Application of rice endogenous oligopeptide in induction of rice blast resistance

Abstract

The invention discloses application of a rice endogenous oligopeptide in inducing rice to resist rice blast. A rice gene Bphi008a is knocked out by adopting CRISPR / Cas9, pyricularia grisea living injury inoculation experiments are respectively carried out on wild type and Bphi008a gene knockout mutant plants, and the result shows that the Bphi008a gene knockout mutant plants show a susceptible phenotype to pyricularia grisea, which indicates that the gene positively regulates the resistance of rice to pyricularia grisea. Furthermore, an oligopeptide containing 39 amino acids is designed and synthesized on the basis of the encoding protein of the Bphi008a gene. Oligopeptide with the final concentration of 10 mu g / mL is exogenously added into rice seedlings, and expression of rice resistance related PR genes (OsPR1a, OsPR5, OsPR10a and OsPAL06) can be quickly activated after the rice seedlings are treated by the ligopeptide for 6 hours. After the oligopeptide is treated for 24 hours, pyricularia oryzae is inoculated by spraying, and the application of the oligopeptide can obviously enhance the resistance of the rice to the pyricularia oryzae. In addition, 100 [mu] g / mL of short peptide has an obvious inhibition effect on the growth of bacterial blight. The results show that the oligopeptide has an application value of being developed into a novel biological resistance inducer and a bacteriostatic agent.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of an endogenous short peptide of rice in inducing resistance to rice blast disease. Background Art

[0002] Rice ( Oryza sativa ) is one of the most important food crops in the world and also a model crop for genomic function research. Rice blast disease is a fungal disease caused by Magnaporthe oryzae . It can occur throughout the growth period of rice and can be mainly divided into: seedling blast, leaf blast, and panicle neck blast according to the infection period and part. Currently, the control of rice blast disease mainly relies on chemical pesticides such as tricyclazole, isoprothiolane, prochloraz, pyraclostrobin, difenoconazole, and kasugamycin. The long-term and excessive use of chemical pesticides not only increases production costs, pollutes the environment, but also disrupts the ecological balance, leading to a series of agricultural ecological safety problems.

[0003] Short peptides / polypeptides are a class of compounds formed by multiple amino acid molecules connected by peptide bonds. The currently commercialized hypersensitive short peptide is the peptide segment in the Harpin protein secreted by plant bacterial pathogens through the type III secretion system that can externally induce plant cell death (i.e., hypersensitive response). The hypersensitive short peptide activates the plant immune response and enhances the plant's defense ability against pathogens to achieve the effect of disease prevention and control. Plant endogenous defense short peptides are natural immune signal molecules derived from plants that can induce plant resistance. Most plant short peptides are derived from longer precursors with unknown biological functions. Plant endogenous defense short peptides are mainly divided into two categories: post-translationally modified small peptides and cysteine-rich peptides. Cysteine-rich peptides are characterized by a Cys-rich domain containing 2 to 16 Cys residues, and their number varies greatly depending on the peptide length and plant species. They are mainly divided into three categories: (1) PDFs (PLANT DEFENSINS) have antibacterial activity, not only because they can bind to intracellular targets in host cells to trigger defense signals, but also because they can interact with various fungal sphingolipids and phospholipids; (2) RALF (RAPID ALKALINIZATION FACTOR) contains four conserved Cys residues, can establish two disulfide bonds, and significantly induces plant resistance; (3) EPF (EPIDERMAL PATTERN FACTOR) and EPFL (EPF-LIKE) can regulate the plant's immune response to pathogens. Therefore, screening for short peptides that promote rice blast disease resistance based on rice functional genomics is of great significance for the development of green and safe crop disease control agents.

[0004] Bphi008aThe gene is located on chromosome 6 of rice and can enhance the resistance of rice to the brown planthopper. In the present invention, the gene was cloned from the rice variety Zhonghua 11, and it was found that the amino acid sequence it encodes is the same as the functional Bphi008a coding protein sequence reported in the rice variety Minghui 63 in the article. Bphi008a There are many reports on the gene in terms of resistance to the brown planthopper, but there are few studies on its function in response to pathogen stress, and there is no report on its function in plant immune regulation at present. SUMMARY OF THE INVENTION

[0005] The purpose of the present invention is to provide an endogenous short peptide of rice and its application in rice blast resistance. Specifically, the CRISPR / Cas9 method was used to Bphi008a knock out the gene and conduct further resistance identification, and it was clarified that the Bphi008a gene has a positive regulatory function on rice blast resistance. An active segment of the protein encoded by this gene was used to design and synthesize a short peptide (BP39a) containing 39 amino acids, and this short peptide can significantly enhance the resistance of rice to Magnaporthe oryzae.

