Nucleic acid compound
By designing nucleic acid compounds containing absent base nucleosides and thermal destabilization modifications, the problem of insufficient efficiency and specificity of existing nucleic acid compounds in gene silencing treatment is solved, and efficient inhibition of target genes is achieved, especially in the treatment of central nervous system diseases.
Patent Information
- Application Number
- CN202380053823.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-02-06
- Filing Date
- 2023-07-27
- Publication Date
- 2025-07-15
AI Technical Summary
Existing nucleic acid compounds have problems of inefficiency and insufficient specificity in gene silencing treatment, especially when treating central nervous system diseases, inflammatory diseases, metabolic disorders, oncology and eye diseases, traditional small molecule compounds are difficult to effectively inhibit target gene expression.
A nucleic acid compound is designed to contain a duplex region complementary to the transcription RNA of the target gene, the second strand has 2 consecutive abasic nucleosides in the 5' terminal region, connected by reverse internucleoside bonds, and contains thermally destabilized modifications such as unlocking nucleic acid (UNA) and glycol nucleic acid (GNA) in the 5' region to enhance stability and specific targeting.
It improves the inhibitory efficiency and specificity of nucleic acid compounds on target genes, and enhances the therapeutic effect on central nervous system diseases, inflammatory diseases, metabolic disorders, oncology and eye diseases.
Smart Images

Figure BDA0005241633250000051 
Figure BDA0005241633250000052 
Figure BDA0005241633250000061
Abstract
Description
Technical Field
[0001] The present application provides novel nucleic acid compounds suitable for therapeutic use. In addition, the present application provides methods for preparing these compounds, as well as methods for using these compounds to treat various diseases and disorders. Background Art
[0002] Nucleic acid compounds have important therapeutic applications in medicine. Nucleic acids can be used to silence genes that cause specific diseases. Gene silencing prevents the formation of proteins by inhibiting translation. Importantly, gene silencing agents are promising alternatives to traditional small organic compounds that inhibit the function of disease-related proteins. siRNA, antisense RNA, and microRNA (micro-RNA) are oligonucleotides / oligonucleosides that prevent the formation of proteins through gene silencing.
[0003] Specifically, over the past two decades, many modified siRNA compounds have been developed for diagnostic and therapeutic purposes, including siRNA / RNAi therapeutics for treating various diseases, including central nervous system diseases, inflammatory diseases, metabolic disorders, oncology, infectious diseases, and ocular diseases.
[0004] The present application relates to nucleic acid compounds for treating and / or preventing diseases. Summary of the Invention
[0005] A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleosides,
[0006] wherein the second strand contains 2 consecutive abasic nucleosides in the 5'-terminal region of the second strand, one of the abasic nucleosides being the terminal nucleoside of the 5'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 5'-terminal region of the second strand, wherein: (a) the penultimate abasic nucleoside is linked to an adjacent first base nucleoside in the adjacent 5'-proximal region by a reverse internucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5', and
[0007] wherein the first strand contains at least one thermally destabilizing modification of the duplex within the first 9 nucleoside positions of its 5'-region.
[0008] A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleosides, and wherein the nucleosides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'):
[0009] ia-ia-(Me)8–(F)3–(Me) 10 ,
[0010] wherein ia represents an inverted abasic nucleoside, and
[0011] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleoside positions of its 5'-region.
[0012] The nucleic acid as described herein, wherein the destabilizing modification is selected from Unlocked Nucleic Acid (UNA) and Glycol Nucleic Acid (GNA).
[0013] The nucleic acid as described herein, wherein the destabilizing modification comprises at least one Unlocked Nucleic Acid (UNA).
[0014] The nucleic acid as described herein, wherein the destabilizing modification comprises at least one Glycol Nucleic Acid (GNA).
[0015] The nucleic acid as described herein, wherein at least one heat-destabilizing modification of the duplex is located within nucleoside positions 2 to 9, preferably nucleoside positions 2 to 8, more preferably nucleoside positions 3 to 8, more preferably nucleoside positions 4 to 8, and most preferably at nucleoside position 6 or 7 of the 5'-region of the first strand.
[0016] The nucleic acid as described herein, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F sugar modifications.
[0017] The nucleic acid as described herein, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five, or seven 2'-F sugar modifications.
[0018] The nucleic acid as described herein, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three 2'-F sugar modifications.
