Application of thyroid hormone in regulation and control of skeletal muscle atrophy

Abstract

The invention belongs to the field of clinical medicine, and particularly relates to application of thyroid hormone in regulation and control of skeletal muscle atrophy. The method comprises the following steps: constructing a mouse tumor malignant fluid model, and determining the change condition of the thyroid hormone level in the malignant fluid model; it is verified that treatment of thyroid hormone inhibits expression of amyotrophy marker genes in skeletal muscles of the mouse with the malignant fluid, alleviates weight reduction of skeletal muscle tissues and inhibits reduction of the cross-sectional area of muscle fibers, and therefore generation of the malignant fluid is inhibited. The research opens up a new thought for the research on the pathogenesis of the malignant fluid, and also provides a potential new target for the research and development of malignant fluid treatment and / or malignant fluid prevention drugs.

Description

Technical Field

[0001] The present invention relates to the field of clinical medicine, and particularly to the application of thyroid hormone in regulating skeletal muscle atrophy. Background Art

[0002] During the occurrence and development of cancer, cancer cells reprogram their metabolic pathways to meet their increased bioenergetic and proliferative demands, while also disrupting the whole-body metabolism of the host. In this process, cancer-induced circulating factors, including inflammatory factors, hormones, and growth factors, are diverse in origin and function, and they can affect muscle breakdown by interacting with skeletal muscle cells, leading to the development of clinical cachexia. Compared with patients without cachexia, the survival period of advanced cancer patients with cachexia is significantly shortened, mainly characterized by fatigue, muscle and fat loss, and systemic inflammation. The consumption of skeletal muscle mass and function is the most obvious feature of cancer cachexia, which not only seriously reduces the quality of life of patients, but also the depletion of muscle mass weakens the tolerance to anti-cancer treatment, thereby reducing the survival rate of patients. Hepatocellular carcinoma (HCC) is one of the most common health threats globally and is the third leading cause of cancer-related mortality. It has been reported in the literature that nearly one-fourth of HCC patients present with cachexia. Although cachexia has been identified as an important prognostic factor in various cancers, there has been no research on it in HCC, so the progress of HCC cachexia is currently unclear.

[0003] Maintaining muscle mass requires the balanced regulation of protein anabolism and catabolism. The occurrence of cancer disrupts the protein metabolism homeostasis in muscles, favoring decreased synthesis and increased breakdown. The main reason for this phenomenon is the overactivation of the ubiquitin-proteasome and autophagy pathways, leading to increased expression of genes related to muscle breakdown and muscle atrophy, such as muscle-specific RING finger protein 1 (MURF1), muscle atrophy F-box protein (MAFBX, also known as FBXO32), FBXO30, and FBXO31. Increasing muscle mass usually requires simultaneously activating protein synthesis and inhibiting catabolic mediators, and the regulation processes of both are inseparable. For example, the PI3K-AKT signaling pathway can not only promote anabolism but also inhibit FOXO-mediated expression of MURF1 and MAFBX, thereby preventing muscle atrophy. In addition, cancer-induced systemic inflammation and increased synthesis of specific cytokines are considered potential driving factors of cancer cachexia. For example, interleukin 6 (IL-6), tumor necrosis factor α (TNF-α), tumor necrosis factor-like apoptosis inducer (TWEEP), tumor necrosis factor receptor-associated factor 6 (TRAF6), interferon-γ, and leukemia inhibitory factor (LIF) in the blood of cancer cachexia patients have all been proven to be mediators of cancer-induced muscle atrophy. These cytokines can induce multiple intracellular pathways, including the NFκB pathway, p38 mitogen-activated protein kinase pathway, and JAK-signal transducer and activator of transcription pathway. At present, although the functions of these signaling pathways are somewhat understood, how they change the skeletal muscle microenvironment, and then affect the physiological functions of skeletal muscle cells, ultimately leading to muscle atrophy remains to be further explored. Currently, there is no effective drug in clinical practice to reverse cachexia. Thyroid hormones play important roles in numerous cellular processes, including cell differentiation, proliferation, autophagy, and metabolism. Existing studies have shown that thyroid hormones are involved in the growth and development of skeletal muscles. For example, thyroid hormones can participate in skeletal muscle regeneration by regulating the metabolic levels in skeletal muscles. In addition, thyroid hormone levels are also closely related to body weight and energy consumption caused by ovarian cancer, breast cancer, and hepatocellular carcinoma. However, the prior art has not disclosed the role of thyroid hormones in the occurrence and development of cancer cachexia. Summary of the Invention

