Primer combination, kit and method for detecting invasive species pistia stratiotes in water by utilizing multiple PCR (Polymerase Chain Reaction)
By designing a specific multiple PCR primer combination and optimizing the PCR reaction system, the problem of detecting large azalea DNA in water in complex environments is solved, and the detection effect of high sensitivity and specificity is achieved, which is suitable for the rapid and accurate detection of large azalea in water.
Patent Information
- Application Number
- CN202510641867.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to detect DNA from invasive species in water quickly and accurately in complex environments, especially in a multi-species context, it is difficult to specifically amplify DNA from saccharides.
Design a highly specific multiplicity PCR primer combination (PS_7, PS_8, PS_9, PS_10 primer pair) and an optimized PCR reaction system, combined with filter membrane extraction and electrophoresis detection methods to achieve high sensitivity and specific amplification of large DNA.
The ability to detect large sac DNA quickly and accurately under complex backgrounds improves the sensitivity and specificity of the detection, saves time and cost, and is suitable for the detection of low-concentration target species.
Smart Images

Figure CN120290781A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a primer combination, a kit and a method for detecting the invasive species Pistia stratiotes in water by using multiplex PCR. Background Art
[0002] Pistia stratiotes L. belongs to the Angiospermae, Magnoliopsida, Alismatales, Araceae, Pistia, and is a perennial aquatic floating herb. Pistia stratiotes is native to small rivers or freshwater lakes in the tropics and subtropics, and is distributed in Southeast Asia, South Asia, South America and Africa. It was initially introduced from Brazil and there are many wild ones in the Pearl River Delta of China. Later, it gradually spread from the Pearl River Basin to the Yangtze River Basin and is distributed in Hunan, Hubei, Sichuan, Fujian, Jiangsu, Zhejiang, Anhui and other places. Pistia stratiotes grows fast and reproduces rapidly, with strong adaptability. Without natural enemy control, it can cover the entire still water area. The allelochemicals secreted during its growth make the native aquatic plants lacking immunity lose their competitiveness. Affected by many factors, Pistia stratiotes grows rapidly in the fresh water channels and reservoir basins in southern China, inhibits and excludes the reproduction of local aquatic organisms, thus forming a monopolar dominant community, posing a serious threat to the local ecosystem security and causing immeasurable economic losses. It is reported that Pistia stratiotes has become a disaster in Yunnan, Guangxi, Guizhou, Fujian, Anhui and other places, with a wide range of disasters and a deep degree of disaster. On January 1, 2023, in accordance with the "Biological Safety Law of the People's Republic of China", the Ministry of Agriculture and Rural Affairs, in conjunction with relevant departments such as the Ministry of Natural Resources and the Ministry of Ecology and Environment, included Pistia stratiotes in the list of key managed alien invasive species. Therefore, in order to monitor the distribution and invasion range of the invasive species Pistia stratiotes, a method for quickly and accurately identifying Pistia stratiotes needs to be established.
[0003] Environmental DNA refers to the DNA directly obtained from environmental samples, including the DNA released by animals, plants and microorganisms in the environment such as air, soil and water. Environmental DNA technology refers to a method of directly extracting target gene fragments from environmental samples and then using various molecular techniques for qualitative or quantitative analysis. Using environmental DNA technology can effectively detect cryptic species in water, such as invasive species in the initial invasion stage with less biomass, and improve the accuracy of survey results. However, the difficulty lies in the complex environment of environmental samples with large interference, and it is very difficult to identify the target species in the background of multi-species DNA or even multi-close-species DNA.
[0004] Currently, there is no technology for detecting Pistia stratiotes DNA in water by using PCR technology. The present invention has established a new, highly sensitive and specific multi-locus detection method for the invasive species Pistia stratiotes. Summary of the Invention
[0005] Aiming at the deficiencies of the prior art, one of the purposes of the present invention is to provide a primer combination for detecting the invasive species Pistia stratiotes in water by multiplex PCR, which can specifically amplify the DNA of Pistia stratiotes under complex backgrounds.
