Application of luteolin in preparation of medicine for treating periprosthetic osteolysis
Luteolin addresses prosthetic joint wear particle-induced osteolysis by enhancing FOXO3A expression and reducing oxidative stress in MC3T3-E1 cells, thereby inhibiting bone resorption and promoting osteogenesis, offering a new therapeutic strategy for prosthetic joint osteolysis.
Patent Information
- Application Number
- CN202510556352.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-07-15
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
In the prior art, wear particles-mediated periphery osteolysis (PPO) after artificial joint replacement leads to bone loss and sterile loosening, and existing drug research is difficult to effectively inhibit this problem.
Luteolin is used as a drug ingredient and administered through intraperitoneal injection to enhance the expression of FOXO3A, reduce the oxidative stress of MC3T3-E1 cells, restore the osteogenic function of BMSCs, and reduce the osteolysis induced by titanium particles.
Luteolin significantly inhibits bone lysis around the prosthesis, reduces bone loss, restores bone structure continuity, promotes osteoblast mineralization, and has a dose-dependent effect.
Smart Images

Figure CN120305249A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceuticals, and particularly to the application of luteolin in the preparation of drugs for treating periprosthetic osteolysis. Background Art
[0002] Total joint arthroplasty refers to using materials such as metal, ultra-high molecular weight polyethylene, and ceramics to make artificial joint prostheses according to the shape, structure, and function of human joints, and implanting them into the human body through surgical techniques to replace the function of diseased joints, so as to relieve joint pain and restore joint function. Total joint arthroplasty has good clinical efficacy. However, postoperative wear particle-mediated periprosthetic osteolysis (PPO) restricts the long-term efficacy of artificial joints. Wear particles stimulate cells around the prosthesis, resulting in increased expression of cytokines and inflammatory factors, activating different signaling pathways, promoting the imbalance between osteoblast-mediated bone formation and osteoclast-mediated bone resorption, leading to local bone loss, and ultimately resulting in osteolysis and aseptic loosening, which requires patients to undergo secondary surgery for treatment. Therefore, the research on drugs that can inhibit wear particle-mediated osteolysis is of great significance. Summary of the Invention
[0003] The purpose of the present invention is to provide an active ingredient of a drug that can inhibit periprosthetic osteolysis.
[0004] To achieve the above purpose, the present invention provides the following technical solutions:
[0005] The application of luteolin in the preparation of drugs for treating periprosthetic osteolysis.
[0006] Optionally, the luteolin restores the osteogenic function of BMSCs cells.
[0007] Optionally, the luteolin promotes osteoblast mineralization.
[0008] Optionally, the luteolin reduces the oxidative stress of MC3T3-E1 cells.
[0009] Optionally, the luteolin enhances the expression of FOXO3A.
[0010] Optionally, the inhibitory effect of the luteolin on periprosthetic osteolysis is dose-dependent.
[0011] Optionally, the drug is administered by intraperitoneal injection.
[0012] Optionally, the concentration of luteolin in the drug is any value in the range of 5 μM to 20 μM.
[0013] The beneficial effects of the present invention are as follows: The present invention discloses the application of luteolin in the preparation of drugs for treating periprosthetic osteolysis. Through animal experiments, the present invention confirms that luteolin can reduce the expression of Cyto-C, NOX4, and Prdx3 in MC3T3-E1 cells, alleviate titanium particle-induced osteolysis and bone loss, and proves that luteolin has an obvious inhibitory effect on titanium particle-induced osteolysis. It can be used as a new means of drug intervention for periprosthetic osteolysis after artificial prosthesis replacement.
