Common PCR (Polymerase Chain Reaction) method for detecting Lawsonia intracellular bacteria in pig farm
A simplified PCR method for detecting Lawsonia intracellularis in pig feces using PBS dilution and optimized thermal denaturation addresses the inefficiencies of current methods, providing a cost-effective and reliable detection solution.
Patent Information
- Application Number
- CN202510662063.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2025-07-15
AI Technical Summary
The existing pig farms have cumbersome operation and require the use of toxic reagents. The technical requirements are high and the cost is high, making it difficult to widely use in ordinary pig farms.
The fecal samples were diluted with PBS buffer, combined with thermal denaturation and high-speed centrifugation, and PCR amplification was performed directly. Specific primers were used to detect intracellular bacteria of Lawson, simplifying the operation process and reducing instrument requirements.
It realizes efficient, economical and simple Lawson's intracellular bacteria detection in ordinary pig farms, reduces the health risks to operators, improves the repetition and accuracy of the test, and is suitable for rapid detection of fecal samples.
Smart Images

Figure CN120310941A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a PCR method for detecting Lawsonia intracellularis in pig farms. Background Art
[0002] Lawsonia intracellularis is a contagious disease of pigs, showing global sporadic or epidemic distribution. Lawsonia intracellularis mainly infects pigs, followed by animals such as hamsters, horses, deer, foxes, ferrets, rats, rabbits, monkeys, ostriches, emus, mice, guinea pigs, and lambs. Porcine proliferative enteropathy (PPE) is a common contagious intestinal disease of pigs characterized by adenomatous hyperplasia of immature intestinal cells in the crypts of the ileum and colon caused by infection with Lawsonia intracellularis (LI). Porcine proliferative enteritis occurs worldwide, especially in countries and regions such as Europe and America. The incidence of the disease in pig farms in Asian countries is also increasing year by year. Although the mortality rate of porcine proliferative enteropathy is not high, it seriously affects the growth of diseased pigs, causing certain economic losses to the pig farming industry. It has also been proven that the disease exists in China, and the current infection rate in China is relatively high, causing significant economic losses to ordinary pig farms.
[0003] The pathogenic detection of Lawsonia intracellularis in clinic mainly includes: antigen detection of feces and antibody detection of blood. Common antibody detection methods include immunochromatography, indirect immunofluorescent antibody test, enzyme-linked immunosorbent assay, radioimmunoassay, etc. Among them, the commonly used method is to detect related antibodies by indirect immunofluorescent antibody test (IFA). The IFA of Lawsonia intracellularis antibody uses purified Lawsonia intracellularis antigen to detect the corresponding IgM or IgG of Lawsonia intracellularis, which has the advantages of high sensitivity and strong specificity. Lawson et al. (Lawson G H, McOrist S, Rowland A C, et al. Serological diagnosis of the porcine proliferative enteropathies: implications for aetiology and epidemiology[J]. Veterinary Record, 1988, 122(23):554-557) used the IFA test to detect antibodies in pigs artificially infected with LI, and the results showed that the antibodies that appeared early were mainly IgM. Knittel et al. (Knittel J P, Jordan D M, Schwartz K J, et al. Evaluation of antemortem polymerase chain reaction and serologic methods for detection of Lawsonia intracellularis-exposed pigs[J]. Am J Vet Res, 1998, 59(6):722-726) used purified LI culture as antigen, porcine serum as the first antibody, and FITC-labeled anti-porcine IgG antibody as the second antibody to improve IFA, and could detect the IgG antibody of LI. IFA has high specificity and sensitivity, but there are also some disadvantages, such as high requirements for operation and instruments, and false positives caused by non-specific staining in the results (Zhuang Jinqiu, Mei Jianguo, Yao Chunyang, et al. Research progress on laboratory diagnosis methods of porcine proliferative enteritis[J]. Swine Production, 2022, 06:121-128. DOI:10.13257). The antigen detection of Lawsonia intracellularis in feces refers to: collecting feces from suspected infected pigs, conducting corresponding treatment and identification, and