Pseudomonas moire and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to pseudomonas moire and application thereof. According to the specific technical scheme, the pseudomonas morei SE-P-4 is preserved in the China General Microbiological Culture Collection Center on September 25, 2024, and the preservation number of the pseudomonas morei SE-P-4 is CGMCC (China General Microbiological Culture Collection Center) No. 32074. The invention provides a novel low-temperature-resistant phosphate solubilizing bacterium which can secrete various organic acids, indoleacetic acid, siderophores and phosphatase, can stably solubilize phosphate in a low-temperature environment of 10 DEG C and help plant growth, provides a novel efficient means for solubilizing phosphate in soil in alpine regions, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a Pseudomonas moorei and its application. Background Art

[0002] Phosphorus plays a crucial role in plant growth and development and is involved in a series of key physiological and biochemical processes in plants. Phosphorus in the soil often binds to cations such as Ca 2+ 、Al 3+ 、Fe 3+ to form insoluble phosphates, which are difficult for plants to directly absorb and utilize, thereby inhibiting the normal growth and development of plants. Therefore, it is crucial to improve the availability of soil phosphorus.

[0003] In alpine regions, due to their unique climate conditions and soil characteristics, the conversion rate of soil phosphorus will be further slowed down, and the content of available soil phosphorus will be reduced. To address this problem, high-concentration phosphate fertilizers are generally selected to be applied to the soil at present. However, the phosphate fertilizers applied to the soil cannot be completely assimilated by plants, and most of them are fixed in the soil, which may lead to environmental problems such as soil acidification, water pollution, and eutrophication.

[0004] Phosphate-solubilizing bacteria (PSB) can secrete organic acids and other metabolites to convert the poorly available phosphorus in soil, animal, and plant residues into available phosphorus that can be absorbed by plants. PSB has been recognized as a key factor in improving soil phosphorus availability and is considered a low-cost, high-benefit, and environmentally friendly biological solution to solve the problem of soil phosphorus deficiency.

[0005] Therefore, if new phosphate-solubilizing bacteria, especially those that can efficiently solubilize phosphorus in low-temperature environments, can be provided, it is expected to improve the utilization efficiency of soil phosphorus, promote plant growth, and contribute to the ecological restoration and stability of alpine regions. Summary of the Invention

[0006] The object of the present invention is to provide a Pseudomonas moorei and its application.

[0007] To achieve the above object of the invention, the technical solution adopted by the present invention is: a Pseudomonas moorei SE-P-4, and the strain SE-P-4 was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on September 25, 2024, with the deposit number of CGMCC No. 32074.

[0008] Correspondingly, for a Pseudomonas moorei SE-P-4, the 16S rDNA sequence of the strain SE-P-4 is as shown in SEQ NO ID: 1.

[0009] Correspondingly, a bacterial preparation prepared using the Pseudomonas moorei.

[0010] Correspondingly, a bacterial preparation containing the Pseudomonas moorei.

[0011] Correspondingly, a method for dissolving insoluble phosphate using the Pseudomonas moorei or the bacterial preparation.

[0012] Correspondingly, a method for preparing phosphatase using the Pseudomonas moorei or the bacterial preparation.

[0013] Correspondingly, a method for preparing siderophore using the Pseudomonas moorei or the bacterial preparation.

[0014] Correspondingly, a method for preparing organic acid using the Pseudomonas moorei or the bacterial preparation.

[0015] Preferably, the organic acid is any one or more of lactic acid, succinic acid, oxalic acid, acetic acid, quinic acid, isovaleric acid, isobutyric acid, benzoic acid, malic acid, fumaric acid, citric acid, glutaric acid, hexanoic acid, propionic acid, butyric acid, malonic acid, maleic acid, adipic acid, tartaric acid, octanoic acid, shikimic acid, pimelic acid, salicylic acid, valeric acid, isohexanoic acid or itaconic acid.

[0016] Correspondingly, a method for preparing indoleacetic acid using the Pseudomonas moorei or the bacterial preparation.

[0017] Preferably, the application temperature of the method is 10 - 28 °C and the pH is 4 - 8.