[0014] The above description is only an overview of the technical solution of the present invention. In order to be able to understand the technical means of the present invention more clearly and implement it in accordance with the content of the specification, the following takes the preferred embodiments of the present invention and combines them with the accompanying drawings to describe in detail as follows. Brief Description of the Drawings
[0015] Figure 1 It is a micro-CT detection image of a mouse skull sample shown in Example 1 of the present invention;
[0016] Figure 2 It is a histological staining and immunohistochemical staining analysis image of a mouse skull sample shown in Example 1 of the present invention;
[0017] Figure 3 It is the experimental result image of the osteoblast oxidative stress experiment in Example 1 of the present invention;
[0018] Figure 4 It is the DIA proteomics analysis result image in Example 1 of the present invention;
[0019] Figure 5 It is the experimental result image of the mechanism verification experiment in Example 1 of the present invention;
[0020] Figure 6 It is the experimental result image of the osteogenesis experiment in Example 1 of the present invention;
[0021] Figure 7 It is the FOXO3A immunohistochemical staining analysis image of a mouse skull sample shown in Example 1 of the present invention;
[0022] Figure 8 It is the image of the expression of osteogenesis-related factors, FOXO3A protein and mRNA after BMSCs cell treatment and knockdown of FOXO3A in Example 1 of the present invention. Detailed Embodiments
[0023] Next, the technical solution of the present invention will be clearly and completely described in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0024] In the description of the present invention, it should be noted that the orientation or positional relationship indicated by the terms "center", "upper", "lower", "left", "right", "vertical", "horizontal", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings. It is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be construed as a limitation to the present invention. In addition, the terms "first", "second", "third" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance.
[0025] In the description of the present invention, it should be noted that unless otherwise clearly specified and defined, the terms "installation", "connection", "connection" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be directly connected or indirectly connected through an intermediate medium, and it can be the communication inside two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances.
[0026] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0027] Luteolin is a natural flavonoid compound that exists in a variety of plants. It has a variety of pharmacological activities, such as anti-inflammatory, anti-allergic, uric acid lowering, anti-tumor, antibacterial, antiviral, etc. Clinically, it is mainly used for cough relief, expectoration, anti-inflammatory, uric acid lowering, treatment of cardiovascular diseases, treatment of "amyotrophic lateral sclerosis", hepatitis, etc. Existing studies have shown that luteolin can promote osteoblast function in cases such as high-sugar, glucocorticoid-induced osteoporosis and menopause-induced osteoporosis. However, it is not clear whether luteolin directly reduces the oxidative stress of osteoblasts to treat osteolysis, and the inventors have conducted research on this. In the present invention, Lut is used to refer to luteolin.
[0028] The present invention claims the application of luteolin in the preparation of drugs for treating periprosthetic osteolysis.
[0029] The present invention has confirmed the application of luteolin in the preparation of drugs for treating periprosthetic osteolysis through experiments, and has revealed through experiments that luteolin enhances the expression of FOXO3A, reduces the oxidative stress of MC3T3-E1 cells, and restores the osteogenic function of BMSCs, alleviating titanium particle-induced osteolysis and bone loss, and confirming that luteolin has an obvious inhibitory effect on titanium particle-induced osteolysis and can be used as a new means for drug intervention in periprosthetic osteolysis after artificial prosthesis replacement.
[0030] In some embodiments, luteolin restores the osteogenic function of BMSCs cells.
[0031] In some embodiments, luteolin promotes osteoblast mineralization.
[0032] In some embodiments, luteolin reduces the oxidative stress of MC3T3-E1 cells.
[0033] In some embodiments, luteolin enhances the expression of FOXO3A.
[0034] In some embodiments, the inhibitory effect of luteolin on periprosthetic osteolysis is dose-dependent.
[0035] In some embodiments, the drug is administered by intraperitoneal injection.
[0036] In some embodiments, the concentration of luteolin in the drug is any value in the range of 5 μM to 20 μM, for example, it can be any value among 5 μM, 7 μM, 9 μM, 11 μM, 13 μM, 15 μM, 18 μM, and 20 μM.
[0037] For details, please refer to the following embodiments.