[0019] A nucleic acid as described herein, wherein the nucleosides of the first strand comprise the following 2'-sugar modification pattern (5'-3'):
[0020] Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7
[0021] wherein X1 is a thermally destabilizing modification.
[0022] A nucleic acid as described herein, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modifications are selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of five 2'-F sugar modifications.
[0023] A nucleic acid as described herein, wherein the nucleosides of the first strand comprise the following 2'-sugar modification pattern (5'-3'):
[0024] Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7
[0025] wherein X1 is a thermally destabilizing modification.
[0026] A nucleic acid as described herein, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modifications are selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of seven 2'-F sugar modifications.
[0027] A nucleic acid as described herein, wherein two phosphorothioate internucleoside bonds are present respectively between three consecutive positions in the 5'-proximal end region of the second strand, wherein when read from the 5'-end, the first phosphorothioate internucleoside bond is present between the first base nucleoside and the adjacent second base nucleoside in the 5'-proximal end region of the second strand, and the second phosphorothioate internucleoside bond is present between the second base nucleoside and the adjacent third base nucleoside in the 5'-proximal end region of the second strand.
[0028] A nucleic acid as described herein, wherein two phosphorothioate internucleoside bonds are present respectively between three consecutive positions in the 5'- and 3'-end regions of the first strand, whereby the terminal nucleosides located respectively in the 5'- and 3'-end regions of the first strand are linked to their respective 5'- and 3'-adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5'- and 3'-penultimate nucleoside is linked to its respective 5'- and 3'-adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
[0029] A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region having a length of at least 17 nucleotides, and wherein the nucleotides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'):
[0030] ia-ia-(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside,
[0031] wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern (5'-3') selected from one of the following:
[0032] Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7, where X1 is a heat-destabilizing modification; or
[0033] Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7, where X1 is a heat-destabilizing modification.
[0034] A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region having a length of at least 17 nucleotides, and wherein the nucleotides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'):
[0035] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate bond,
[0036] wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern (5'-3') selected from one of the following:
[0037] Me(s)F(s)(Me)3–X1–(Me)7–F–Me–F–(Me)5(s)Me(s)Me, where X1 is a heat-destabilizing modification; or
[0038] Me(s)F(s)(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)5(s)Me(s)Me, where X1 is a heat-destabilizing modification.
[0039] A nucleic acid as described herein, wherein the first strand comprises at least 17 consecutive nucleosides that differ from any of the first strand sequences listed in Table 2 by 0 or 1 nucleoside, specifically, wherein the first strand comprises nucleosides 2-18 of any of the sequences defined in Table 2.
[0040] The nucleic acid according to the present application may further comprise a first strand that comprises at least 17 consecutive nucleosides that differ from any of the first strand sequences listed in Table 3 by 0 or 1 nucleoside, specifically, wherein the first strand comprises nucleosides 2-18 of any of the sequences defined in Table 3.
[0041] A nucleic acid as described herein, wherein the second strand comprises a nucleoside sequence of at least 17 consecutive nucleosides that differ from any of the second strand sequences listed in Table 2 by 0 or 1 nucleoside, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0042] The nucleic acid according to the present application may further comprise a second strand that comprises a nucleoside sequence of at least 17 consecutive nucleosides that differ from any of the second strand sequences listed in Table 4 by 0 or 1 nucleoside, and wherein the duplex region comprises at least 14, 15, 16 or 17 complementary base pairs.
[0043] A nucleic acid as described herein, wherein the first strand comprises any of the first strand sequences listed in Table 2, and / or wherein the second strand comprises any of the second strand sequences listed in Table 2.
[0044] A nucleic acid as described herein, wherein the first strand comprises any of the first strand sequences listed in Table 3, and / or wherein the second strand comprises any of the second strand sequences listed in Table 4.
[0045] A nucleic acid as described herein, wherein the first strand and the second strand form any of the duplexes listed in Table 5.
[0046] A nucleic acid as described herein, wherein the nucleic acid is an siRNA oligonucleoside.
[0047] A nucleic acid as described herein, wherein 2 consecutive abasic nucleosides in the 5'-terminal region of the second strand, one of the abasic nucleosides being the terminal nucleoside of the 5'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 5'-terminal region of the second strand, wherein: (a) the penultimate abasic nucleoside is linked to the adjacent first base nucleoside in the adjacent 5'-proximal region by a reverse internucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5'.