[0018] The present invention has the following beneficial effects: The present invention provides a new low-temperature phosphorus-solubilizing bacterium: Pseudomonas moorei. This strain can secrete a variety of organic acids, as well as siderophore and phosphatase, can grow normally in a low-temperature environment of 6 °C, stably dissolve phosphorus at 10 °C, help plant growth, provides a new efficient means for soil phosphorus dissolution in alpine regions, and has good application prospects. Description of the Drawings

[0019] Figure 1 It is a Gram staining diagram of strain SE-P-4;

[0020] Figure 2 It is a schematic diagram of the phosphorus dissolution effect of strain SE-P-4 at different temperatures;

[0021] Figure 3 It is a schematic diagram of the change in the phosphatase activity secreted by strain SE-P-4. Detailed Embodiments

[0022] The present invention provides a new strain of Pseudomonas moorei SE-P-4. The strain SE-P-4 has strong low-temperature tolerance, can grow normally at a low temperature of 6°C, can stably secrete IAA, siderophores and phosphatases at 10°C, has the ability to secrete 26 organic acids, and can efficiently dissolve phosphorus.

[0023] The strain SE-P-4 was deposited on September 25, 2024 at the China General Microbiological Culture Collection Center (CGMCC), with the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 32074. The 16S rDNA sequence of the strain SE-P-4 is as shown in SEQ ID NO: 1.

[0024] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. If not specifically specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The data obtained are all averages obtained after at least 3 repetitions, and all repetitions obtained are valid data.

[0025] The media and reagents used in the present invention are as follows:

[0026] Inorganic phosphorus liquid medium: 10.0 g of glucose, 0.5 g of (NH4)2SO4, 0.3 g of KCl, 0.3 g of NaCl, 0.3 g of MgSO4·7H2O, 0.03 g of FeSO4·7H2O, 0.03 g of MnSO4·H2O, 10.0 g of Ca3(PO4)2, 1000 mL of deionized water, pH 7.0 - 7.5. For the corresponding solid medium, 15.0 g of agar is added.

[0027] Succinic acid medium: 6.0 g of K2HPO4, 3.0 g of KH2PO4, 1.0 g of (NH4)2SO4, 0.2 g of MgSO4·7H2O, 4.0 g of succinic acid, 1000 mL of deionized water, pH = 7.0.

[0028] CAS detection solution: Dissolve 21.9 mg of hexadecyltrimethylammonium bromide (HDTMA) in 25 mL of water, then add 1.5 mL of 1 mmol / L FeCl3 (containing 10 mmol / L HCl), 7.5 mL of 2 mmol / L chrome azurol S (CAS), and make up to 100 mL with deionized water.

[0029] Salkowski colorimetric solution: 15 mL of 0.5 mo1 / L FeC13, 300 mL of concentrated sulfuric acid (specific gravity 1.84), 500 mL of deionized water. Mix well and store in the dark.

[0030] Example 1: Screening and identification of microorganisms

[0031] 1. Screening

[0032] Weigh 1.0 g of soil from alpine regions and add it to a conical flask containing 100 mL of inorganic phosphorus liquid medium. Incubate with shaking at 28 °C and 180 r / min for 48 h. Using the 10-fold dilution method, prepare soil dilutions of 10 -8 、10 -9 and 10 -10 respectively. Pipette 0.2 mL of each soil dilution and spread it on the inorganic phosphorus solid medium. Repeat three times for each gradient. Incubate the plates upside down in an incubator at 10 °C. After 5 - 7 days, pick colonies with obvious phosphorus-dissolving halos and good growth, and transfer them to the inorganic phosphorus solid medium again using the streaking method. Subculture three times. Finally, 5 phosphate-solubilizing bacteria with strong phosphate-solubilizing ability are obtained (the 5 strains do not all come from the same alpine region), labeled as SE-P-1, SE-P-2, SE-P-3, SE-P-4, and SE-P-5 respectively, and stored on slants at 4 °C.

[0033] 2. Identification and physiological and biochemical characteristics

[0034] 1. Physiological and biochemical characteristics: Strain SE-P-4 is a Gram-negative bacterium. It forms pale yellow and opaque circular colonies on LB solid medium, with a smooth surface. The growth temperature range is 6 - 28 °C, and the pH tolerance range is 6 - 8; its Gram staining is as Figure 1 shown.

[0035] 2. 16S rRNA identification: Use the universal bacterial primers 27F (5’AGAGTTTGATCCTGGCTCAG 3’) and 1492R (5’TACGGCTACCTTGTTACGACTT 3’) for PCR amplification. The 16S rRNA sequence of SE-P-4 is shown in SEQ ID NO:1. Upload it to NCBI-BLAST for sequence alignment. The sequence similarity between strain SE-P-4 and the strain Pseudomonasmoorei strain IHB B 7208 with the closest sequence is 98.82%, and it is named Pseudomonasmoorei.SE-P-4. SE-P-1 to 5 are all identified as the genus Pseudomonas.