[0006] To achieve the above purpose, the following technical solutions are adopted: Bphi008a Application of the gene in regulating the resistance of rice to Magnaporthe oryzae, wherein the Bphi008a open reading frame nucleotide sequence of the gene is shown as SEQ ID NO.1, and the amino acid sequence it encodes is shown as SEQ ID NO.2.

[0007] A method for reducing the resistance of rice to Magnaporthe oryzae, the steps are as follows: Select two target sites in the open reading frame coding region of the Bphi008a gene, construct a Bphi008a gene knockout vector, transform the vector into Agrobacterium tumefaciens, and obtain a Bphi008a gene knockout mutant through the Agrobacterium-mediated transformation technology of rice mature embryos.

[0008] Furthermore, the sequences of the target sites are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0009] Application of the endogenous short peptide BP39a of rice in enhancing the resistance of rice to Magnaporthe oryzae, wherein the amino acid sequence of the endogenous short peptide BP39a of rice is shown as SEQ ID NO.5.

[0010] A method for improving the resistance of rice to Magnaporthe oryzae, the steps are as follows: Exogenously add the endogenous short peptide BP39a of rice to hydroponic rice seedlings, and the amino acid sequence of the endogenous short peptide BP39a of rice is shown as SEQ ID NO.5.

[0011] Furthermore, the final concentration of the endogenous rice short peptide BP39a is 10 μg / mL, and the hydroponic rice seedlings are 18 days old.

[0012] Furthermore, the endogenous rice short peptide BP39a enhances the resistance of rice to Magnaporthe oryzae by activating rice resistance-related genes OsPR1a , OsPR5 , OsPR10a and OsPAL06 expression.

[0013] Application of the endogenous rice short peptide BP39a in inhibiting the growth of Xanthomonas oryzae pv. oryzae, the amino acid sequence of the endogenous rice short peptide BP39a is as shown in SEQ ID NO.5.

[0014] Furthermore, the concentration of the endogenous rice short peptide BP39a is 100 μg / mL.

[0015] The present invention has the following beneficial effects: The present invention uses CRISPR / Cas9-mediated gene editing technology to knockout rice Bphi008a gene, and it is clear that this gene has a positive regulatory function in rice resistance to rice blast. This gene encodes a protein of 82 amino acids, with a transmembrane domain at its N-terminus and 4 cysteines in its C-terminal sequence. Based on the analysis of the C-terminal amino acid sequence of this protein, the present invention designed and synthesized a short peptide (BP39a) containing 39 amino acids, which contains these 4 cysteines. Exogenously applied to hydroponic rice seedlings in the form of an aqueous solution of the short peptide, it can rapidly activate the expression of rice resistance-related PR genes 6 hours after the short peptide treatment, with a fast response rate, and significantly enhances the resistance of rice to Magnaporthe oryzae after applying the short peptide. Hydroponic absorption can induce rice resistance, avoiding the problem of degradation loss in traditional foliar spraying, and having high delivery efficiency. In addition, after treating Xanthomonas oryzae pv. oryzae with this short peptide, an obvious antibacterial effect is shown. Therefore, this short peptide has the application value of being developed into a new biological elicitor and antibacterial agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 After 24 hours of spraying and inoculating rice with Magnaporthe oryzae, Bphi008a the transcriptional level of the gene is up-regulated compared with the control treatment.

[0017] Figure 2 is bphi008a identification of knockout mutants; where ZH11 is the reference gene sequence; bphi008a-1 and bphi008a-2 are Bphi008a homozygous mutant lines of the gene.

[0018] Figure 3 is Bphi008aInvestigation results of inoculating Magnaporthe oryzae on living plants with homozygous mutant plants of genes, where ZH11: Zhonghua 11, a wild-type rice material; bphi008a-1 and bphi008a-2 : bphi008a Homozygous mutant plants; (a) Diseased leaves 7 days after punching and inoculating Magnaporthe oryzae; (b) Statistical analysis of fungal biomass.