[0004] Aiming at the deficiencies existing in the prior art, the purpose of the present invention is to provide the application of thyroid hormones in skeletal muscle atrophy. By intraperitoneally injecting thyroid hormones into cachectic mice, the symptoms of skeletal muscle atrophy in the mice are alleviated, providing a new direction for promoting the development of clinical treatment strategies for skeletal muscle atrophy in human cancer cachexia.

[0005] To solve the above technical problems, the technical solution provided by the present invention is:

[0006] The application of thyroid hormones in regulating skeletal muscle atrophy caused by cancer cachexia.

[0007] Use of thyroid hormone in the preparation of a drug for inhibiting cancer cachexia.

[0008] Use of thyroid hormone in indicating cancer cachexia.

[0009] Preferably, atrophy of in vitro myotubes is inhibited by adding thyroid hormone to an in vitro skeletal muscle cell atrophy model, and the added concentration of the thyroid hormone is 30 nM.

[0010] Preferably, the regulation is to inhibit skeletal muscle cell atrophy, including increasing the myotube diameter and increasing the cross-sectional area of skeletal muscle.

[0011] Preferably, regulating skeletal muscle cell atrophy includes: inhibiting the expression of muscle atrophy-related genes Fbxo31, Fbxo32, and Trim63 and increasing the expression of myogenic factor MYHC.

[0012] Preferably, a decrease in the level of thyroid hormone in the circulation of cancer cachexia mice and in skeletal muscle tissue is used as a biomarker for cancer cachexia.

[0013] A preparation for inhibiting skeletal muscle atrophy caused by cancer cachexia, the preparation includes thyroid hormone, and the added amount of the thyroid hormone is 100 μg / kg.

[0014] The beneficial effects of the present invention are:

[0015] The present invention reveals that thyroid hormone is involved in the process of skeletal muscle atrophy caused by cancer cachexia. Injecting thyroid hormone in vivo inhibits skeletal muscle atrophy, providing new ideas and targets for promoting skeletal muscle atrophy caused by human cancer cachexia. Description of the Drawings

[0016] The drawings are used to provide further understanding of the present invention, and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation to the present invention. In the drawings:

[0017] Figure 1 Construction of a mouse tumor cachexia model. Among them, A is a schematic diagram of the construction of a mouse cachexia model; in the upper image of B, the in-situ tumor of a liver cancer mouse is taken out for photographing, and in the lower image, the liver tissue section is stained with H&E. The black triangle points to the cancerous position of the liver (scale bar = 520 μm); C shows that compared with littermate control mice, the liver weight of liver cancer mice increases (n = 3, **P < 0.01).

[0018] Figure 2For skeletal muscle atrophy in liver cancer mice. A shows the appearance of the tibialis anterior muscle in control and liver cancer mice and the statistical results of the weight of the tibialis anterior muscle in mice; B shows the statistical results of the measurement of the diameter of the tibialis anterior muscle in mice; C shows the detection of the myofiber area in the skeletal muscle of mice by WGA immunofluorescence staining (scale bar = 130 μm); D shows the statistical results of the cross-sectional area distribution of the myofibers in Figure C (n = 3, *P < 0.05, **P < 0.01).