mainly using PCR detection clinically. The PCR detection of Lawsonia intracellularis in feces mainly includes: feces treatment, PCR amplification of the target fragment, and identification of the target fragment.There are generally three conventional treatment methods for fecal samples in the PCR detection of Lawsonia intracellularis. The first method is to remove the fecal residue after low-speed centrifugation, then act with SDS and proteinase K, and then perform phenol-chloroform extraction multiple times. After ethanol precipitation of DNA and re-dissolution with distilled water, it is used as the PCR template. The second method is to remove the fecal sediment after low-speed centrifugation, then perform high-speed centrifugation, enrich bacteria multiple times to remove inhibitors, lyse with SDS, remove the sediment after centrifugation, add proteinase K for digestion, and after the digestion is completed, use an equal volume of phenol-chloroform extraction, ethanol precipitate DNA, and re-dissolve with distilled water to be used as the PCR template. The third method is to directly extract DNA from feces using an extraction kit. The first two methods both use phenol-chloroform extraction. Although these two reagents are common reagents and drugs in the laboratory, the operation is cumbersome, and chloroform has strong volatility and high toxicity. Prolonged operation will have a greater impact on the health of operators. If the system is large, the repeatability among different operators is poor, which is not conducive to operation. The third method uses a kit for DNA extraction. The DNA extracted in this way is conducive to preservation and can be stored for a long time, but the cost is high. Summary of the Invention
[0004] Object of the Invention: Aiming at the deficiencies of the prior art, the present application provides a simple detection method for Lawsonia intracellularis in feces of ordinary pig farms. This solution is economical, simple to operate, has low instrument requirements, and can detect without DNA extraction.
[0005] In order to solve the above technical problems, the present invention discloses a simple detection method for Lawsonia intracellularis in feces of ordinary pig farms, which includes the following steps:
[0006] (1) Dilute the fecal sample to be detected with PBS buffer and centrifuge to obtain the supernatant.
[0007] (2) Heat-denature the supernatant obtained in step (1) and then cool it.
[0008] (3) Using the sample obtained in step (2) as a template, use primer 1 as the amplification primer for PCR amplification range, wherein the primer 1 sequence is:
[0009] Forward primer: ATACCCTGGTAGTCCACGCT;
[0010] Reverse primer: GTCTTGCTGCCCTTTGTGTG;
[0011] (4) Separate the amplified product by agarose gel electrophoresis. If a product of 473 bp can be specifically amplified, it is determined that Lawsonia intracellularis exists in the detected sample.
[0012] Among them, in step (1), each gram of fecal sample to be detected is diluted with 1.5 - 4.5 mL of PBS buffer.
[0013] Preferably, each gram of the fecal sample to be detected is diluted with 4.5 mL of PBS buffer.
[0014] In step (1), the centrifugation conditions are: centrifuging at 800 - 1000 rpm for 8 - 10 min. Preferably, centrifuge at 1000 rpm for 10 min to obtain the supernatant.
[0015] More preferably, in step (1), the obtained supernatant is further centrifuged at 8000 - 10000 rpm for 5 - 8 min, the sediment is taken, PBS buffer is added and mixed evenly, and the obtained mixed solution is then subjected to the operation of step (2).
[0016] Preferably, in step (2), the conditions for heat denaturation are: 95 °C for 6 - 8 min.
[0017] In step (2), the conditions for heat denaturation are: 95 °C for 6 min.
[0018] The PCR reaction system is as follows: a 25 μL reaction system, pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 30 s, for a total of 40 cycles, and finally extension at 72 °C for 5 min.
[0019] Preferably, after sampling, the sample to be detected is stored refrigerated and detected within one week.
[0020] In a preferred embodiment, the fecal sample to be detected is diluted with PBS buffer at a ratio of 1:4.5, centrifuged to obtain the supernatant, first centrifuged at 800 - 1000 rpm for 8 - 10 min, after taking the supernatant, the supernatant is further centrifuged at 8000 - 10000 rpm for 5 - 8 min, the sediment is taken, then PBS buffer is added and mixed evenly, and then heat denaturation is carried out. The conditions for heat denaturation are: 95 °C for 6 min.