[0036] Example 2: Demonstration of the ability of strain SE-P-4 to dissolve calcium phosphate

[0037] Insoluble inorganic phosphate in the soil mostly exists in the form of calcium phosphate. In this example, calcium phosphate was selected as the phosphorus source to simulate the dissolution of poorly soluble phosphorus in the soil.

[0038] Inoculate the SE-P-4 strain preserved on the slant into 5 mL of LB medium, and incubate it overnight at 28 °C with shaking at 180 r / min. Adjust the OD 600 value to 0.6. Take 0.5 mL of the bacterial solution and inoculate it into 50 mL of inorganic phosphorus liquid medium, and culture it at 10 °C or 28 °C with shaking at 180 r / min. At the same time, set up a blank control group (CK): replace the bacterial solution with an equal volume of sterile water, and keep the other conditions the same. Each treatment was repeated 3 times, and the results were averaged. Every 24 h, the phosphorus content in the culture solution was measured by the molybdenum antimony anti-colorimetric method, and the measurement was continued for 9 days.

[0039] The results are as Figure 2 shown. The results show that after inoculating the strain SE-P-4 into the inorganic phosphorus liquid medium, at 10 °C, the phosphorus content in the solution reached the maximum value of 492.67 mg / L on the second day; at 28 °C, the phosphorus content in the solution reached the maximum value of 427.81 mg / L on the fifth day.

[0040] Example 3: Demonstration of the abilities of strain SE-P-4 to secrete siderophores, IAA, and acid phosphatase

[0041] 1. Ability to secrete siderophores: Inoculate the SE-P-4 strain preserved on the slant into 5 mL of LB medium, and incubate it overnight at 28 °C with shaking at 180 r / min. Adjust the OD 600 value to 0.6. Take 0.5 mL of the bacterial solution and culture it in 50 mL of succinic acid medium at 10 °C with shaking at 180 r / min. At the same time, set up a blank control group: replace the bacterial solution with an equal volume of sterile water, and keep the other conditions the same. Each treatment was repeated 3 times, and the results were averaged. Every 24 hours, take the bacterial solution and centrifuge it at 10000 r / min at 4 °C for 10 min. Take the supernatant and react it with an equal volume of CAS detection solution in the dark at room temperature for 4 h, and measure the OD 630 value (As) of the fermentation broth. The OD 630 value of the blank control group without adding the bacterial solution was used as the reference value (Ar). The relative content of siderophores was expressed by the As / Ar ratio. The lower the value, the greater the content of siderophores. Use “+” and “-” to indicate the ability and inability to produce siderophores respectively. When the As / Ar value is between 0 and 1.0, for every 0.2 decrease, one more “+” is added. The results are shown in Table 1.

[0042] Table 1 Comparison table of the siderophore production of the strain

[0043] Number of days 1 2 3 4 5 6 7 8 As / Ar 1.00 1.00 1.00 1.00 0.64 0.77 0.76 0.77 Siderophore production ability - - - - ++ ++ ++ ++

[0044] The results showed that when cultured in succinic acid medium, the growth of strain SE-P-4 started slowly. When there was more reproduction of the strain on the 5th day, it began to secrete siderophores and maintained stability.

[0045] 2. Ability to secrete IAA:

[0046] Drawing of the IAA standard curve: Weigh 10.000 mg of IAA standard sample, dissolve it with a small amount of ethanol, and make up the volume to 100 mL with deionized water to prepare a 0.1 g / L IAA stock solution. Respectively pipette 0, 2.5, 5, 7.5, 10, 12.5 mL of the stock solution and make up the volume to 25 mL in a volumetric flask to prepare standard solutions of 0, 10, 20, 30, 40, 50 mg / L. Pipette 1 mL of the standard solution and mix it with 4 mL of Salkowski color reagent, shake well, and let it stand in the dark at room temperature for 30 min. Measure the absorbance value at a wavelength of 530 nm. Draw a standard curve with the IAA standard solution concentration as the abscissa and the absorbance as the ordinate.