[0019] Figure 3 For the decrease in thyroid hormone levels in cachectic liver cancer mice. A shows the detection of T3 levels in the circulating blood of mice using an enzyme-linked immunosorbent assay (ELISA) kit for mouse thyroxine (T3); B shows the detection of T3 levels in the tibialis anterior muscle of mice using an ELISA kit for mouse thyroxine (T3); C shows the detection of the expression of genes related to thyroid hormone activity in the skeletal muscle of control and cachectic liver cancer mice by qPCR (n = 3, *P < 0.05, **P < 0.01).

[0020] Figure 4 For the construction of an in vitro myotube atrophy model. A shows the immunofluorescence results of MyHC in mouse skeletal muscle satellite cells induced to differentiate for 3 days (scale bar = 130 μm); B shows the morphological observation of myotubes cultured for 1 day after adding LLC conditioned medium (CM) to myotubes differentiated from skeletal muscle satellite cells in vitro for 3 days (scale bar = 1000 μm); C shows the detection of the expression of genes related to muscle atrophy in the control (Control) and myotube atrophy group (CM) by qPCR (n = 3, *P < 0.05, **P < 0.01).

[0021] Figure 5 Thyroid hormone can resist in vitro myotube atrophy. A shows the immunofluorescence results of MyHC in mouse skeletal muscle satellite cells induced to differentiate for 3 days (scale bar = 130 μm); B shows the morphological observation of myotubes cultured for 1 day after adding LLC conditioned medium (CM) to myotubes differentiated from skeletal muscle satellite cells in vitro for 3 days (scale bar = 130 μm); C shows the detection of the expression of genes related to muscle atrophy in the control (Control) and myotube atrophy group (CM) by qPCR (n = 3, *P < 0.05, **P < 0.01). Figure 6Results of thyroid hormone alleviating skeletal muscle atrophy in mice with hepatocellular carcinoma cachexia. In A, the morphological changes of skeletal muscle in mice of the control group (Control), the thyroid hormone addition group (T3), the cachexia group (Cancer), and the thyroid hormone supplementation group (Cancer+T3) after thyroid hormone supplementation are shown; in B, the weight ratio of TA to body weight and the statistical analysis of the diameter of the widest part of TA in each group after thyroid hormone supplementation are shown; in C, the cross-sectional area of TA in mice of each group after thyroid hormone treatment was detected by WGA immunofluorescence staining (scale bar = 130 μm); in D, the distribution of muscle fiber areas in the skeletal muscle of mice in each group after thyroid hormone treatment was statistically analyzed; in E, the expression levels of muscle atrophy-related genes in TA of mice in each group after thyroid hormone treatment were detected by qPCR (n = 3, *P < 0.05, **P < 0.01). Detailed implementation mode

[0022] The following is a description of the preferred examples of the present invention with reference to the accompanying drawings. It should be understood that the following examples are given only for illustrative purposes and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the spirit and purpose of the present invention.

[0023] Example 1 Decreased thyroid function level in cancer patients

[0024] In order to explore the changes in thyroid hormone levels in cancer patients, this study retrospectively analyzed the five-item thyroid function data of patients with liver cancer caused by hepatitis B cirrhosis and hepatitis B cirrhosis and lung cancer patients who were pathologically diagnosed in the Fifth Medical Center of the Chinese People's Liberation Army General Hospital from January 2020 to October 2021. The stages of liver cancer patients were diagnosed by BCLC staging, excluding cirrhosis and liver cancer caused by other etiologies. Thyroid function tests (TFT) were performed by electrochemiluminescence immunoassay.

[0025] Statistical analysis of the results found that the level of thyroid-stimulating hormone TSH in the liver cancer group was significantly higher than that in the control group. On the contrary, the levels of free thyroid hormone FT3 and total thyroid hormone T3 were significantly lower than those in the control group, which are all clinical manifestations of hypothyroidism. After the Barcelona classification of liver cancer in liver cancer patients, it was also found that as the severity of liver cancer increased, the thyroid hormone levels (T3 and FT3) gradually decreased, while the level of TSH showed an increasing trend. At the same time, the levels of thyroxine T4 and one of the free thyroid hormones FT4 showed a decreasing trend, which also indicated that as the disease progressed, the thyroid hormone levels of liver cancer patients decreased. As shown in Table 1, the clinical baseline data of liver cancer patients and cirrhosis patients in clinical practice. Different superscript letters in the same row indicate significant differences, suggesting that the occurrence of liver cancer is related to changes in thyroid hormone levels.