[0006] Specifically, the primer combination is: PS_7 primer pair, PS_8 primer pair, PS_9 primer pair, PS_10 primer pair. Among them:
[0007] The nucleotide sequence of the PS_7 primer pair is:
[0008] PS_7_L: CCCAGGTCAGTTTGTAGTCTAA (SEQ ID NO: 1);
[0009] PS_7_R: TCCAGGGCATATGATAGTTCG (SEQ ID NO: 2);
[0010] The nucleotide sequence of the PS_8 primer pair is:
[0011] PS_8_L: TGTCGCCTCCCAAAAAGGTT (SEQ ID NO: 3);
[0012] PS_8_R: AGACCACGACTGATCCTGAA (SEQ ID NO: 4);
[0013] The nucleotide sequence of the PS_9 primer pair is:
[0014] PS_9_L: TGTCGCCTCCCAAAAAGGTT (SEQ ID NO: 5);
[0015] PS_9_R: AAGACCACGACTGATCCTGA (SEQ ID NO: 6);
[0016] The nucleotide sequence of the PS_10 primer pair is:
[0017] PS_10_L: TTGTCGCCTCCCAAAAAGGT (SEQ ID NO: 7);
[0018] PS_10_R: AGACCACGACTGATCCTGAA (SEQ ID NO: 8).
[0019] Another purpose of the present invention is to provide a kit including the above-mentioned primer combination for detecting the invasive species Pistia stratiotes in water by multiplex PCR.
[0020] Preferably, the kit for detecting the invasive species Pistia stratiotes in water by multiplex PCR further comprises 2×Multiplex PCR Master mix enzyme, BSA and sterile and enzyme-free water.
[0021] Preferably, the kit for detecting the invasive species Pistia stratiotes in water by multiplex PCR further comprises positive control DNA. The positive control DNA is Pistia stratiotes DNA and serves as a positive control.
[0022] The third object of the present invention is to provide a method for detecting the invasive species Pistia stratiotes in water by multiplex PCR, which is a rapid and accurate multi-priming detection method for Pistia stratiotes in the freshwater environment, and is a multiplex PCR detection method for Pistia stratiotes that can combine the optimized water sample DNA extraction technology with the multiplex PCR technology. This method can save time and cost, has high sensitivity, strong specificity, high efficiency, and low professional requirements. When the concentration of the target species is low, the detection rate is better, and it can be judged by the gel image.
[0023] Specifically, the method for detecting the invasive species Pistia stratiotes in water by multiplex PCR comprises the following steps:
[0024] S1. Water sample extraction: Filter the water sample to be tested using a filter membrane, and after suction filtration, place the filter membrane into a sterilized centrifuge tube;
[0025] S2. eDNA water sample extraction: Extract eDNA from the filter membrane after suction filtration using the CTAB method;
[0026] S3. Multiplex PCR amplification: Perform a multiplex PCR amplification reaction on the extracted eDNA using the above kit;
[0027] S4. Electrophoresis detection: Perform agarose gel electrophoresis on the amplification product, observe the bright band situation in the gel imager after electrophoresis, and judge the presence of Pistia stratiotes according to whether there is a bright band of the target fragment.
[0028] Preferably, in step S1, the filter membrane is a mixed cellulose membrane with a filtration diameter of 0.45 μm to fully intercept eDNA and reduce extraction loss.
[0029] Preferably, in step S3, the reaction system for multiplex PCR amplification is: 5 μL of 2×Multiplex PCR Master mix enzyme, 0.5 μL of BSA, 3 μL of DNA template, 0.1 μL of each of 4 pairs of upstream and downstream primers (20 μmol·L -1 ) and make up to 10 μL with sterile and enzyme-free water.
[0030] Preferably, in step S3, the reaction conditions for multiplex PCR amplification are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 90 s, extension at 72°C for 30 s, with 40 cycles of reaction; and finally extension at 68°C for 10 min.