[0048] A nucleic acid according to the present application, wherein the nucleic acid is directly or indirectly conjugated to one or more ligand moieties. Optionally, the ligand moiety is present in the terminal region of the second strand, typically in its 3'-terminal region, and can generally comprise one or more N-acetylgalactosamine (GalNAc) ligands, and / or one or more derivatives of N-acetylgalactosamine (GalNAc) ligands, and / or one or more N-acetylgalactosamine (GalNAc) ligands and / or their derivatives, which are conjugated to the nucleic acid through a linker. Generally, one or more GalNAc ligands and / or GalNAc ligand derivatives are directly or indirectly conjugated to the 5'- or 3'-terminal region of the second strand of the nucleic acid, typically in its 3'-terminal region.
[0049] A nucleic acid according to the present application, which comprises a ligand moiety having the following structure:
[0050]
[0051] A nucleic acid according to the present application, which comprises a ligand moiety having the following structure:
[0052]
[0053] Wherein:
[0054] Each occurrence of R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl;
[0055] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen, and nitro;
[0056] Each occurrence of X1 and X2 is independently selected from the group consisting of methylene, oxygen, and sulfur;
[0057] m is an integer from 1 to 6;
[0058] n is an integer from 1 to 10;
[0059] q, r, s, t, v are independently integers from 0 to 4, provided that: q and r cannot both be 0 at the same time; and s, t, and v cannot all be 0 at the same time;
[0060] Z is an oligonucleoside.
[0061] A nucleic acid according to the present application, which comprises the following structure:
[0062]
[0063] Wherein [oligonucleotide] represents consecutive nucleosides of the second strand.
[0064] Alternatively, the nucleic acid according to the present application comprises a ligand moiety, and the ligand moiety comprises the following structure:
[0065]
[0066] Wherein:
[0067] r and s are independently integers selected from 1 to 16; and
[0068] Z is an oligonucleoside.
[0069] The nucleic acid according to the present application comprises the following structure:
[0070]
[0071] Wherein [oligonucleotide] represents consecutive nucleosides of the second strand.
[0072] The present application also provides a pharmaceutical composition comprising the nucleic acid as described herein, and a pharmaceutically acceptable excipient or carrier.
[0073] The present application also provides the use of the nucleic acid or pharmaceutical composition as described herein for treatment.
[0074] The present application also provides the use of the nucleic acid or pharmaceutical composition as described herein for preventing or treating a disease associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder, such as hemophilia.
[0075] The present application also provides the use of the nucleic acid or pharmaceutical composition as described herein for preventing or treating diabetes.
[0076] The present application also provides the use of the nucleic acid or pharmaceutical composition as described herein for preventing or treating cardiovascular diseases. Description of the Drawings
[0077] Figure 1 : Linkers and ligand moieties of constructs including tether 1a suitable for use according to the present application. Although Figure 1 Linkers conjugated to oligonucleotides are described, it should be understood that the present application also encompasses conjugates of the same linkers with the oligonucleosides disclosed herein.
[0078] It should also be understood that although Figure 1 products molecules based on the Figure 1 linkers and ligand moieties specifically described therein are described, which are linked to an oligonucleoside moiety (also as described herein), the product may alternatively further comprise or consist essentially of: linkers and ligand moieties substantially as Figure 1 described linked to an oligonucleoside moiety, but as Figure 1The F substituent on the cyclooctyl ring is replaced by a substituent generated by hydrolysis displacement (such as an OH substituent). In this way, (a) the linker 1a construct can consist essentially of a molecule having a linker and a ligand moiety as specifically described in Figure 1 , wherein there is an F substituent on the cyclooctyl ring; or (b) the linker 1a construct can consist essentially of a molecule having a linker and a ligand moiety as described substantially in Figure 1 , but as Figure 1 shown, the F substituent on the cyclooctyl ring is replaced by a substituent generated by hydrolysis displacement (such as an OH substituent); or (c) the linker 1a construct can contain a mixture of molecules as defined in (a) and / or (b).
[0079] Figure 2 : The linker and ligand moieties of constructs including linker 1b suitable for use according to the present application. Although Figure 2 describes a linker conjugated to an oligonucleotide, it should be understood that the present application also encompasses conjugates of the same linker with the oligonucleosides disclosed herein.