[0026] Table 1

[0027]

[0028]

[0029] In addition to liver cancer patients, clinical data of lung cancer patients were also collected. Statistical analysis of the results found that compared with the control group, the levels of free thyroxine FT3 and total thyroxine T3 in the lung cancer group were significantly lower than those in the control group, showing a hypothyroid physiological state overall, indicating disordered thyroid hormone metabolism. As shown in Table 2, which presents the clinical baseline data of lung cancer patients and cancer-free healthy patients in clinical practice, different superscript letters in the same row indicate significant differences.

[0030] Table 2

[0031]

[0032] Construction of a mouse tumor cachexia model in Example 2

[0033] (1) Construction of a mouse tumor model

[0034] Male C57BL / 6 mice at 8 weeks of age with a body weight difference of no more than 2 g were selected. The mice were randomly divided into a control group and a cachexia group. Each mouse was injected with activated AKT, NRAS, and MYC via the tail vein (the plasmids were kindly provided by the research group of Teacher Wu Sen from China Agricultural University). The injection day was counted as day 0, and then day 1, day 2, and so on. Liver tissues were collected 4 weeks after tumor inoculation for relevant detections ( Figure 1 A). From the results of H&E staining, it can be seen that compared with the control group mice, obvious tumors were formed in the livers of tumor-bearing mice ( Figure 1 B), and the liver weight was significantly higher than that of the control group ( Figure 1 C). The above results indicate that the liver cancer mouse model was successfully constructed.

[0035] The H&E staining steps used in the present invention were carried out according to conventional steps.

[0036] (2) Evaluation of mouse tumor cachexia

[0037] To further explore whether liver cancer mice develop tumor cachexia, the mice were sacrificed by overdose anesthesia 4 weeks after tumor inoculation. Then, the tumor tissues were removed, and the body weights of all animals without tumors were measured; the tibialis anterior muscles (TA) of the mice were isolated, and their diameters and weights were measured respectively. The results showed that the skeletal muscle weights ( Figure 2 A) and diameters ( Figure 2 B) of liver cancer mice both decreased. Statistical analysis of WGA immunofluorescence staining of skeletal muscle tissues found that compared with the control group, the cross-sectional areas of skeletal muscle fibers in tumor-bearing mice were significantly reduced ( Figure 2C & D). These results indicate that obvious cachexia phenotypes occur in liver cancer mice, suggesting that a cachexia mouse model has been successfully constructed and subsequent experiments can be carried out.

[0038] The steps of WGA immunofluorescence staining used in this invention are as follows: the step of dewaxing the sections to distilled water for hydration; 1) Rinse with PBS for 5 min; 2) Preheat 0.01 M citric acid repair buffer in a microwave oven; 3) Put the sections into citric acid, place them in an antigen heat repair pot, boil in a microwave oven for 13 min, and leave at room temperature for 30 min; 4) Rinse with PBS for 3 min, wipe off the PBS outside the specimen with filter paper, add 0.5% Triton X-100 and treat for 20 min, then wash with PBS three times, 5 min each time; 5) Add blocking solution and block at room temperature in a wet box for 2 h; 6) Wipe off the blocking solution with filter paper, add PBS, and incubate overnight at 4 °C in a wet box; 7) Take out the wet box and rewarm at room temperature for 30 min, then wash with PBS three times for 5 min each, and wipe off the PBS outside the specimen with filter paper; 8) Add WGA staining solution (Invitrogen, 1:50), incubate in the dark in a wet box at room temperature for 30 min; 9) Wash off the secondary antibody with PBS 3 min × 3 times, and wipe off the PBS outside the specimen with filter paper; 10) Add DAPI and incubate in the dark for 5 min; 11) Directly cover with a coverslip and examine under a microscope and take pictures for record.