[0031] The present invention has the following beneficial effects:
[0032] The present invention innovates the primer design method, screens out the dominant Pistia stratiotes multiplex PCR primers, and combines with the optimized PCR reaction system and conditions, which can detect Pistia stratiotes DNA in the background of multiple species, with strong specificity, high accuracy and high sensitivity. It solves the problems existing in environmental eDNA detection, can combine multiplex PCR primers with eDNA detection, realizes more accurate monitoring of the movement of Pistia stratiotes, accumulates data for the invasion of this species, and provides a new scientific method for monitoring invasive species and ecological protection. Description of the Drawings
[0033] Figure 1 : The electrophoresis result diagram of the single primer pair test in Example 3, which is the positive test and specificity test result diagram. The specificity test includes the closely related species Spirodela polyrhiza of Pistia stratiotes. In the figure, Marker: DNA Marker; P7, P8, P9, P10: The DNA is Pistia stratiotes DNA, and primers PS_7, PS_8, PS_9, PS_10 are used respectively; S7, S8, S9, S10: The DNA is Spirodela polyrhiza DNA, and primers PS_7, PS_8, PS_9, PS_10 are used respectively; blank (negative control): The DNA is replaced with sterile and enzyme-free water, and any pair of primers is used.
[0034] Figure 2 : The electrophoresis result diagram of the primer combination test in Example 3, mainly the test result diagram of Pistia stratiotes tissue samples. In the figure, Marker: DNA Marker; z7, z8, z9, z10: Primers PS_7, PS_8, PS_9, PS_10 are used respectively, and the DNA is Pistia stratiotes tissue sample DNA; zd1: The primer combination of PS_7, PS_8, PS_9, PS_10 is used, and the DNA is Pistia stratiotes tissue sample DNA. hd1: The primer combination of PS_7, PS_8, PS_9, PS_10 is used, and the DNA is the DNA of the water body where Pistia stratiotes is cultured.
[0035] Figure 3: Electrophoresis result diagram of primer combination test in Example 3, which is the test result diagram of water body for Pistia stratiotes cultivation. In the figure, Marker: DNA Marker; W1, W2, W3, W4, W5, W6 respectively represent the bands of multiplex PCR amplification products under different annealing temperatures (54°C, 54.2°C, 54.6°C, 55.1°C, 55.6°C, 56°C). The primer combination of PS_7, PS_8, PS_9, PS_10 is used, and the DNA of water body for Pistia stratiotes cultivation is used. The result shows that W6 has the best effect, which is 56°C.
[0036] Figure 4 : Electrophoresis result diagram of primer combination test in Example 3, which is the test result diagram of natural water body for Pistia stratiotes. In the figure, Marker: DNA Marker; 1 - 6: The primer combination of PS_7, PS_8, PS_9, PS_10 is used, and the DNA is the water samples from Zhejiang, Hunan, Guangdong, Dongting Lake, Chongqing, and Jiangsu regions respectively.
[0037] Figure 5 : Electrophoresis result diagram of sensitivity test in Example 4, which is the test result diagram of single primer. In the figure, Marker: DNA Marker; N1: DNA of original Pistia stratiotes tissue sample 大薸 309.1 ng / μl; N2: DNA 大薸 30.91 ng / μl; N3: DNA 大薸 3.091 ng / μl; N4: DNA 大薸 0.618 ng / μl; N5: DNA 大薸 0.123 ng / μl; N6: DNA 大薸 0.024 ng / μl. The lanes starting with 7, 8, 9, 10 in the figure use primers PS_7, PS_8, PS_9, PS_10 respectively.
[0038] Figure 6 : Electrophoresis result diagram of sensitivity test in Example 4, which is the test result diagram of primer combination. In the figure, Marker: DNA Marker; dn1: DNA of original Pistia stratiotes tissue sample 大薸 309.1 ng / μl; dn2: DNA 大薸 30.91 ng / μl; dn3: DNA 大薸 3.091 ng / μl; dn4: DNA 大薸 0.618 ng / μl; dn5: DNA 大薸 0.123 ng / μl; dn6: DNA 大薸 0.024 ng / μl. The primer combination of PS_7, PS_8, PS_9, PS_10 is used in the figure. Detailed implementation method
[0039] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.
[0040] Example 1: Primer Design
[0041] The present invention aims to design specific primers for amplifying and detecting the target fragment of Pistia stratiotes. Therefore, the obtained primers are required to specifically amplify only Pistia stratiotes and not produce amplification reactions for other species in the Araceae family. Currently, existing primer design software generally can only design primers based on one sequence, or does not consider the variation of the amplified sequence when designing primers, and the manual method cannot design primers for hundreds of species simultaneously. Therefore, we developed a kmer-based primer design method, and the specific steps are as follows:
[0042] 1) Download all the complete chloroplast genomes of the Araceae family from the NCBI public database (ncbi.nlm.nih.gov), a total of 123 sequences with a total sequence length of 21 Mbp.