[0080] Regarding the comments on Figure 1 , and the situation where the F substituent on the cyclooctyl ring as shown in Figure 1 may be replaced by a substituent generated by hydrolysis displacement (such as an OH substituent), the same applies to the linker 1b construct. In this way, (a) the linker 1b construct can consist essentially of a molecule having a linker and a ligand moiety as specifically described in Figure 2 , wherein there is an F substituent on the cyclooctyl ring; or (b) the linker 1b construct can consist essentially of a molecule having a linker and a ligand moiety as described substantially in Figure 2 , but as Figure 2 shown, the F substituent on the cyclooctyl ring is replaced by a substituent generated by hydrolysis displacement (such as an OH substituent); or (c) the linker 1b construct can contain a mixture of molecules as defined in (a) and / or (b).
[0081] Figure 3 : The linker and ligand moieties of constructs including linker 2a suitable for use according to the present application. Although Figure 3 describes a linker conjugated to an oligonucleotide, it should be understood that the present application also encompasses conjugates of the same linker with the oligonucleosides disclosed herein.
[0082] Figure 4 : The linker and ligand moieties of constructs including linker 2b suitable for use according to the present application,. Although Figure 4 describes a linker conjugated to an oligonucleotide, it should be understood that the present application also encompasses conjugates of the same linker with the oligonucleosides disclosed herein.
[0083] Figure 5 : The formula described in Items 1 - 101 disclosed herein.
[0084] Figure 6 : The formula described in Clauses 1 - 56 disclosed herein.
[0085] Figure 7a - c: Exemplary modification patterns falling within the scope of the claims.
[0086] As shown in the 5'-terminal region of the sense strand, iaia means (i) two abasic nucleosides are provided as the penultimate and terminal nucleosides in the 5'-terminal region of the sense strand; (ii) a 5'-5' reverse bond is provided between the third-to-last nucleoside (i.e., at position 1 in the sense strand, not including the iaia motif in the 5'-terminal region of the sense strand in the nucleoside position numbering of the sense strand) and the adjacent penultimate abasic nucleoside of the sense strand; and (iii) when read towards the 5'-terminal region containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5'.
[0087] A nucleoside with a 2'-O-Me modification is described as "Me".
[0088] A nucleoside with a 2'-F modification is described as "F".
[0089] A nucleoside with a thermally destabilizing modification, such as GNA or UNA, is described as "TD".
[0090] A nucleoside with a 2'-O-Me modification, a 2'-F modification, or a thermally destabilizing modification is described as "*".
[0091] Exemplary modification patterns can be applied to the nucleic acid sequences according to the present application as described herein. A GalNAc linker can be attached to the 3'-terminal region of the sense strand in use ( Figure 7b not shown).
[0092] Figure 8 : Inhibition of ZPI expression by ETXM1201 (ETXS2402 and ETXS2397) and ETXM1227 (ETXS2454 and ETXS1037).
[0093] Figure 9 : Inhibition of B4GALT1 expression by ETXM1764 (ETXS3528 and ETXS2401) and ETXM1231 (ETXS2462 and ETXS2401).
[0094] Figure 10: Inhibition of B4GALT1 expression by ETXM1772 (ETXS3544 and ETXS2407) and ETXM1232 (ETXS2464 and ETXS2407).
[0095] Definition
[0096] The "first strand" is also referred to herein as the antisense strand or the guide strand and is used interchangeably herein. It refers to a nucleic acid strand, such as a strand of an siRNA (e.g., dsiRNA), which includes a region that is substantially complementary to a target sequence (e.g., to an mRNA). As used herein, the term "complementary region" refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., the target sequence). When the complementary region is not completely complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. In some embodiments, the double-stranded nucleic acid (e.g., the siRNA agent of the present application) includes nucleotide mismatches in the antisense strand.
[0097] The "second strand" (also referred to herein as the sense strand or the passenger strand and used interchangeably herein) refers to a nucleic acid (e.g., an siRNA) strand that includes a region that is substantially complementary to a region of the antisense strand (as defined herein).
[0098] In the context of a molecule comprising a nucleic acid having a ligand moiety and optionally also a linker moiety, the nucleic acid of the present application can be referred to as an oligonucleoside or an oligonucleoside moiety.