[0021] Beneficial effects: The present application optimizes the detection method of Lawsonia intracellularis according to the screening of primers, dilution concentration, different heat denaturation procedures, and the selection of high-speed centrifugation, and selects the most suitable PCR method for detecting Lawsonia intracellularis in ordinary pig farms, without the need for DNA extraction. Compared with the prior art, which either requires the use of toxic reagents, has a cumbersome operation, high requirements for technicians, or requires DNA extraction, the method of the present invention only requires simple direct dilution and centrifugation, has a simple operation, low requirements for the technical level of operators, high repeatability, an economical scheme, simple operation, and low requirements for instruments, and is applicable to the detection of Lawsonia intracellularis in feces of ordinary pig farms. Description of the Drawings
[0022] Figure 1Electrophoresis results of PCR amplification products with different primers. Among them, lane M is DL2000 DNA Marker, lane 1 is the amplification product of primer 1; lane 2 is the amplification product of primer 2; lane 3 is the amplification product of primer 3; lane 4 is the amplification product of primer 4; lane 5 is the amplification product of primer 5;
[0023] Figure 2 Electrophoresis results of different heat denaturation procedures. Among them, lane M is DL2000 DNA Marker, lanes 1, 2, 3, 4 are the amplification products after heat denaturation at 95°C for 6 min after low-speed centrifugation; lanes 5, 6, 7, 8 are the amplification products at 95°C for 9 min; lanes 9, 10, 11, 12 are the amplification products at 95°C for 3 min; the dilution concentrations are 1:1.5, 1:3, 1:4.5, 1:6; lanes 13, 14 are the amplification products after heat denaturation at 85°C for 10 min after low-speed centrifugation, and the dilution concentrations are 1:1.5, 1:4.5;
[0024] Figure 3 Electrophoresis results of different heat denaturation procedures. Lane M is DL2000 DNA Marker; lanes 1, 2, 3, 4 are the amplification products after heat denaturation at 95°C for 3 min after low-speed centrifugation; lanes 5, 6, 7, 8 are the amplification products at 95°C for 6 min; lanes 9, 10, 11, 12 are the amplification products at 85°C for 10 min; the dilution concentrations are 1:1.5, 1:3, 1:4.5, 1:6;
[0025] Figure 4 Electrophoresis results of high-speed centrifugation and low-speed centrifugation. Lane M is DL2000 DNA Marker; lanes 1, 2, 3 are the amplification products of the supernatant samples without high-speed centrifugation; lanes 4, 5, 6 are the amplification products after high-speed centrifugation;
[0026] Figure 5 Electrophoresis results. Lane M is DL2000 DNA Marker; lane 1 is the amplification product of the frozen negative sample, lanes 2, 4 are the amplification products of the weakly positive frozen samples, lanes 3, 5 are the amplification products of the strongly positive frozen samples, lanes 6 / 7 / 8 are the amplification products of the feces refrigerated for 1 month;
[0027] Figure 6 Specific experimental results of the ordinary PCR detection method. Specific embodiments
[0028] The present invention will be further specifically described below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become clearer.
[0029] Sample collection: The test samples were positive feces from pigs with clinical symptoms and positive samples with DNA extraction completed in the previous experiment, and DNA samples were extracted. The fattening pigs for sampling were fixed by the standing fixation method. A rope as thick as a chopstick was tied with a slipknot at one end. During fixation, one person grasped the pig's two ears and lifted them upward. When the pig howled, the slipknot of the rope was immediately put on the pig's upper jaw and tightened, and the rope end was buckled on the pen. At this time, the pig would step back. When the pig stepped back to a certain extent, the rope would contract and tighten, and it would stand still. An aseptic container was placed under the anus, and when it defecated, about 30 g of feces was collected with an aseptic sampling spoon and put into an aseptic fecal sampling tube, and then stored in a refrigerator at 5°C.