[0038] Example 1:
[0039] In the present invention, a wear particle-mediated osteolysis model was constructed in mice and animal experiments were conducted to study the inhibitory effect of luteolin on PPO. The experimental design and all procedures involving mice in the present invention were approved by Soochow University and were carried out strictly in accordance with the guidelines of the National Institutes of Health (NIH) and the principles of care and use of laboratory animals.
[0040] Fifty-six 6- to 8-week-old male C57BL / 6J mice were randomly divided into a Control group, a Ti group, a Ti+L-Lut group, and a Ti+H-Lut group according to the random number table method. All mice were anesthetized by intraperitoneal injection of 0.4 mL of 1.25% tribromoethanol before the surgical procedure, and the scalp hair of the mice was shaved off with a razor. The shaved area was disinfected three times with iodophor disinfectant solution. An incision of about 10 mm was made along the mid-sagittal plane of the mouse from the midpoint of the line connecting the two orbital margins to the midpoint of the line connecting the two ear margins with a scalpel. After thoroughly scraping off the periosteum on the surface of the mouse skull, the periosteum was wiped with sterile gauze to fully separate the periosteum from the skull, and the skin around the incision was lifted with skin forceps to prevent fluid leakage. 40 μl of the treatment solution was aspirated with a pipette and dropped onto the surface of the skull. Subsequently, a suture needle with a thread was used to suture the incision progressively. After suturing, the incision was disinfected again with iodophor disinfectant solution and the mice were placed in a cage to wait for recovery. The treatment solution for the mice in the Control group was normal saline, and the treatment solutions for the mice in the other three groups were Ti nanoparticle suspensions with a concentration of 0.5 kg / L. After the surgery, the mice in the Ti group were injected intraperitoneally with phosphate buffer solution (PBS) daily, the mice in the Ti+L-Lut group were injected with luteolin solution at a dose of 25 mg / kg, and the mice in the Ti+H-Lut group were injected with luteolin solution at a dose of 50 mg / kg. After continuous administration for two weeks, all mice were euthanized with an overdose of sodium pentobarbital, and then all fresh skull specimens and the heart, liver, spleen, lungs, and kidneys were collected and fixed with 4% paraformaldehyde.
[0041] The fixed skull samples were taken, and the titanium nanoparticles on the surface of the skull were removed to reduce metal artifacts. Scanning was performed using a SkyScan1176 microCT device (SkyScan1176, Aartselaar, Belgium), two-dimensional and three-dimensional images were reconstructed using NRecon software (Skyscan micro-CT, Aartselaar, Belgium), and bone parameters were analyzed using SkyScan software, including bone mineral density (BMD, mg / cm 3 ), bone volume / tissue volume (BV / TV, %), bone surface area / bone volume (BS / BV, %), trabecular bone thickness (Tb.Th, mm), trabecular bone spacing (Tb.Sp, mm), and trabecular bone number (Tb.N, 1 / mm). The experimental results are shown in Figure 1, it can be seen that compared with the Control group, titanium particle implantation led to a significant reduction in the surrounding bone mass and disruption of the cranial continuity. After luteolin treatment, this damage was effectively inhibited. Combining the changes in various bone parameters obtained from the analysis, it can be seen that compared with the Control group, the BV / TV, Tb.N, Tb.Th, and BMD values in the Ti group were significantly decreased. BS / BV and Tb.Sp were significantly increased respectively. The osteolysis reaction of the skulls of mice in the L-Lut group and the H-Lut group was significantly alleviated compared with the Ti group. The number of cavities on the surface of the mouse skull and the sunken area on the surface of the skull were significantly reduced. BMD, Tb.N, Tb.Th, and BV / TV were significantly increased compared with the Ti group, and the trabecular separation was significantly decreased compared with the Ti group. Moreover, high-dose luteolin could significantly reduce titanium particle-induced osteolysis of the mouse skull, while the therapeutic effect of the low-dose group was limited, indicating that luteolin could significantly inhibit the degree of osteolysis induced by Ti particles, and this inhibition was dose-dependent.