[0047] Inoculate the SE-P-4 strain preserved on the slant into 5 mL of LB medium, culture it overnight at 28 °C and 180 r / min, and adjust the OD 600 value to 0.8. Take 0.5 mL of the bacterial solution and put it into a conical flask containing 50 mL of LB medium with 1 g / L L-tryptophan, and culture it at 10 °C and 180 r / min for 3 replicates. After 7 days, take the bacterial solution and centrifuge it at 10000 r / min and 4 °C for 10 min. Take 1 mL of the supernatant and mix it with 4 mL of Salkowski colorimetric solution, shake well, let it stand in the dark at room temperature for 30 min, and measure the absorbance value at a wavelength of 530 nm. The results showed that strain SE-P-4 secreted a total of 6.76 ± 1.00 mg / L IAA after culturing at 10 °C for 7 days.

[0048] 3. Ability to secrete acid phosphatase:

[0049] Inoculate the SE-P-4 strain preserved on the slant into 5 mL of LB medium, culture it overnight at 28 °C and 180 r / min, and adjust the OD 600The value is 0.6. Take 0.5mL of bacterial liquid in a conical flask containing 50mL of inorganic phosphorus liquid culture medium, culture at 10℃, 180r / min, and repeat 3 times. Take 2mL of fermentation liquid every 24h and centrifuge at 10000r / min, 4℃ for 10min, take 0.2mL of supernatant after centrifugation to measure acid phosphatase activity. Under acidic conditions, 4-Methylumbelliferylphosphate disodium salt (4-Methylumbelliferylphosphate, 4-MUP) is hydrolyzed into 4-Methylumbelliferone (4-MU) and phosphate (Phosphate) under the action of acid phosphatase. The generated 4-MU is blue fluorescence with an excitation wavelength of 360nm and an emission wavelength of 460nm. The fluorescence intensity of acid phosphatase is proportional to the amount of 4-MU produced by its catalysis, so the activity of acid phosphatase can be calculated by detecting the fluorescence intensity of 4-MU.

[0050] The results are as follows Figure 3 The results showed that the phosphatase activity secreted by strain SE-P-4 was the highest on the first day, which was 5.20±0.68μmol / L·h.

[0051] Example 4: Demonstration of the ability of strain SE-P-4 to secrete organic acids

[0052] Take the strains SE-P-1 to 5 stored on the slant and inoculate them into 5 mL LB medium respectively, culture them at 28°C and 180 rpm overnight, and adjust the OD 600 The value was 0.6. 0.5 mL of each bacterial solution was inoculated into 50 mL of inorganic phosphorus liquid culture medium, cultured at 10°C and 180 r / min for 2 days, 2 mL of supernatant was aspirated, centrifuged at 10000 r / min and 4°C for 10 min, and filtered through a 0.22 μm filter membrane under a sterile environment. The organic acid content was determined by high performance liquid chromatography (Vanquish, UPLC, Thermo, USA) and high resolution mass spectrometry (Q Exactive, Thermo, USA). The results are shown in Table 2, unit: ng / mL.

[0053] Table 2 Comparison of the ability of each strain to secrete organic acids

[0054]

[0055]

[0056]

[0057] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the spirit of the design of the present invention, various deformations, variations, modifications, and substitutions made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A Pseudomonas moorei SE-P-4, characterized in that: The strain SE-P-4 was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on September 25, 2024, with the deposit number of CGMCC No. 32074.

2. A Pseudomonas moorei SE-P-4, characterized in that: The 16S rDNA sequence of the strain SE-P-4 is shown as SEQ NO ID:

1.

3. A bacterial preparation prepared by using the Pseudomonas moorei according to claim 1 or 2.

4. A bacterial preparation comprising the Pseudomonas moorei according to claim 1 or 2.

5. A method for dissolving insoluble phosphate by using the Pseudomonas moorei according to claim 1 or 2 or the bacterial preparation according to claim 3 or 4.

6. A method for preparing phosphatase by using the Pseudomonas moorei according to claim 1 or 2 or the bacterial preparation according to claim 3 or 4.

7. A method for preparing siderophore by using the Pseudomonas moorei according to claim 1 or 2 or the bacterial preparation according to claim 3 or 4.

8. A method for preparing organic acid by using the Pseudomonas moorei according to claim 1 or 2 or the bacterial preparation according to claim 3 or 4.

9. A method for preparing indole acetic acid by using the Pseudomonas moorei according to claim 1 or 2 or the bacterial preparation according to claim 3 or 4.

10. The method according to any one of claims 5 to 9, characterized in that: The application temperature of the method is 10-28 °C; and / or; the pH is 4-8.

Images