[0030] For the piglets in the previous experiment, feces were collected by hanging fixation. According to the weight of the piglets, the corresponding hammock was selected, and its anus was exposed. An aseptic container was placed under the anus. After it defecated, about 30 g of feces was collected with an aseptic sampling spoon and put into an aseptic fecal sampling tube, and then stored in an ultra-low temperature freezer.
[0031] Example 1 Establishment of a common PCR detection method for detecting Lawsonia intracellularis in pig farms.
[0032] (I) Feces treatment:
[0033] Prepare autoclaved 1.5 mL EP tubes, and take out the frozen (-20°C) 96-well EP tube rack from the refrigerator. Place the 1.5 mL EP tubes in the 96-well EP tube rack (produced by Nantong Haikelasi Experimental Equipment Co., Ltd.). Place the 1.5 mL EP tubes containing feces on ice and operate on ice. The specific operations are as follows:
[0034] (1) Weigh four portions of 0.5 g of feces from the fecal sampling tubes and place them in 1.5 mL EP tubes (on ice) respectively. Add PBS buffer according to the ratio (mass-volume ratio), which are 1:1.5, 1:3, 1:4.5, and 1:6 respectively. Use a pipette to aspirate and blow repeatedly to homogenize them. After mixing, put them into a centrifuge, centrifuge at 1000 rpm for 10 min. After centrifugation, remove the residue and retain the supernatant. The supernatant after low-speed centrifugation is divided into six groups.
[0035] (2) Take the supernatant after low-speed centrifugation from 3 of the groups and perform heat denaturation with different procedures. Put them into a water bath at 95°C for 3 min, 95°C for 6 min, 95°C for 9 min, and 85°C for 10 min respectively. After the water bath, wait for it to cool quickly and store it in a refrigerator at -20°C for later use.
[0036] (3) Take the supernatant of the other three groups of low-speed centrifugation, put it into a centrifuge, and further perform high-speed centrifugation at 10,000 rpm for 5 minutes. After centrifugation, slowly aspirate the supernatant multiple times with a 200 μL pipette, retain the sediment, and add 30 μL of PBS buffer to mix well.
[0037] (3) Heat-denature the sample after high-speed centrifugation and mixing. Place it in a water bath and perform heat denaturation at 95 °C for 6 minutes. After the water bath, wait for it to cool and store it in a refrigerator freezer (-20 °C) for later use.
[0038] For those fecal samples in the preliminary investigation experiment, extract them using a fecal DNA kit (Omega Biotech Co., Ltd.). The specific steps are as follows: Take 200 mg of fecal sample in a 2 mL centrifuge tube, add 200 mg of glass beads (on ice), add 540 μL of SLX-MLus Buffer, and oscillate for 15 minutes until the fecal sample is refined into a homogenate; add 60 μL of DS Buffer and 20 μL of proteinase K (4 °C), and oscillate for a few seconds to mix well; incubate at 70 °C for 15 minutes (3 minutes in water bath - 3 minutes of oscillation - 3 minutes in water bath - 3 minutes of oscillation - 3 minutes in water bath); add 200 μL of SPZ Buffer and oscillate for 30 s; place on ice for 5 minutes, and then centrifuge at 1300 xg for 5 minutes; carefully aspirate 400 μL of the supernatant into another new 1.5 mL centrifuge tube (do not aspirate the precipitate); after mixing cHTR Reagent (4 °C), add 200 μL and oscillate for 10 s to mix well; let stand at room temperature for 2 minutes, centrifuge at 13000 xg for 2 minutes, and carefully aspirate 500 μL of the supernatant into a new 1.5 mL centrifuge tube; add 500 μL of BL Buffer and 500 μL of absolute ethanol, and oscillate for 10 s to mix well (1:1:1); insert the adsorption column into the collection tube, add it to the adsorption column in 2 portions (750 μL each time), centrifuge at 13000 xg / min, and discard the filtrate; place the adsorption column in a new collection tube, add 500 μL of VHB Buffer, centrifuge at 13000 xg / min, and discard the filtrate. Add 700 μL of DNA Wash Buffer, centrifuge at 13000 xg / min, discard the filtrate and repeat once; centrifuge the empty column at 13000 xg for 2 minutes, place the adsorption column on a new 1.5 mL centrifuge tube, open the lid and air dry for 5 minutes; suspend and drop 50 μL of Elution Buffer (preheated at 65 °C) into the center of the adsorption column, let stand at room temperature for 2 minutes, centrifuge at 13000 xg for 1 minute; suck up the liquid from below and repeat once, and the obtained liquid is the DNA sample. Use a UV spectrophotometer to measure the concentration of the DNA sample and store it in a -20 °C refrigerator. Select 1 tube each of strongly positive, weakly positive, and negative for fluorescence determination and the corresponding fecal samples.