[0039] Example 3 Changes in thyroid hormone levels in a cachexia mouse model

[0040] (1) Detect thyroid hormone levels in circulating blood and skeletal muscle tissues by Elisa

[0041] Collect peripheral blood and tibialis anterior muscle tissues from cachexia and control mice, and operate according to the instruction manual of the mouse thyroxine (T3) enzyme-linked immunosorbent assay kit (Wuhan Saipai Biotechnology Co., Ltd.) to detect the level of thyroid hormone T3 in blood and skeletal muscle tissues. The results show that in addition to a significant decrease in the level of thyroid hormone T3 in the peripheral blood of mice ( Figure 3 A), the level of thyroid hormone in skeletal muscle tissues also decreases ( Figure 3 B), indicating disordered thyroid hormone levels in cachexia mice.

[0042] (2) Detect the expression changes of thyroid hormone-related genes in skeletal muscle tissues of control and cachexia mice by qRT-PCR.

[0043] Collect the tibialis anterior muscle tissues of cachectic mice, and detect the expression levels of the downstream signaling factors of thyroid hormone in skeletal muscle, namely MyoD, MyoG, Myh2, Myh7, Myh1, Serca1, Serca2, Myf5 and Tropomyosin, by qRT-PCR. The results show that the expression levels of the factors related to thyroid hormone change. Compared with the control group, the expression levels of MyoG, Myh2, Myh1, Serca1, Serca2 and Tropomyosin decrease significantly, the changes of MyoD and Myf5 are not significant, and Myh7 increases significantly ( Figure 3 C), indicating that the occurrence of cachexia changes the thyroid hormone signaling pathway in mice, suggesting that the change of thyroid hormone level can be used as a marker for cachexia in cancer patients.

[0044] The qRT-PCR steps used in the present invention are as follows: Tissue lysis is performed using Trizol solution (about 5 mg of tissue plus 1 ml of Trizol), and total RNA is extracted, and then reverse transcribed into cDNA using RT-PCR technology. qPCR primers for specific genes are designed, with 18S as the internal reference, and amplification is performed on a fluorescence quantitative PCR instrument to detect the mRNA expression level. The detailed information of the primers used is as follows:

[0045] MyoD-F: CCCTGCCATTGTTAAGACC (SEQ ID NO.1);

[0046] MyoD-R: TGCTGCTGTTCCTGTTTTC (SEQ ID NO.2);

[0047] MyoG-F: GCTCTGACGCTCTGAAGGAC (SEQ ID NO.3);

[0048] MyoG-R: AAGGGCTTGGGCAATCCTC (SEQ ID NO.4);

[0049] Myh2-F: CCTTTGGCAACAAGCAAGGTA (SEQ ID NO.5);

[0050] Myh2-R: AGTCGTACACATAGGTGGTCC (SEQ ID NO.6);

[0051] Myh7-F: AGCTCAAAGGAGAGATGATG (SEQ ID NO.7);

[0052] Myh7-R: GAATGATGAACTTGAACACC (SEQ ID NO.8);

[0053] Myh1 - F: GCATCCCTAAAGGCAGGCTC (SEQ ID NO.9)

[0054] Myh1 - R: CAAACACCGATGACTTGGCG (SEQ ID NO.10)

[0055] Serca1 - F: ACCCCAGACCAAGTTAAGCG (SEQ ID NO.11)

[0056] Serca1 - R: GCAGGTCTTCGAACTGCTCT (SEQ ID NO.12)

[0057] Serca2 - F: TTTGTGGCCCGAAACTACCT (SEQ ID NO.13)

[0058] Serca2 - R: TGTGCTGTAGACCCAGACCA (SEQ ID NO.14)

[0059] Myf5 - F: CGGATCACGTCTACAGAGCC (SEQ ID NO.15)

[0060] Myf5 - R: GCAGGAGTGATCATCGGGAG (SEQ ID NO.16)