[0099] An oligonucleotide is a short nucleic acid polymer. Although oligonucleotides contain phosphodiester bonds between their nucleoside components (base plus sugar), the present application is not limited to oligonucleotides that are always linked by such phosphodiester bonds between adjacent nucleosides. Other oligomers of nucleosides linked by bonds other than phosphodiester bonds are also contemplated. For example, the bond between nucleosides can be a phosphorothioate bond. Thus, the term "oligonucleoside" as used herein encompasses oligonucleotides and other oligomers of nucleosides. According to the present application, it is preferred that the oligonucleoside is a nucleic acid having at least a part that is an oligonucleotide. According to the present application, it is also preferred that the oligonucleoside has one or more or most phosphodiester backbone bonds between nucleosides. According to the present application, it is also preferred that the oligonucleoside has one or more or most phosphodiester backbone bonds between nucleosides and also has one or more phosphorothioate backbone bonds (usually in the terminal regions of the first and / or second strand) between nucleosides.
[0100] It is preferred herein that the nucleic acid according to the present application is a double-stranded oligonucleoside that contains one or more phosphorothioate backbone bonds between nucleosides. Thus, in all cases where the present application relates to oligonucleotides, particularly in the chemical structures disclosed herein, the oligonucleotide can equally be an oligonucleoside as defined herein.
[0101] In some embodiments, the double-stranded nucleic acids (e.g., siRNA agents) of the present application include nucleoside mismatches in the sense strand. In some embodiments, the nucleoside mismatches are, for example, within 5, 4, 3, 2, or 1 nucleoside from the 3'-end of the nucleic acid (e.g., siRNA).
[0102] In another embodiment, the nucleoside mismatch is, for example, in the 3'-terminal nucleoside of the nucleic acid (e.g., siRNA).
[0103] A "target sequence" (which may also be referred to as target RNA or target mRNA) refers to a continuous portion of the nucleoside sequence of an mRNA molecule formed during gene transcription, including the mRNA that is a processed product of the RNA primary transcript.
[0104] The length of the target sequence can be about 10 - 35 nucleosides, for example, about 15 - 30 nucleosides in length. For example, the length of the target sequence can be about 15 - 30 nucleosides, 15 - 29, 15 - 28, 15 - 27, 15 - 26, 15 - 25, 15 - 24, 15 - 23, 15 - 22, 15 - 21, 15 - 20, 15 - 19, 15 - 18, 15 - 17, 18 - 30, 18 - 29, 18 - 28, 18 - 27, 18 - 26, 18 - 25, 18 - 24, 18 - 23, 18 - 22, 18 - 21, 18 - 20, 19 - 30, 19 - 29, 19 - 28, 19 - 27, 19 - 26, 19 - 25, 19 - 24, 19 - 23, 19 - 22, 19 - 21, 19 - 20, 20 - 30, 20 - 29, 20 - 28, 20 - 27, 20 - 26, 20 - 25, 20 - 24, 20 - 23, 20 - 22, 20 - 21, 21 - 30, 21 - 29, 21 - 28, 21 - 27, 21 - 26, 21 - 25, 21 - 24, 21 - 23, or 21 - 22 nucleosides. Ranges and lengths between the above ranges and lengths are also considered to be part of the present application.
[0105] The term "ribonucleoside" or "nucleoside" may also refer to modified nucleosides, as further detailed below.
[0106] The nucleic acid can be DNA or RNA and can contain modified nucleosides. RNA is the preferred nucleic acid.
[0107] The terms "iRNA", "siRNA", "RNAi agent", and "iRNA agent", "RNA interference agent", which are used interchangeably herein, refer to RNA-containing agents that mediate the targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. siRNA directs the sequence-specific degradation of mRNA through RNA interference (RNAi).
[0108] Double-stranded RNA is referred to herein as "double-stranded siRNA (dsiRNA) agent", "double-stranded siRNA (dsiRNA) molecule", "double-stranded RNA (dsRNA) agent", "double-stranded RNA (dsRNA) molecule", "dsiRNA agent", "dsiRNA molecule", or "dsiRNA", which refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, and is referred to as having "sense" and "antisense" orientations relative to the target RNA.
[0109] Most of the nucleosides of each strand of the nucleic acid (such as a dsiRNA molecule) are preferably ribonucleosides, but in this case, each strand or both strands may also include one or more non-ribonucleosides, such as deoxyribonucleosides or modified nucleosides. In addition, as used in this specification, "siRNA" may include ribonucleosides with chemical modifications.
[0110] The term "modified nucleoside" refers to a nucleoside independently having a modified sugar moiety, a modified internucleoside bond, or a modified nucleobase, or any combination thereof. Thus, the term modified nucleoside encompasses substitutions, additions, or removals of, for example, functional groups or atoms, to the internucleoside bond, the sugar moiety, or the nucleobase. For the purposes of this specification and the claims, any such modifications (as used in siRNA-type molecules) are encompassed within "iRNA" or "RNAi agent" or "siRNA" or "siRNA agent".