[0039] (2) PCR Reaction System
[0040] In this experiment, a 25 μL reaction system was used, as shown in Table 1.
[0041] Table 1 PCR Reaction System
[0042]
[0043] (3) PCR Program
[0044] Using the positive sample as a template, a PCR amplification reaction was carried out according to the 25 μL reaction system. The PCR amplification reaction was performed on a PCR amplifier produced by Shanghai Kehuai Instrument Co., Ltd., and the PCR program (see Table 2).
[0045] Table 2 PCR Program
[0046]
[0047] (4) Electrophoresis and Staining
[0048] Dilute 10X TBE to 1X TBE and pour it into the gel electrophoresis instrument. Then, prepare the agarose gel. Put 50 mL of 1x TBE buffer and 0.5 g of agarose into a conical flask, shake well, and then heat it in the microwave oven at high power for one and a half minutes. After heating, add 5 μL of nucleic acid dye (Gold view), mix well, pour it into the gel plate before it cools, and after it cools (30 min), put it into the electrophoresis instrument. Add DL2000 DNA Marker to the first sample well of the gel, and add the products after PCR amplification to the other sample wells. Place the part with holes in the gel at the cathode, set the electrophoresis instrument to 120V, start electrophoresis, and let it move towards the anode. When it runs to a specific position, end the electrophoresis, and place the gel on a ZF-401 visible ultraviolet light detector produced by Shanghai Gucun Electro-Optical Instrument Factory to observe whether the target band appears.
[0049] (5) Primer Design
[0050] Use primer software to design primers. Enter the sequence in the "Sequence" option, click design, and then according to multiple candidate primers automatically analyzed. According to the length of the primer, GC content, etc., conduct preliminary screening, optimize the selected primers, adjust parameters such as primer length and GC content to improve the specificity and reliability of the primers, and screen out 5 groups of primers. After completing the primer design, save the primer information and send the designed primer sequences to General Biology (Anhui) Co., Ltd. to synthesize the corresponding products. The primer information is shown in Table 3.
[0051] Table 3 Primer Sequences
[0052]
[0053] (6) Primer Dilution and Preservation
[0054] Put the primer products synthesized by General Biology (Anhui) Co., Ltd. into a centrifuge produced by Yancheng Anxin Laboratory Instruments Co., Ltd., centrifuge at 10,000 rpm for 10 min. Add 538 μL of sterilized pure water to the upstream of Primer 1 and 587 μL of sterilized pure water to the downstream; add 502 μL of sterilized pure water to the upstream of Primer 2 and 544 μL of sterilized pure water to the downstream; add 500 μL of sterilized pure water to the upstream of Primer 3 by swirling and 547 μL of sterilized pure water to the downstream; add 567 μL of sterilized pure water to the upstream of Primer 4 and 532 μL of sterilized pure water to the downstream; add 542 μL of sterilized pure water to the upstream of Primer 5 and 564 μL of sterilized pure water to the downstream. Mix well by vortex oscillation, directly dilute and store in the refrigerator (-20 °C) for later use. Put another undiluted primer into the refrigerator and freeze it (-20 °C) for preservation.