[0043] 2) Use the sliding window algorithm to establish a kmer index containing all chloroplast genomes. The steps are to split all sequences into kmers with n = 18, and record the positions where each kmer exists in each sequence.
[0044] 3) Starting from the first kmer (K1) of the chloroplast genome of the target species (Pistia stratiotes), find all possible positions of the next kmer (K2), with the condition that the last n - 1 bases of K1 are the same as the first n - 1 bases of K2. Repeat this step to find all continuously identical intervals, record the interval positions and lengths until all target species sequences are covered once. At this time, record the number of repetitions of each interval in all species.
[0045] 4) Extract 85 unique intervals that only appear in Pistia stratiotes and have a length greater than 90 bp, and align them to all chloroplast genomes to confirm the uniqueness of the sequence intervals.
[0046] 5) Call the Primer3 local program to design amplification primers for the unique intervals. The primer screening parameters are: amplification fragment size, 90 bp - 300 bp; primer size, 18 bp - 22 bp; annealing temperature, 57 - 63 °C; GC content, 45 - 55, and other parameters are set according to the default settings of Primer3.
[0047] Finally, select 4 pairs of the best primers that meet the specificity and have the highest electrophoretic band brightness. Their sequences are: PS_7_L: CCCAGGTCAGTTTGTAGTCTAA (SEQ ID NO: 1);
[0048] PS_7_R: TCCAGGGCATATGATAGTTCG (SEQ ID NO: 2);
[0049] PS_8_L: TGTCGCCTCCCAAAAAGGTT (SEQ ID NO: 3);
[0050] PS_8_R: AGACCACGACTGATCCTGAA (SEQ ID NO: 4);
[0051] PS_9_L: TGTCGCCTCCCAAAAAGGTT (SEQ ID NO: 5);
[0052] PS_9_R: AAGACCACGACTGATCCTGA (SEQ ID NO: 6);
[0053] PS_10_L: TTGTCGCCTCCCAAAAAGGT (SEQ ID NO: 7);
[0054] PS_10_R: AGACCACGACTGATCCTGAA (SEQ ID NO: 8).
[0055] Example 2: Establishment of multiplex PCR method
[0056] This example provides a method for detecting the invasive species Pistia stratiotes in water using multiplex PCR, including the following steps:
[0057] S1. Water sample extraction: Filter the water sample containing Pistia stratiotes using a mixed cellulose membrane, and place the filter membrane in a sterilized centrifuge tube after suction filtration.
[0058] S2. eDNA water sample extraction: Add 1200 μL of CTAB lysis buffer (1:1) to submerge the filter membrane. Vortex vertically at low speed for 5 minutes, place it in a 60°C constant temperature water bath for 8 hours, and vortex vertically for 5 minutes every 2 hours. After taking it out, add 1200 μL of chloroform (24:1), vortex vertically at low speed for 7 minutes to allow the solution to react fully. Centrifuge at 7000 rpm for 15 minutes at room temperature to separate the non-DNA solid from the aqueous phase; Pipette 1000 μL of the aqueous phase into a 2 mL microcentrifuge tube and label it (do not aspirate the middle and lower layer liquids). Then add 500 μL of ice-cold isopropanol and 250 μL of 5 M NaCl, and store it in a -20°C refrigerator for 1 hour. Centrifuge at 15000 rcf for 15 minutes at room temperature, and gently pour off the supernatant. Add 150 μL of 70% alcohol to wash the inner wall of the centrifuge tube, centrifuge at 15000 rcf for 5 minutes at room temperature, and pour off the alcohol. Repeat this step twice. After rinsing clean, open the centrifuge tube cap at room temperature and let it air dry for 10 minutes. Finally, add 50 μL of TE after heating in a 60°C water bath to the centrifuge tube, and then heat it in a 55°C water bath for 10 minutes to obtain the water sample eDNA, which is stored in a -20°C refrigerator for later use.