[0061] Tropomyosin - F:GCTGAGCTCTCAGAAGGCAA (SEQ ID NO.17)

[0062] Tropomyosin - R:CAGCCTCCTTCAGCTTGTCA (SEQ ID NO.18)

[0063] 18S - F:CCTGCGGCTTAATTTGACTC (SEQ ID NO.19);

[0064] 18S - R:ATGCCAGAGTCTCGTTCGTT (SEQ ID NO.20);

[0065] MYHC - F:ACCCTCCCAAGTACGACAAG (SEQ ID NO.21);

[0066] MYHC - R:CGTTATACACTGGCAGCCAC (SEQ ID NO.22);

[0067] FBXO31 - F: CGAATCTTGCACACGGACAC (SEQ ID NO.23);

[0068] FBXO31 - R: ATCGGTGAAGCAGTTTTGCAT (SEQ ID NO.24);

[0069] FBXO32 - F: AAGCATTGATGCGTGGGGTA (SEQ ID NO.25);

[0070] FBXO32 - R: ATTTGGCCACCAGGAGATGG (SEQ ID NO.26);

[0071] TRIM63 - F: GAGGGGCTACCTTCCTCTCA (SEQ ID NO.27);

[0072] TRIM63 - R: TTTACCCTCTGTGGTCACGC (SEQ ID NO.28);

[0073] MUSA1 - F: CCAGAGAAGCCAGGGTTTGA (SEQ ID NO.29);

[0074] MUSA1 - R: ACCACACTTGCAGGACACAT (SEQ ID NO.30).

[0075] Example 4 Construction of an in vitro skeletal muscle cell atrophy model

[0076] (1) Isolation and culture of mouse skeletal muscle satellite cells in vitro

[0077] Mice were sacrificed by cervical dislocation. After completely disinfecting the skin with 75% alcohol, the hindlimbs of wild - type mice were collected under sterile conditions using sterile forceps. The samples were digested with collagenase II and Dispase II, and mouse skeletal muscle satellite cells (mSCs) were isolated and purified by differential attachment. mSCs were cultured at 37°C and 5% CO2 in F10 medium containing 20% (v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin.

[0078] When the cell density reached 90%, the cell culture medium was changed to a differentiation medium (DMEM containing 2% horse serum), and the cells were continuously cultured at 37°C for 3 days. As shown in the figure, it can be seen that mSCs differentiated into myotubes ( Figure 4 A).

[0079] (2) Preparation of conditioned medium from tumor cells

[0080] Mouse lung cancer cells LLC were cultured at 37 °C and 5% CO2, and the culture medium was DMEM containing 10% (v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin. When the cell density reached 40%, the cells were replaced with a new serum-free cell culture medium and continued to be cultured at 37 °C for 48 hours. The cell culture medium was taken, centrifuged at 3000 rmp for 30 minutes, and the supernatant was the LLC tumor cell conditioned medium (CM).

[0081] (3) Construction of an in vitro myotube atrophy model

[0082] CM was mixed with the mSCs differentiation culture medium at a ratio of 1:1, and mSCs myotubes were treated for 24 hours. Observation of the myotube morphology showed that the diameter of the myotubes in the CM group decreased ( Figure 4 B). Subsequently, mSCs cell lysates were collected and RNA was extracted, and the expression levels of its muscle atrophy marker genes MYHC, FbxO31, FbxO32, Trim63, and Musa1 were detected by qRT-PCR. The results showed that compared with the control group, the expression of muscle atrophy marker genes in the cachexia group was significantly increased ( Figure 4 C). The above results indicate that the constructed myotube atrophy model is successful and can be used for subsequent experiments.