[0055] (III) Results and Analysis
[0056] (1) Primer Screening
[0057] Primer 1 had obvious and clear target bands at 473 bp, Primer 2 had weak target bands at 569 bp, Primer 3 did not have the target bands that appeared at 845 bp, Primer 4 did not have target bands at 994 bp, and Primer 5 did not have target bands at 329 bp (see Figure 1 ). The results showed that among the 5 groups of primers, Primer 1 had the highest amplification efficiency and specificity. Finally, Primer 1 was selected as the primer for subsequent experiments.
[0058] (2) Influence of Different Denaturation Programs
[0059] Compared with the denaturation programs of 95 °C for 6 min and 9 min, the target bands of the subsequent PCR products with a denaturation of 95 °C for 3 min were relatively weak (see Figure 2 ). This may be due to insufficient denaturation time, and the inhibitors in the samples may not have been completely denatured. Compared with the denaturation programs of 95 °C for 6 min and 9 min, the target bands of the subsequent PCR products with a denaturation of 85 °C for 10 min were relatively weak (see Figure 3 ), and the amplification effect was poor. In the PCR amplification reaction, denaturation at 95 °C was also included. In order to reduce the influence of high temperature on DNA, the denaturation program of 95 °C for 6 min was finally selected.
[0060] (3) Influence of Dilution Ratio
[0061] The target fragment can be effectively detected within the dilution ratio range of 1:1.5 to 1:4.5 (g / mL); when the dilution ratio is 1:3, the target bands detected by different thermal denaturation programs are relatively faint (see Figure 3 ). This result may be due to the influence of complex components in the fecal sample on the amplification efficiency, or it may be caused by uneven sampling. It is recommended that the fecal sample be directly diluted as a whole after sampling to make the distribution of Lawsonia intracellularis in the feces uniform and present the positive results that should be there to prevent false negatives. The results show that a 1:4.5 serial dilution is available, and the bands seen at this concentration are clear and have a high brightness.
[0062] (4) Influence of high-speed centrifugation
[0063] After amplification, the bands of the 3 supernatant samples that had been centrifuged at high speed were significantly clearer than those of the 3 supernatant samples that had not been centrifuged at high speed (see Figure 4 ). The results indicate that after high-speed centrifugation, the target bacteria in the sample are effectively enriched, the DNA content is higher, and the amplification effect is better. For the samples centrifuged at high speed, based on the volume before centrifugation and the volume after centrifugation and dissolution, they are approximately concentrated to 4 times the original. Assuming no influence from various factors, the theoretical number of DNA templates becomes 4 times the original. As a result, after amplification, the bands of the 3 supernatant samples that had been centrifuged at high speed were significantly clearer than those of the 3 supernatant samples that had not been centrifuged at high speed (see Figure 4 ). The results show that the selected rotation speed and time are reasonable, and the bacteria in the supernatant sample can be effectively sedimented; of course, it also shows that most of the Lawsonia intracellularis bacteria in the refrigerated fecal samples are well-preserved. If a large number of bacteria are damaged, they cannot be sedimented by the selected rotation speed. By enriching the bacteria, fecal samples with a lower bacterial content can be detected, with higher sensitivity. During the susceptible period, through highly sensitive detection, the subclinical infection of Lawsonia intracellularis in pigs can be determined earlier, and earlier intervention can enable the faster recovery of porcine ileitis and effectively ensure growth.
[0064] (5) Selection between freezing and refrigerating fecal samples
[0065] After the feces of a positive case were refrigerated for 1 month, an appropriate amount of PBS buffer was added, and amplification of the target band was carried out according to the optimized PCR procedure. After the reaction ended, agarose gel electrophoresis was performed for identification, and a faint target band still appeared at 473 bp (see Figure 5 ). The results show that under refrigeration conditions, the bacterial DNA available for detection remains in the feces for a relatively long time. In contrast, for the strongly positive, weakly positive, and negative samples collected in previous experiments that had been frozen and thawed more than twice, amplification of the target band was also carried out according to the optimized PCR procedure, and no target band appeared through gel electrophoresis identification. As Figure 5As shown, the amplification product of the frozen negative sample is in well 1, the amplification products of the weakly positive frozen samples are in wells 2 and 4, the amplification products of the strongly positive frozen samples are in wells 3 and 5, and the amplification products of the feces refrigerated for 1 month are in wells 6 / 7 / 8. The result comparison shows that repeated freeze-thaw of fecal samples is not suitable for our optimized PCR procedure, and refrigeration can effectively store the samples for a long time.