[0059] S3. Multiplex PCR amplification:
[0060] Prepare the multiplex PCR system: Among them, 5 μL of 2×Multiplex PCR Master mix enzyme, 0.5 μL of BSA, 3 μL of DNA template, 0.1 μL each of 4 pairs of upstream and downstream primers (20 μmol·L -1 ), and make up to 10 μL with sterile and enzyme-free water.
[0061] Vortex and mix each component evenly and place it in a PCR instrument. 1st PCR amplification program: Pre-denature at 95°C for 5 minutes; Denature at 95°C for 30 seconds, anneal at 56°C for 90 seconds, extend at 72°C for 30 seconds, and perform 40 cycles of reaction; Finally, extend at 68°C for 10 minutes.
[0062] S4. Electrophoresis detection:
[0063] Prepare an agarose gel with a concentration of 1.5%. After the gel solidifies, pipette 1 μL of the PCR product, mix it with 1 μL of Loading buffer, load the sample, place it in an electrophoresis instrument, and run it at 110 V and 400 mA for 40 minutes. Observe the bright band situation in a gel imager, and judge the presence of Pistia stratiotes based on whether the bright band of the target fragment appears.
[0064] After washing the 1st PCR product with magnetic beads, perform the second PCR. The 2nd PCR system is 10 μL of Takara Taq enzyme, 4 μL of DNA template, primers P5 / P7 (10 μmol·L -1) 1 μL, make up to 20 μL with sterile and enzyme-free water. 2nd PCR amplification program: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 15 s, 15 cycles of reaction; finally, extension at 72°C for 5 min. After gel electrophoresis (the same as above), observe the bright band situation in the gel imager. The purpose of the second-step PCR is mainly for sequencing needs, and at the same time, it can also make the target band more obvious. In general detection, the first-step PCR can achieve the detection of the target species Pistia stratiotes.
[0065] S5. Sequencing verification: Recover and purify the multiplex PCR amplification products through a DNA purification and recovery kit, send the purified samples to a biotechnology company for sequencing, and perform BLAST alignment analysis on the obtained sequences. This is a non-essential step, but because the bands are close, using this means for additional verification can show a clearer effect.
[0066] Example 3: Primer testing
[0067] I. Single primer pair testing
[0068] Positive detection: Test whether each pair of primers can amplify the DNA of the target species (i.e., Pistia stratiotes DNA).
[0069] Specificity testing: Test whether the primers cannot amplify the related species Spirodela polyrhiza of Pistia stratiotes. The reaction system and reaction conditions for positive and specificity testing are the same as in Example 4.
[0070] Test results: As Figure 1 shown, all 4 pairs of primers can amplify Pistia stratiotes, and none of them can amplify the related species Spirodela polyrhiza of Pistia stratiotes. It is preliminarily judged that they can be used as amplification primers for Pistia stratiotes DNA.
[0071] II. Primer pair combination testing
[0072] Primer combinations: PS_7 primer pair, PS_8 primer pair, PS_9 primer pair, PS_10 primer pair.
[0073] Perform multiplex PCR amplification according to the method described in Example 2, and use Pistia stratiotes tissue sample DNA, aquaculture water body DNA, and natural water body DNA to test whether multiple pairs of specific primers can amplify Pistia stratiotes DNA simultaneously. Test results: As Figure 2 shown, when using 4 pairs of primers to amplify Pistia stratiotes tissue sample DNA respectively, clear bands can be seen; when using the primer combination to amplify Pistia stratiotes tissue sample DNA, clear bands can be seen; when using the primer combination to amplify the water sample DNA of the aquaculture water body of Pistia stratiotes, clear bands can be seen. As Figure 3 shown, when using the primer combination to amplify the aquaculture water sample of Pistia stratiotes again, clear bands can be seen, and the amplification efficiency is the highest at 56°C. As Figure 4As shown in the figure, 4 pairs of primers were used to amplify water samples (natural water samples of Pistia stratiotes) from Zhejiang, Hunan, Guangdong, Dongting Lake, Chongqing, and Jiangsu regions, and clear bands could be seen. Since the bp numbers of the four pairs of primers are similar, the test results of the primer combinations cannot be used to distinguish the bands of each primer pair by gel electrophoresis, but it does not affect the determination of the presence or absence of Pistia stratiotes.