[0019] Figure 4 For the rice endogenous short peptide (BP39a) added exogenously to hydroponic seedlings at a final concentration of 10 μg / mL, the relative expression levels of genes were detected by RT-qPCR after 6 h of treatment; (a) PR ; (b) OsPR1a ; (c) OsPR5a ; (d) OsPR10a ; (d) OsPAL06 , where Mock: Hydroponic rice seedlings without treatment; BP39a: Hydroponic rice seedlings treated with short peptides.

[0020] Figure 5 Investigation results of spraying and inoculating Magnaporthe oryzae 24 h after adding the rice endogenous short peptide (BP39a) to hydroponic seedlings at a final concentration of 10 μg / mL; (a) Leaf phenotypes after spraying and inoculating Magnaporthe oryzae after short peptide treatment; (b) Statistical analysis of fungal biomass; where Mock: Hydroponic rice seedlings without treatment; BP39a: Hydroponic rice seedlings treated with short peptides.

[0021] Figure 6 Effects of the rice endogenous short peptide (BP39a) at a final concentration of 100 μg / mL on the growth of Xanthomonas oryzae pv. oryzae; (a) Growth of Xanthomonas oryzae pv. oryzae on petri dishes after short peptide treatment; (b) Statistical analysis of the growth amount of Xanthomonas oryzae pv. oryzae; where Mock: Xanthomonas oryzae pv. oryzae without short peptide treatment; BP39a: Xanthomonas oryzae pv. oryzae treated with short peptides at a final concentration of 100 μg / mL. Detailed implementation manners

[0022] To make the content of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation manners, but the present invention is not limited thereto.

[0023] Example 1 Bphi008a Obtaining of genes When analyzing the genes with up-regulated transcriptional levels in rice infected by Magnaporthe oryzae, we found that the transcriptional levels of the Bphi008a (LOC_Os06g29730) gene were significantly up-regulated compared with the control treatment 24 and 48 hours after spraying and inoculating Magnaporthe oryzae. The results are shown in Figure 1 as follows.

[0024] According to the predicted cDNA sequence (AK063797) of this gene in the genome of the rice cultivar Nipponbare on the NCBI website, we successfully cloned from the total cDNA of the leaves of Zhonghua 11 rice Bphi008a open reading frame, with a full length of 249 bp. The Bphi008a nucleotide sequence of the open reading frame of the gene is shown in SEQ ID NO.1; the amino acid sequence encoded by it is shown in SEQ ID NO.2. The amino acid sequence encoded by it is identical to the protein sequence of the functional Bphi008a in the rice cultivar Minghui 63 reported in the article. The primers used for cloning the Bphi008a open reading frame have the following nucleotide sequences: Bphi008aORF-F: 5’- ATGGCGTCTCTTAGAGCCAC-3’ (SEQ ID NO.6); Bphi008aORF-R: 5’- TTATGGATCACCCATCCGTCC -3’ (SEQ ID NO.7).

[0025] Example 2 Bphi008a Construction of knockout vector Two target sites were selected in the coding region of the open reading frame of the Bphi008a gene (the target sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively), a gRNA expression cassette was constructed, and then the two target gRNA expression cassettes were ligated into the knockout vector C025 to obtain the Bphi008a knockout vector. The specific steps are as follows: A. Synthesize the fragment of the gene target sequence + the linearized backbone recombination arm sequence of the vector (C025). According to the C025 vector sequence, primers with recombination arms were synthesized (the primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9 respectively), and the promoter and two gRNA fragments were obtained by amplifying the template. Bphi008a

[0026] B. Digest the backbone vector C025 (Weimi Biotechnology Co., Ltd.) with BsaⅠ restriction endonuclease. The enzyme digestion reaction system is as follows: React at 37°C for 30 min, and the product was recovered to obtain a linear vector.

[0027] C. Recombinant ligate the target fragment with the promoter and gRNA (containing homologous recombination arms) and the linear vector by DNA homologous recombination to obtain the desired vector.

[0028] ​After the PCR instrument runs the recombinant program at 50 °C for 20 min, it is stored at 4 °C.

[0029] D. Transformation of DH5α: More than 10 μL of the ligation product + 100 μL of Escherichia coli competent cells. After taking out the competent DH5α from the refrigerator, quickly place it on ice. After 5 minutes, wait for the bacterial mass to dissolve, add the ligation product, let it stand on ice for 25 min, heat shock at 42 °C for 45 s, place it on ice for 2 min (do not shake), add 100 μL of antibiotic-free LB liquid medium, shake the bacteria at 37 °C and 200 rpm for 1 h, spread on the plate (LB solid medium + bacterial antibiotic), and culture at 37 °C for one day.