[0066] After the above condition optimization, the preferred PCR method suitable for detecting Lawsonia intracellularis in ordinary pig farms is as follows: Use primer 1, which is an efficient and specific primer for Lawsonia intracellularis in fecal samples; the feces are preferably diluted as a whole with PBS at a ratio of 1:4.5 (mass / volume), and the dilution is directly centrifuged at 1000 rpm for 10 min, and the supernatant is taken. Pig farms (laboratories) with conditions can centrifuge the supernatant of low-speed centrifugation at 10,000 rpm for 5 min to enrich the bacteria. It is recommended to refrigerate the fecal samples and detect them within 1 week as much as possible; select a thermal denaturation program of 95°C for 6 min and a 25 μL reaction system; select a PCR main program of 95°C for 15 s, 55°C for 15 s, and 72°C for 15 s (40 cycles for the three steps of denaturation-annealing-extension).
[0067] The following experiments were all detected using the above optimized conditions.
[0068] Example 2 Sensitivity Experiment of the Common PCR Detection Method for Detecting Lawsonia intracellularis in Pig Farms
[0069] To verify the sensitivity of this detection method, 356 fecal samples from the general survey and 354 corresponding serum samples from the same batch were taken. The age of the pigs was 113–155 days, and no grouping or inoculation was carried out. Use the detection method of the present invention to detect 356 fecal samples (the number of samples with determined numbers). Among the results, the number of positive samples was 206. Among them, the absolute value of the LI content in 129 samples was greater than 2×10 5 CFU / g feces (98.45% of the samples with a content higher than this could be detected, and only 2 samples with a content higher than this did not show bands), and the detection rate below this concentration was 50.5%. 65 positive samples were identified using the Biostone antibody detection kit.
[0070] The detection method of the present application is cheaper than quantitative fluorescent PCR. For example, quantitative fluorescent PCT requires a DNA extraction kit, a fluorescent PCR instrument, synthetic standards, and a standard curve, while the method of the present application only requires simple instruments, such as a refrigerator, a centrifuge, and PCR, which is more practical. In addition, studies have shown that low LI content in feces is not significantly correlated with infection (Pedersen et al. BMC Veterinary research 2012, 8: 198 Johansen et al. preventive veterinary medicine 108 (2013): 63-72).
[0071] In addition, the detection method of the present application is more accurate and efficient than the old-style and nested PCR. The old-style and nested PCR requires the direct addition of PBS, followed by denaturation and PCR. Due to the low LI content, many interfering factors, and low primer efficiency in the sample, it is necessary to run twice, with the second run further amplifying the first product. The method of the present application can remove impurities and concentrate through two centrifugations for direct detection.
[0072] At the same time, the method of the present application is more timely, accurate and forward-looking than antibody testing. Antibody levels can only reach the infection judgment standard a few days after infection, and antibody levels will remain for a period of time after the use of antibiotics. Therefore, antibody testing can sometimes be misleading in monitoring the risk of LI infection in pig herds and whether treatment intervention is needed.
[0073] At the same time, this method was used to detect pigs with clinical symptoms after virus attack (6 positive samples came from conventional virus attack, and the positive detection rate of feces of infected pigs with clinical symptoms was 100% (6 heads). The reliability of this method was further demonstrated by the detection of feces of toxin-excreting pigs with obvious clinical symptoms and confirmed LI infection. This method can replace other methods for confirming pathogens in clinical diagnosis and treatment (pathogens such as epidemic diarrhea, Clostridium perfringens, Escherichia coli, and Salmonella can cause similar symptoms).
[0074] This method can be used not only for the identification of porcine ileitis (LI), but also for daily monitoring. The effect of daily monitoring is significantly better than that of antibody detection kits (antibody detection requires antibody levels significantly higher than daily levels, requiring a large amount of pathogens or multiple stimulations to achieve), providing earlier warning for the prevention and treatment of LI.
