min, 30 cycles.

Citation Information

Patent Citations

  • Cultivation method of new variety of local characteristic Feiyue series bitter gourds

    CN111713349A

  • KASP marker for detecting fruit tumor character of bitter gourd and application of KASP marker

    CN112852994A

  • Molecular marker associated with form of bitter gourd peel and application of molecular marker

    CN114457185A

  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with all-female character of bitter gourd and application of SNP molecular marker

    CN115058538A