[0083] The steps of MYHC immunofluorescence staining used in the present invention are as follows: the step of dewaxing the section to distilled water for hydration; 1) rinsing with PBS for 5 min; 2) preheating 0.01 M citrate repair buffer in a microwave oven; 3) putting the section into a citrate cup, putting it into an antigen heat repair pot, boiling in a microwave oven for 15 min, and naturally cooling to room temperature; 4) rinsing with PBS for 3 min, wiping off the PBS outside the specimen with filter paper, dropping the blocking solution, and blocking at room temperature in a wet box for 2 h; 5) wiping off the blocking solution with filter paper, do not wash. Add MYHC (1:200, Santa Cruz) primary antibody, and incubate overnight at 4 °C in a wet box; 6) take out the wet box and rewarm at room temperature for 30 min; 7) wash off the primary antibody with PBS 3 min × 5 times, wipe off the PBS outside the specimen with filter paper; 9) drop the fluorescent secondary antibody, incubate in the dark at room temperature in a wet box for 1 h; 10) wash off the secondary antibody with PBS 3 min × 3 times, wipe off the PBS outside the specimen with filter paper; 11) drop DAPI and incubate in the dark for 2 min to stain the nucleus of the specimen; 12) directly cover the specimen with a coverslip, and examine and photograph under a microscope for recording.

[0084] Example 5 Addition of thyroid hormone reverses in vitro skeletal muscle cell atrophy

[0085] (1) Effect of thyroid hormone addition on the morphology of in vitro atrophied myotubes

[0086] To detect the effect of thyroid hormone on in vitro myotube atrophy, first, an in vitro myotube atrophy model was constructed according to the method in Example 3. Then, the cells were divided into four groups, namely: control group (Control), thyroid injection group (T3), cachexia group (CM), and thyroid hormone-replenished cachexia group (T3+CM). Among them, thyroid hormone T3 with a concentration of 30 nM was added to the cells in the thyroid hormone and thyroid hormone-replenished cachexia groups and treated for 24 h. Then, the cells were collected and fixed in 4% neutral paraformaldehyde solution overnight. The mature myotubes were labeled with MyHC antibody, and immunofluorescence staining of the myotubes was performed. Then, statistical pre-analysis was carried out using ImageJ and GraphPad Prism 8 software. The results showed that compared with the cachexia group, the diameter of the myotubes in the thyroid hormone-replenished cachexia group increased significantly ( Figure 5 A), with a statistically significant difference ( Figure 5 B). This indicates that after treatment with thyroid hormone injection, protein degradation in the atrophied myotubes was inhibited, thereby inhibiting myotube atrophy, and the in vitro myotube atrophy phenotype caused by tumor cell culture medium was significantly improved.

[0087] (2) Effect of addition of thyroid hormone on the expression of muscle atrophy-related proteins

[0088] To further study the function of thyroid hormone in murine cachexia, cell lysates of each group were collected, and RNA was extracted. The expression levels of myoatrophy marker genes were detected by qRT-PCR. The results showed that treatment with thyroid hormone could increase the expression of MYHC in the cells, and at the same time decrease the expression of myoatrophy marker genes FbxO31, FbxO32, and Trim63. This indicates that thyroid hormone can reverse the expression of myogenic factor MYHC and myoatrophy marker genes FbxO31, FbxO32, and Trim63 in in vitro CM-induced atrophied myotubes ( Figure 5 C).

[0089] Example 6 Reversal of murine cachexia by addition of thyroid hormone

[0090] (1) Effect of thyroid hormone treatment on the tumor-free weight of cachectic mice

[0091] Build cachexia mice according to the method of Example 1. After two weeks, divide the mice into four groups, namely the control group (Control), the thyroid injection group (T3), the cachexia group (Cancer), and the thyroid-replenished cachexia group (Cancer+T3). Inject the mice intraperitoneally every day according to the concentration. After 2 weeks of administration (inject T3 at 100 μg / kg, and the control group injects the same dose of normal saline), euthanize the mice, take the liver and the tibialis anterior muscle tissue of the mice, take pictures, and record the tumor-free weight, tibialis anterior muscle weight, and tumor weight of the mice. The tibialis anterior muscle tissue was fixed overnight in a neutral paraformaldehyde solution with a mass percentage concentration of 4%. Using GraphPad Prism 8 software for statistics, it was found that compared with the cachexia group, the skeletal muscle weight and diameter of the cachexia mice in the thyroid-replenished group were significantly increased ( Figure 6 A&B). It shows that after treatment with thyroid hormone injection, the degradation of skeletal muscle protein in cachexia mice was inhibited, the reduction of skeletal muscle tissue weight was alleviated, the degradation of skeletal muscle in cachexia mice was inhibited, the reduction of tumor-free weight in cachexia mice was inhibited, and the cachexia phenotype of tumor mice was significantly improved.