[0042] After decalcifying the cranial samples, paraffin sections with a thickness of 5 μm were prepared. Hematoxylin-eosin (H&E) staining and Masson staining were performed. An Invitrogen EVOS m700 inverted microscope was used to observe the morphological changes of the skull, and a microscope computer image analysis system (Image-Proplus 6.0) was used to calculate the relative collagen content of the skull. Then, immunostaining was performed with antibodies against the proteins of the bone formation markers OCN, ALP, and ostertix (OSX), and their contents were quantitatively analyzed. The experimental results are shown in Figure 2 , as can be seen from the H&E staining pictures, compared with the Control group, the cranial continuity of the Ti group was severely disrupted and the bone structure was loose, while luteolin treatment significantly alleviated this damage. The Masson staining pictures showed that the collagen fibers in the Ti group were reduced compared with the Control group, while the collagen fiber content was significantly increased after luteolin treatment. Immunostaining confirmed the osteogenic ability of luteolin. Compared with the Control group, the expression levels of the bone formation markers ALP, OCN, and ostertix in the Ti group were decreased, but luteolin treatment significantly enhanced the expression levels of these markers. In summary, these results further confirmed that luteolin could effectively treat titanium particle-induced osteolysis of the mouse skull.
[0043] MC3T3-E1 cells obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA) were thawed and cultured in α-minimum essential medium (α-MEM; EallBio, Beijing, China) supplemented with 10% fetal bovine serum (Excell, Suzhou, China) at 37 °C under 5% CO2 to obtain samples of the Control group. 0.1 mg / ml of Ti particles were additionally added to the culture medium to obtain samples of the Ti group after culture, 200 μM of H2O2 was additionally added to the culture medium to obtain samples of the H2O2 group after culture, and 0.1 mg / ml of Ti particles and 200 μM of H2O2 were additionally added simultaneously to obtain samples of the Ti + H2O2 group after culture. The Ti particles and H2O2 were used to simulate osteolytic and oxidative stress microenvironments.
[0044] Please refer to Figure 3, Osteoblast oxidative stress experiments were conducted using the above four groups of samples. Using β-actin as an internal reference, the expression levels of oxidative stress markers Cyto-C, NOX4, and Prdx3 in each group of samples were detected by Western blot (WB) and quantitatively analyzed. According to the experimental results, it can be seen that titanium particles increased the expression of Cyto-C, NOX4, and Prdx3 in MC3T3-E1 cells, and under hydrogen peroxide stimulation, titanium particles exacerbated the expression of these proteins. That is to say, titanium particles can induce oxidative stress in osteoblasts and exacerbate the original oxidative stress response of cells. 5 μM, 10 μM, 20 μM, 40 μM, and 80 μM of luteolin were added additionally to the culture medium of the Control group samples, and after culturing, the cell viability of the samples was detected by Cell Counting Kit-8 (CCK-8) respectively with the Control group samples. It can be seen that luteolin with a concentration less than or equal to 20 μM has no obvious inhibitory effect on the growth of MC3T3-E1 cells. 5 μM, 10 μM, 20 μM, and 40 μM of luteolin were added additionally to the culture medium of the Ti+H2O2 group samples, and after culturing, the cell viability of the samples was detected by CCK-8 respectively with the Control group samples and the Ti+H2O2 group samples. It can be seen that under the stimulation of titanium and hydrogen peroxide, the effect of 20 μM concentration of luteolin in improving cell proliferation inhibition is the most obvious. Therefore, 20 μM was selected as the treatment concentration for subsequent in vitro experiments. Through DCFH-DA staining and DAPI staining, fluorescence images were obtained under a fluorescence microscope (EVOS 7000, Thermo Scientific, MA, USA), and the fluorescence intensity was measured by a multifunctional fluorescence enzyme label (Victor Nivo, Perkin Elmer, MA, USA) to quantify the intracellular reactive oxygen species (ROS) level and perform quantitative analysis. The results showed that the combination of titanium particles and hydrogen peroxide increased the intracellular ROS level in MC3T3-E1 cells. However, luteolin treatment inhibited the growth of ROS, demonstrating that luteolin can alleviate titanium particle-induced oxidative stress in osteoblasts.