[0111] The two strands forming the duplex structure may be different parts of a larger molecule, or they may be separate molecules, such as RNA molecules.
[0112] The term "nucleotide overhang" refers to at least one unpaired nucleotide extending from the duplex structure of a nucleic acid. The nucleic acids according to the present application may contain overhangs of at least one nucleotide; alternatively, the overhang may contain at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides, or more. The nucleotide overhang may contain or consist of nucleotide / nucleotide analogs (including deoxynucleotides). The overhang may be on the sense strand, the antisense strand, or any combination thereof. In addition, the nucleotides of the overhang may be present at the 5'-end, 3'-end, or both ends of the antisense strand or the sense strand.
[0113] In certain embodiments, the antisense strand has 1-10 nucleotides, such as 0-3, 1-3, 2-4, 2-5, 4-10, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, and the overhang is located at the 3'-end or the 5'-end.
[0114] "Flat" or "blunt end" means that there are no unpaired nucleosides at the ends of double-stranded nucleic acids, i.e., no nucleoside overhangs. The nucleic acids of the present application include nucleic acids that do not have a nucleoside overhang at one end or do not have a nucleoside overhang at either end.
[0115] As understood by those skilled in the art, unless otherwise specified, the term "complementary" when used to describe a first nucleoside sequence relative to a second nucleoside sequence refers to the ability of an oligonucleoside containing the first nucleoside sequence to hybridize with an oligonucleoside containing the second nucleoside sequence and form a duplex structure under certain conditions. For example, such conditions can be stringent conditions, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 °C or 70 °C for 12 - 16 hours, followed by washing (see, for example, "Molecular Cloning: A Laboratory Manual", Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press).
[0116] As described herein, complementary sequences within a nucleic acid (e.g., dsiRNA) include base pairing of an oligonucleoside containing a first nucleoside sequence with an oligonucleoside containing a second nucleoside sequence over the entire length of one or both nucleoside sequences. Such sequences may be referred to herein as being "fully complementary" to each other. However, when a first sequence is referred to herein as being "substantially complementary" or "partially complementary" to a second sequence, the two sequences may be fully complementary, or they may form one or more mismatched base pairs, such as 2, 4, or 5 mismatched base pairs, but preferably no more than 5, while maintaining the ability to hybridize under conditions most relevant to their ultimate application (e.g., inhibiting gene expression via the RISC pathway). In the determination of complementarity, overhangs should not be considered mismatches. For example, a nucleic acid (e.g., dsRNA) containing an oligonucleoside 17 nucleosides in length and another oligonucleoside 19 nucleosides in length, where the longer oligonucleoside contains a sequence of 17 nucleosides that is fully complementary to the shorter oligonucleoside, can still be referred to as "fully complementary".
[0117] As used herein, "complementary" sequences may also include non-Watson-Crick base pairs or base pairs formed by non-natural and modified nucleosides, or consisting entirely of non-Watson-Crick base pairs or base pairs formed by non-natural and modified nucleosides, provided that the above requirements regarding their hybridization ability are met. Such non-Watson-Crick base pairs include, but are not limited to, G:U wobble or Hoogstein base pairing.
[0118] The terms "complementary", "fully complementary", and "substantially / partially complementary" as used herein can be used to refer to base pairing between the sense and antisense strands of a nucleic acid (such as a dsiRNA), or between the antisense strand of a double-stranded nucleic acid (such as an siRNA agent) and a target sequence.
[0119] In the present application, the second strand of the nucleic acid according to the present application is at least partially complementary to the first strand of the nucleic acid. In certain embodiments, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is at least 17 base pairs in length and contains no more than 1, 2, 3, 4, or 5 mismatched base pairs.
[0120] In certain embodiments, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is 19 base pairs in length and contains no more than 1, 2, 3, 4, or 5 mismatched base pairs. In certain embodiments, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is 21 base pairs in length and contains no more than 1, 2, 3, 4, or 5 mismatched base pairs.
[0121] Alternatively, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is at least 17 base pairs in length, wherein at least 14, 15, 16, or 17 of the base pairs are complementary base pairs, specifically Watson-Crick base pairs.