[0074] Example 4: Sensitivity test
[0075] In this example, sensitivity tests were respectively carried out on primer pairs PS_7, PS_8, PS_9, PS_10, and primer combinations.
[0076] The stock solution of Pistia stratiotes DNA was diluted 5 times, and four primers were respectively used for concentration gradient tests to test the sensitivity of a single primer. Test results: The test results are as Figure 5 shown. The detection limit of primer PS_7 reached 0.024 ng / μl, the detection limit of primer PS_8 reached 0.618 ng / μl, the detection limit of primer PS_9 reached 0.123 ng / μl, and the detection limit of primer PS_10 reached 0.024 ng / μl. In summary, the sensitivities of primers PS_7 and PS_10 are better.
[0077] The stock solution of Pistia stratiotes DNA was diluted 5 times, and concentration gradient multiplex PCR amplification was carried out using the primer combination to test the sensitivity of the multiplex PCR method in Example 2. The test results are as Figure 6 shown. The detection limit of the primer combination of PS_7, PS_8, PS_9, and PS_10 reached 0.024 ng / μl, and the sensitivity is better.
[0078] This specific implementation manner is only an interpretation of the present invention and does not limit the present invention. Any changes made by those skilled in the art after reading the specification of the present invention will be protected by the patent law as long as they are within the scope of the claims of the present invention.
Claims
1. Primer combination for detecting the invasive species Pistia stratiotes in water by multiplex PCR, characterized in that: Including PS_7 primer pair, PS_8 primer pair, PS_9 primer pair, and PS_10 primer pair; The nucleotide sequences of the PS_7 primer pair are shown as SEQ ID NO: 1-2, the nucleotide sequences of the PS_8 primer pair are shown as SEQ ID NO: 3-4, the nucleotide sequences of the PS_9 primer pair are shown as SEQ ID NO: 5-6; the nucleotide sequences of the PS_10 primer pair are shown as SEQ ID NO: 7-8.
2. Kit for detecting the invasive species Pistia stratiotes in water by multiplex PCR, characterized in that: Including the primer combination for detecting the invasive species Pistia stratiotes in water by multiplex PCR as described in Claim 1.
3. The kit for detecting the invasive species Pistia stratiotes in water by multiplex PCR according to claim 2, characterized in that: Also including 2×Multiplex PCR Master mix enzyme, BSA, and sterile enzyme-free water.
4. The kit for detecting water hyacinth, an invasive species in water, by multiplex PCR according to claim 3, characterized in that: Also including a positive control DNA, which is Pistia stratiotes DNA.
5. Method for detecting water hyacinth, an invasive species in water, by multiplex PCR, characterized in that: Including the following steps: S1. Water sample extraction: Filter the water sample to be tested using a filter membrane, and place the filter membrane in a sterilized centrifuge tube after suction filtration; S2. eDNA water sample extraction: Extract eDNA from the filter membrane after suction filtration using the CTAB method; S3. Multiplex PCR amplification: Perform a multiplex PCR amplification reaction on the extracted eDNA using the kit described in Claim 2; S4. Electrophoresis detection: Perform agarose gel electrophoresis on the amplification product, observe the bright band situation in the gel imager after electrophoresis, and judge the presence of Pistia stratiotes according to whether there is a bright band of the target fragment.
6. The method for detecting the invasive species Pistia stratiotes in water by using multiplex PCR according to claim 5, characterized in that: In step S1, the filter membrane is a mixed cellulose membrane with a pore size of 0.45 microns.
7. The method for detecting the invasive species Pistia stratiotes in water by using multiplex PCR according to claim 5, wherein: In step S3, the reaction system for multiplex PCR amplification is as follows: 5 μL of 2×Multiplex PCR Mastermix enzyme, 0.5 μL of BSA, 3 μL of DNA template, 0.1 μL each of 4 pairs of upstream and downstream primers (20 μmol·L -1 ), and sterile enzyme-free water is added to make up to 10 μL.
8. The method for detecting the invasive species Pistia stratiotes in water by using multiplex PCR according to claim 5, wherein: In step S3, the reaction conditions for multiplex PCR amplification are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 90 s, extension at 72°C for 30 s, with 40 cycles of reaction; finally, extension at 68°C for 10 min.