[0075] Example 3 Specificity experiment of the common PCR detection method for detecting Lawsonia intracellulare in pig farms.
[0076] Using various pathogens including *Lawsonia intracellularis* as samples, ordinary PCR detection was carried out using the detection method under the preferred conditions of Example 1. The gel electrophoresis results are shown in the figure. The band size is correct, and the results show that Primer 1 has good specificity. The negative and positive controls were valid during the detection process. The results are as Figure 6 shown. Among them, LI represents *Lawsonia intracellularis*, APP represents *Actinobacillus pleuropneumoniae*; Pm represents *Pasteurella multocida*, SS represents *Streptococcus suis*; Sal represents *Salmonella*; pedv represents porcine epidemic diarrhea virus; Pdcov represents porcine deltacoronavirus; porv represents porcine rotavirus; Bb represents *Bordetella bronchiseptica*; E.coli represents *Escherichia coli*; SA represents porcine sapelovirus. Spirochete represents *Treponema hyodysenteriae*; Gas bacillus represents *Clostridium perfringens*.
[0077] The present invention provides an ordinary PCR idea and method for detecting *Lawsonia intracellularis* in pig farms. There are many methods and ways to specifically implement this technical solution. The above description is only the preferred implementation mode of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. Each component not clearly defined in this embodiment can be implemented by existing technologies.
Claims
1. A PCR method for detecting Lawsonia intracellularis in feces, characterized in that, It includes the following steps: (1) Dilute the fecal sample to be detected with PBS buffer and centrifuge to obtain the supernatant; (2) Heat-denature the supernatant obtained in step (1) and then cool it; (3) Using the sample obtained in step (2) as a template, use Primer 1 as the amplification primer for PCR amplification. Among them, the sequence of Primer 1 is: Forward primer: ATACCCTGGTAGTCCACGCT; Reverse primer: GTCTTGCTGCCCTTTGTGTG; (4) Separate the amplified product by agarose gel electrophoresis. If a product of 473 bp can be specifically amplified, it is determined that Lawsonia intracellularis exists in the detected sample.
2. The method according to claim 1, wherein In step (1), each gram of the fecal sample to be detected is diluted with 1.5 - 4.5 mL of PBS buffer.
3. The method according to claim 1, wherein In step (1), each gram of the fecal sample to be detected is diluted with 4.5 mL of PBS buffer.
4. The method according to claim 1, wherein In step (1), the centrifugation conditions are: centrifuge at 800 - 1000 rpm for 8 - 10 min.
5. The method according to claim 3, characterized in that In step (1), the obtained supernatant is further centrifuged at 8000 - 10000 rpm for 5 - 8 min, the sediment is taken, PBS buffer is added and mixed evenly, and then the obtained mixed solution is subjected to the operation of step (2).
6. The method according to claim 1, wherein In step (2), the heat-denaturation conditions are: 95°C, 6 - 8 min.
7. The method according to claim 1, characterized in that In step (2), the heat-denaturation conditions are: 95°C for 6 min.
8. The method according to claim 1, characterized in that, The PCR reaction system is: a 25 μL reaction system, pre-denature at 95°C for 3 min, denature at 95°C for 15 s, anneal at 55°C for 15 s, extend at 72°C for 30 s, for a total of 40 cycles, and finally extend at 72°C for 5 min.
9. The method according to claim 1, characterized in that The sample to be detected is stored refrigerated after sampling and detected within one week.
10. The method according to claim 1, wherein Dilute the fecal sample to be detected with PBS buffer at a ratio of 1:4.5 and centrifuge to obtain the supernatant. First, centrifuge at 800 - 1000 rpm for 8 - 10 min. After taking the supernatant, further centrifuge the supernatant at 8000 - 10000 rpm for 5 - 8 min, take the sediment, then add PBS buffer and mix evenly, and then perform heat-denaturation. The heat-denaturation conditions are: 95°C for 6 min.