[0122] In certain embodiments, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is 19 base pairs in length, wherein at least 14, 15, 16, 17, 18, or all 19 base pairs are complementary base pairs, specifically Watson-Crick base pairs. In certain embodiments, they are partially complementary if the first and second strands of the nucleic acid according to the present application form a duplex region that is 21 base pairs in length, wherein at least 16, 17, 18, 19, 20, or all 21 base pairs are complementary base pairs, specifically Watson-Crick base pairs.
[0123] As used herein, a nucleic acid that is "substantially complementary" or "partially complementary" to at least a portion of a messenger RNA (mRNA) refers to a nucleic acid that is substantially or partially complementary to a continuous portion of the target mRNA (e.g., the mRNA encoding a gene). In certain embodiments, the continuous portion of the mRNA is a sequence as listed in Table 1, i.e., any one of SEQ ID NOs: 4-17. For example, a nucleic acid is at least partially complementary to the mRNA of a target gene if the sequence is substantially or partially complementary to an uninterrupted portion of the mRNA encoding that gene.
[0124] Thus, in some preferred embodiments, the antisense oligonucleotides disclosed herein are fully complementary to the target gene sequence.
[0125] In other embodiments, the antisense oligonucleotides disclosed herein are substantially or partially complementary to the target RNA sequence and comprise a continuous nucleoside sequence that is at least about 80% complementary, such as at least about 85%, 86%, 87%, 88%, 89%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary or 100% complementary, to the equivalent region of the target RNA sequence over its entire length.
[0126] In some embodiments, the nucleic acids (e.g., siRNA) of the present application include a sense strand that is substantially or partially complementary to the antisense oligonucleotide, which in turn is complementary to the target gene sequence and comprises a continuous nucleoside sequence. The nucleoside sequence of the sense strand is at least about 80% complementary, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary, or 100% complementary, to the equivalent region of the nucleoside sequence of the antisense strand over its entire length.
[0127] In some embodiments, the nucleic acids (e.g., siRNA) of the present application include an antisense strand that is substantially or partially complementary to the target sequence and comprises a continuous nucleoside sequence that is at least 80% complementary, such as about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary, or 100% complementary, to the target sequence over its entire length.
[0128] As used herein, a "subject" is an animal, such as a mammal, including a primate (e.g., a human, a non-human primate such as a monkey and a chimpanzee), or a non-primate or a bird, that endogenously or heterologously expresses a target gene to facilitate target knockdown when the target gene sequence has sufficient complementarity to a nucleic acid (e.g., an siRNA agent). In certain preferred embodiments, the subject is a human.
[0129] The term "treatment" refers to a beneficial or desired result, including but not limited to alleviating or improving one or more symptoms associated with gene expression. "Treatment" can also refer to an extension of survival compared to the expected survival of a subject not receiving treatment. Treatment can include preventing the development of comorbidities, for example, reducing liver damage in a subject with a liver infection.
[0130] As used herein, "therapeutically effective amount" is intended to include an amount of a nucleic acid (e.g., siRNA) that, when administered to a patient to treat a subject having a disease, is sufficient to effect treatment of the disease (e.g., by alleviating, ameliorating or maintaining an existing disease or one or more symptoms thereof or its associated comorbidities).
[0131] The phrase "pharmaceutically acceptable" as used herein refers to a compound, material, composition or dosage form that is suitable for use in contact with the tissues of human and animal subjects without undue toxicity, irritation, allergic response or other problems or complications, commensurate with a reasonable benefit / risk ratio.
[0132] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients in the formulation and not injurious to the subject being treated.
[0133] When listing values of parameters or ranges of values, it is intended that values and ranges intermediate to the recited values also be part of this application.
[0134] The articles "a" and "an" are used herein to refer to one or more than one (i.e., at least one) of the grammatical object of the article.
[0135] The term "comprising" is used herein to mean the phrase "comprising but not limited to" and may be used interchangeably with that phrase.
[0136] The term "or" is used herein to mean the term "and / or" and may be used interchangeably with the term "and / or", unless the context clearly indicates otherwise. For example, "sense strand or antisense strand" should be understood to mean "sense strand or antisense strand or sense strand and antisense strand".
[0137] The term "about" is used herein to denote within the typical tolerances in the art. For example, "about" can be understood to be about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When "about" appears before a series of numbers or a range, it should be understood that "about" can modify each number in the series or range.