[0045] Bone marrow mesenchymal stem cells (BMSCs) were isolated and cultured from the tibiae and femurs of healthy 6- to 8-week-old Sprague-Dawley male rats. The BMSCs were inoculated in α-MEM culture medium containing 10% fetal bovine serum, 1% penicillin / streptomycin, 100 nM dexamethasone, 10 mM β-glycerophosphate, and 50 mM vitamin C for culture, and the culture medium was changed every 3 days to obtain BMSC vehicle group samples. 20 μM of luteolin was added additionally to the culture medium to obtain BMSC Lut group samples. DIA proteomics analysis was performed on the BMSC vehicle group samples and the BMSC Lut group samples. For the analysis results, please refer to Figure 4, in the differential protein heat map plotted according to the |logFC| value, it can be seen that there are significant differences in protein expression levels between the two groups of samples, that is, there are significant differences in the transcriptomes between the two groups. In the PCA score plot, it can be seen that there are significant differences in the principal components between the two groups of samples. KEGG pathway analysis was performed on the differentially expressed genes and a bubble plot was drawn. It can be seen from the figure that multiple signaling pathways are significantly enriched, with the PI3K-AKT and FoxO signaling pathways being the most significant. In the heat map of the protein expression of the FoxO pathway and the PI3K-AKT pathway within the two groups of samples, it can be seen that in the samples after luteolin treatment, the key protein FOXO3A regulated by the AKT pathway increased significantly.
[0046] Based on the protein analysis results, a mechanism verification experiment was performed on MC3T3-E1 cells. The samples obtained by culturing with an additional 20 μM luteolin in the culture medium of the samples in the Ti+H2O2 group were named the Ti+H2O2+Lut group samples. Please refer to Figure 5, with GAPDH as the internal reference, the expression levels of oxidative stress markers Cyto-C, NOX4, Prdx3, and FOXO3A in the samples of the Control group, Ti+H2O2 group, and Ti+H2O2+Lut group were detected by WB assay, and quantitative analysis was performed. It can be seen that luteolin reversed the increase in oxidative stress marker proteins in MC3T3-E1 cells after stimulation with titanium particles and H2O2, and luteolin treatment further increased the expression of FOXO3A. After knocking down the expression level of FOXO3A in MC3T3-E1 cells by SiRNA, the same treatments as the samples of the Ti+H2O2 group and Ti+H2O2+Lut group were performed to obtain the samples of the Ti+H2O2+SiFOXO3A group and Ti+H2O2+Lut+SiFOXO3A group. With β-actin as the internal reference, the expression levels of oxidative stress markers Cyto-C, NOX4, Prdx3, and FOXO3A in the samples of the Ti+H2O2 group, Ti+H2O2+Lut group, Ti+H2O2+SiFOXO3A group, and Ti+H2O2+Lut+SiFOXO3A group were detected by WB assay, and quantitative analysis was performed. It can be seen from the experimental results that knocking down FOXO3A expression by SiRNA can reverse the inhibitory effect of luteolin on the expression of NOX4, PRDX3, and Cyto-C. In addition, when FOXO3A was knocked down, the effect of luteolin on oxidative stress markers was no longer significant, demonstrating that the therapeutic effect of luteolin on titanium particle-induced osteolysis is directly related to the regulation of FOXO3A expression. DCFH-DA staining and DAPI staining were performed on the four groups of samples of the Ti+H2O2 group, Ti+H2O2+Lut group, Ti+H2O2+SiFOXO3A group, and Ti+H2O2+Lut+SiFOXO3A group, and observed under a fluorescence microscope. It can be seen that after knocking down FOXO3A, luteolin blocked the clearance of ROS in MC3T3-E1 cells under oxidative stress. These results indicate that the overexpression of FOXO3A is an important mechanism for luteolin to protect osteoblasts against oxidative stress.