[0030] E. Picking colonies: Randomly pick 12 monoclonal colonies from the plate and put them into 2 ml sterile EP tubes. Add 500 μL of LB liquid medium in advance, shake the bacteria for 6 hours, use SEQ ID NO.10 and SEQ ID NO.11 primers for sequencing to determine that the clone construction is correct, and obtain the recombinant plasmid.

[0031] SEQ ID NO.10: 5’-ctggcgaaagggggatgtgctgcaa-3’; SEQ ID NO.11: 5’-ttcaaacaagtgtgacaaaaa-3’.

[0032] Example 3 Bphi008a Obtaining of knockout mutants Transform the recombinant plasmid with correct sequencing results into Agrobacterium tumefaciens EHA105.

[0033] A. 20 μL of Agrobacterium competent cells + 1 μL of recombinant plasmid, ice bath for 5 min, quick freeze in liquid nitrogen for 5 min, water bath at 37 °C for 5 min, ice bath for 5 min. Add 100 μL of antibiotic-free LB liquid medium, shake the bacteria at 28 °C and 200 rpm for 2 h, and directly spread on the corresponding plate containing bacterial antibiotic + rifampicin, and culture at 28 °C for two days.

[0034] B. After two days, pick a monoclonal colony and put it into a 5 mL sterile EP tube. Add 2 mL of the corresponding LB liquid medium containing bacterial antibiotic + rifampicin in advance, shake the bacteria overnight, and send the Agrobacterium liquid for sequencing. After verification, perform the transformation of callus of rice japonica variety Zhonghua 11 to obtain Bphi008a Gene knockout mutants.

[0035] Example 4 Bphi008a Verification of knockout mutants In Bphi008aFor each of the two target sites of the gene, a pair of primers was designed near the front and back ends, and used to amplify target site 1 (the amplification primer sequences are shown in SEQ ID NO.12 and SEQ ID NO.13) and target site 2 (the amplification primer sequences are shown in SEQ ID NO.14 and SEQ ID NO.15), respectively. Using Bphi008a the genomic DNA of the T0 generation plants of the knockout mutant as a template, PCR amplification was performed. After sequencing and alignment of the PCR products, 2 homozygous mutants were screened out, and the mutation types were bphi008a-1 insertion of T at target site 1 (gRNA-1) and insertion of A at target site 2 (gRNA-2); bphi008a-2 insertion of T at target site 1 and deletion of G at target site 2. The results are shown in Figure 2 Figure [Figure number not provided in the original, assumed to be inserted here].

[0036] The PCR amplification program was as follows: Example 5 Bphi008a Identification of the resistance of knockout mutants to Magnaporthe oryzae by punching and inoculation Rice Zhonghua 11 (ZH11) and bphi008a the knockout mutants ( bphi008a-1 and bphi008a-2 ) were planted in an artificial incubator. After 4 weeks of cultivation, an inoculation experiment with Magnaporthe oryzae was carried out. Wounding in vivo (puncturing with a small punch to leave a wound on the leaf surface) was performed at a position 1 / 3 from the leaf tip to facilitate the infection of Magnaporthe oryzae. 10 μL of the spore suspension of Magnaporthe oryzae Guy11 (concentration about 2×10 5 spores / mL) was dropped on the wound, and then the leaf at this position was wrapped into a small chamber with transparent tape. The inoculated rice was transferred to normal light conditions for continued cultivation, and the disease incidence was investigated 7 - 10 days later. The results are shown in Figure 3 Figure [Figure number not provided in the original, assumed to be inserted here]. Compared with the wild-type rice Zhonghua 11, bphi008a the lesion area on the leaves of the knockout mutants was significantly larger, proving that Bphi008a after gene knockout, the resistance of rice to Magnaporthe oryzae decreased. The above results indicate that Bphi008a the gene positively regulates the resistance of rice to Magnaporthe oryzae.

[0037] Example 6 Functional identification of the function of an endogenous short peptide in rice in inducing resistance to rice blast A 39-amino acid short peptide (BP39a) designed and synthesized based on the coding protein of the rice blast resistance gene Bphi008a in rice, and its amino acid sequence is shown in SEQ ID NO.5. First, the short peptide was dissolved in deionized water to prepare a short peptide mother solution with a concentration of 5 mg / mL.