[0092] (2) Effect of thyroid hormone addition on the morphology of the tibialis anterior muscle of cachexia mice

[0093] Embed the gastrocnemius muscle fixed in a neutral paraformaldehyde solution in paraffin blocks, section, and perform WGA

[0094] immunofluorescence staining. According to the staining results, it was observed that the thyroid hormone-replenished group inhibited the muscle fiber atrophy phenomenon in cachexia mice ( Figure 6 C). Use ImageJ software to quantify the cross-sectional area of muscle fibers. The cross-sectional area of muscle fibers in cachexia mice in the thyroid hormone-replenished group was significantly higher than that in the cachexia group ( Figure 6 D). It shows that after treatment with thyroid hormone, the degradation of skeletal muscle protein in cachexia mice was inhibited, the reduction of skeletal muscle tissue weight was alleviated, the reduction of the cross-sectional area of muscle fibers was inhibited, the degradation of skeletal muscle in cachexia mice was inhibited, and the cachexia phenotype was significantly improved.

[0095] (3) Effect of thyroid hormone addition on the expression of muscle atrophy-related proteins in cachexia mice

[0096] To further study the function of thyroid hormone in murine cachexia, the effect of thyroid hormone treatment on the expression of skeletal muscle atrophy marker genes was detected. Extract RNA from the remaining tibialis anterior muscle tissue and reverse it, and then use qRT-PCR to detect and analyze the expression of the transcription levels of MYHC, FbxO31, FbxO32, and Trim63 in cells of different groups. The results showed that the expression of FbxO31, FbxO32, and Trim63 all decreased significantly after 2 days of differentiation ( Figure 6E) It shows that thyroid hormone can inhibit the expression of atrophy genes, thereby inhibiting the occurrence of cachexia.

[0097] The content not described in detail in this specification belongs to the prior art well-known to those skilled in the art.

[0098] Finally, it should be noted that the above are only preferred examples of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of thyroid hormone in regulating skeletal muscle atrophy.

2. Use of thyroid hormone in the preparation of a drug for inhibiting cancer cachexia.

3. Use of thyroid hormone in indicating cancer cachexia.

4. The use of thyroid hormone in regulating skeletal muscle atrophy according to claim 1, characterized in that by adding thyroid hormone to an in vitro skeletal muscle cell atrophy model to inhibit the atrophy of in vitro myotubes, and the added concentration of the thyroid hormone is 30 nM.

5. The use of thyroid hormone in regulating skeletal muscle atrophy according to claim 1, characterized in that the regulation is to inhibit skeletal muscle cell atrophy, including increasing the myotube diameter and increasing the cross-sectional area of skeletal muscle.

6. The use of thyroid hormone in regulating skeletal muscle atrophy according to claim 1, characterized in that regulating skeletal muscle cell atrophy includes: inhibiting the expression of muscle atrophy-related genes Fbxo31, Fbxo32 and Trim63 and increasing the expression of myogenic factor MYHC.

7. The use of thyroid hormone in indicating cancer cachexia according to claim 3, characterized in that by the decrease in the level of thyroid hormone in the circulation and skeletal muscle tissue of cancer cachexia mice, as a marker of cancer cachexia.

8. A preparation for inhibiting skeletal muscle atrophy caused by cancer cachexia, characterized in that the preparation includes thyroid hormone, and the added amount of the thyroid hormone is 100 μg / kg.

Images