[0047] BMSCs cells were cultured to obtain the samples of the Control group. 0.1 mg / ml of titanium particles were added to BMSCs cells for co-culture to form the samples of the Ti group. 0.1 mg / ml of titanium particles and 20 μM of luteolin were added to BMSCs cells for co-culture to form the samples of the Ti+Lut group. After knocking down the expression of FOXO3A in BMSCs cells, they were co-cultured with titanium particles and luteolin to form the samples of the Ti+Lut+SiFOXO3A group. Osteogenic experiments were performed on the four groups of samples by ALP staining and ARS staining on the 7th day after osteogenic differentiation, and quantitative analysis was performed. Please refer to Figure 6, it can be seen that compared with the Control group, osteogenesis in the Ti group was reduced. Compared with the Ti group, luteolin significantly promoted osteogenic differentiation, and knockdown of FOXO3A reversed the effect of luteolin on promoting osteogenic differentiation.
[0048] Mice that had completed model construction were administered luteolin at 20 μM, and cranial samples of the Ti+Lut group were obtained by sampling and processing. FOXO3A immunohistochemical staining was performed on the mouse cranial samples of the Control group, Ti group, and Ti+Lut group, and quantitative analysis was carried out. Please refer to Figure 7 , it can be seen that the expression of FOXO3A in the mouse cranial samples was significantly increased after luteolin treatment, further verifying that luteolin promotes osteogenesis by alleviating oxidative stress through the FOXO signaling pathway.
[0049] BMSCs samples were taken, either co-treated with Ti and H2O2, or treated with luteolin after co-treatment, or knockdown of FOXO3A was performed before co-treatment and then treated with luteolin, forming four groups of samples. WB experiments were carried out on each group of samples to detect the protein expression of osteogenesis-related factors Runx2 and OCN as well as FOXO3A in each group of samples, and then qRT-PCR experiments were used to detect the mRNA expression of osteogenesis-related genes Runx2 and OCN in each group of samples. The primer sequences in the qRT-PCR experiment are shown in Table 1 below.
[0050] Table 1:
[0051] mRNA Forward primer (5’-3’) Reverse primer (5’-3’) GAPDH TGTCAAGCTCATTTCCTGGTATG TTATGGGGGTCTGGGATGGA OCN CCTGAGTCTGACAAAGCCTTCA AGATGCGTTTGTAGGCGGTC RUNX2 TGGCCGGGAATGATGAGAAC TGAAACTCTTGCCTCGTCCG
[0052] The experimental results are shown in Figure 8 , it can be seen that luteolin treatment contributed to osteogenesis, and the osteogenic promoting effect of luteolin was dependent on the overexpression of FOXO3A.
[0053] Based on the above experiments, it can be seen that luteolin can alleviate osteolysis of mouse calvaria, reduce oxidative stress in MC3T3-E1 cells, and restore the osteogenic function of BMSCs. Its mechanism is related to enhancing the expression of FOXO3A. These findings indicate that luteolin has potential value as a drug for the prevention and treatment of PPOL.
[0054] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.
[0055] The above-described embodiments merely represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limitations on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.
Claims
1. Use of luteolin in the preparation of a drug for treating periprosthetic osteolysis.
2. The application according to claim 1, characterized in that The luteolin restores the osteogenic function of BMSCs cells.
3. The application according to claim 2, wherein The luteolin promotes osteoblast mineralization.
4. The application according to claim 1, wherein The luteolin reduces the oxidative stress of MC3T3-E1 cells.
5. The application according to claim 1, wherein The luteolin enhances the expression of FOXO3A.
6. The application according to claim 1, wherein The inhibitory effect of the luteolin on periprosthetic osteolysis is dose-dependent.
7. The application according to claim 1, wherein The drug is administered by intraperitoneal injection.
8. The application according to claim 1, characterized in that The concentration of luteolin in the drug is any value in the range of 5 μM to 20 μM.