[0038] Co-39 rice seedlings that had been germinated for one week were cultured in an artificial intelligence incubator by hydroponics for 18 days. A short peptide (BP39a) with a final concentration of 10 μg / mL was added to the hydroponic solution, while the Mock treatment did not add the short peptide. Samples were taken after 6 h of treatment, total RNA was extracted, reverse transcribed into cDNA, and RT-qPCR was used to detect the expression levels of resistance-related PR genes. The experimental results are shown in Figure 4 . The treatment with the short peptide (BP39a) significantly induced the expression of OsPR1a , OsPR5a , OsPR10a and OsPAL06 genes. After 24 h of short peptide treatment, a spore suspension of Magnaporthe oryzae Guy11 (concentration approximately 3×10 5 per milliliter) was spray-inoculated onto the rice seedlings. The inoculated rice seedlings were treated in the dark and at 75% relative humidity for 24 h, and then the leaf disease phenotypes were recorded after being cultured in a normal artificial intelligence greenhouse for about 3 days. The leaf lesion areas were statistically analyzed using Image J. The experimental results are shown in Figure 5 . Compared with the Mock, the incidence of rice disease was significantly reduced after short peptide treatment, and the number of lesions was significantly decreased, indicating that the short peptide can enhance the resistance of rice to Magnaporthe oryzae.

[0039] Example 7: The endogenous short peptide of rice has a significant inhibitory effect on the growth of Xanthomonas oryzae pv. oryzae The Xanthomonas oryzae pv. oryzae strain Pxo86 was cultured in a liquid medium for Xanthomonas oryzae pv. oryzae (20 g / L sucrose, 5 g / L peptone, 0.5 g / L ferrous sulfate heptahydrate, 0.5 g / L calcium nitrate tetrahydrate, 2 g / L disodium hydrogen phosphate; pH = 6.8 - 7.0) at 28°C with shaking until the OD 600 reached 1.0. The bacterial solution concentration was diluted to 10 -7 in a laminar flow hood, and then a short peptide with a final concentration of 100 μg / mL was added. 10 μL of the bacterial solution was dropped onto the solid medium for Xanthomonas oryzae pv. oryzae, and the number of colonies was counted after culturing in an incubator at 28°C for 2 days. The experimental results are shown in Figure 6 . Compared with the Mock, the number of Xanthomonas oryzae pv. oryzae bacteria was significantly reduced after short peptide treatment, indicating that the short peptide can inhibit the growth of Xanthomonas oryzae pv. oryzae.

[0040] The above are only the preferred embodiments of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope covered by the present invention.

Claims

1. Bphi008a Use of a gene in regulating the resistance of rice to Magnaporthe oryzae, characterized in that: The said Bphi008a The nucleotide sequence of the open reading frame of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.

2.

2. A method for reducing the resistance of rice to Magnaporthe oryzae, characterized in that: In Bphi008a two target sites were selected from the open reading frame coding region of the Bphi008a gene to construct a Bphi008a gene knockout vector. The vector was transformed into Agrobacterium tumefaciens, and gene knockout mutants were obtained through Agrobacterium-mediated transformation of mature rice embryos.

3. The method according to claim 2, wherein: The sequences of the target sites are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

4. Use of the endogenous short peptide BP39a of rice in enhancing the resistance of rice to Magnaporthe oryzae, characterized in that: The amino acid sequence of the rice endogenous short peptide BP39a is shown as SEQ ID NO.

5.

5. A method for improving the resistance of rice to Magnaporthe oryzae, characterized in that: The rice endogenous short peptide BP39a was added exogenously to hydroponically grown rice seedlings, and the amino acid sequence of the rice endogenous short peptide BP39a is shown as SEQ ID NO.

5.

6. The method according to claim 5, characterized in that: The final concentration of the rice endogenous short peptide BP39a was 10 μg / mL, and the hydroponically grown rice seedlings were 18 days old.

7. The method according to claim 5, wherein: The endogenous rice short peptide BP39a enhances the resistance of rice to Magnaporthe oryzae by activating the expression of rice resistance-related genes OsPR1a 、 OsPR5 、 OsPR10a and OsPAL06 .

8. Use of the endogenous short peptide BP39a of rice in inhibiting the growth of Xanthomonas oryzae pv. oryzae, characterized in that: The amino acid sequence of the rice endogenous short peptide BP39a is shown as SEQ ID NO.

5.

9. The application according to claim 8, characterized in that: The concentration of the rice endogenous short peptide BP39a was 100 μg / mL.

Images