[0138] The term "at least" before a number or series of numbers shall be understood to include the number adjacent to the term "at least", as well as all subsequent numbers or integers that can logically be included as is clear from the context. For example, the number of nucleosides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleosides in a 21-nucleoside nucleic acid molecule" means that 18, 19, 20, or 21 nucleosides have the specified property. When "at least" appears before a series of numbers or a range, it shall be understood that "at least" can modify each number in the series or range.
[0139] As used herein, "not exceeding" or "less than" shall be understood to mean the value adjacent to the phrase, as well as lower values or integers that are logically derived from the context, and shall be understood to mean values adjacent to zero. For example, a duplex having an overhang "not exceeding 2 nucleosides" has 2, 1, or 0 nucleoside overhangs. When "not exceeding" appears before a series of numbers or a range, it shall be understood that "not exceeding" can modify each number in the series or range.
[0140] The terminal region of a strand is the last 5 nucleosides from the 5' or 3' end.
[0141] The various embodiments of the present application can be combined as appropriately determined by those skilled in the art.
[0142] Abasic nucleoside
[0143] In certain embodiments, there is 1, for example 2, for example 3, for example 4 or more abasic nucleosides present in the nucleic acid according to the present application. Abasic nucleosides are modified nucleosides as they lack the base normally seen at position 1 of the sugar moiety. Typically, there will be a hydrogen at position 1 of the sugar moiety of the abasic nucleosides present in the nucleic acid according to the present application.
[0144] The abasic nucleosides are in the terminal region of the second strand, preferably within the terminal 5 nucleosides at the end of the strand. The terminal region can be the terminal 5 nucleosides, which include the abasic nucleosides.
[0145] As a preferred feature, the second strand can comprise (all of these features are specifically considered for combination, unless mutually exclusive):
[0146] 2 or more abasic nucleosides in the terminal region of the second strand; and / or
[0147] 2 or more abasic nucleosides in the 5' terminal region of the second strand; and / or
[0148] 2 or more abasic nucleosides in the 5' terminal region of the second strand, wherein the abasic nucleosides are present in the overhang as described herein; and / or
[0149] Two or more consecutive abasic nucleosides in the terminal region of the second strand, wherein preferably, one such abasic nucleoside is the terminal nucleoside; and / or
[0150] Two or more consecutive abasic nucleosides in the 5'-terminal region of the second strand, wherein preferably, one such abasic nucleoside is the terminal nucleoside of the 5'-terminal region of the second strand; and / or
[0151] An inverted internucleoside bond links at least one abasic nucleoside to an adjacent base nucleoside in the terminal region of the second strand; and / or
[0152] An inverted internucleoside bond links at least one abasic nucleoside to an adjacent base nucleoside in the 5'-terminal region of the second strand; and / or
[0153] An abasic nucleoside is the penultimate nucleoside, which is linked by an inverted bond to a nucleoside that is not the terminal nucleoside (referred to herein as the antepenultimate nucleoside); and / or
[0154] When reading the strand in the direction towards the end containing the terminal nucleoside, abasic nucleosides are the two terminal nucleosides linked by a 5'-3' bond;
[0155] When reading the strand in the direction towards the end containing the terminal nucleoside, abasic nucleosides are the two terminal nucleosides linked by a 3'-5' bond;
[0156] Abasic nucleosides are the two terminal positions, wherein the penultimate nucleoside is linked by an inverted bond to the antepenultimate nucleoside, and wherein the inverted bond is a 5-5' inverted bond or a 3'-3' inverted bond;
[0157] Abasic nucleosides are the two terminal positions, wherein the penultimate nucleoside is linked by an inverted bond to the antepenultimate nucleoside, and wherein
[0158] (1) The inverted bond is a 5-5' inverted bond, and when reading towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'5'; or
[0159] (2) The inverted bond is a 3-3' inverted bond, and when reading towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 5'3'.
[0160] Preferably, there is an abasic nucleoside at the end of the second strand.
[0161] Preferably, in the terminal region of the second strand, preferably at the terminal and penultimate positions there are two or at least two abasic nucleosides.
[0162] Preferably, two or more abasic nucleosides are consecutive, e.g., all abasic nucleosides can be consecutive. For example, the terminal 1 or 2 or 3 or 4 nucleosides can be abasic nucleosides.
[0163] An abasic nucleoside can also be linked to an adjacent nucleoside by a 5'-3' phosphodiester bond or a reverse bond, unless there is only 1 abasic nucleoside at the terminus, in which case it will have a reverse bond with the adjacent nucleoside.
[0164] A reverse bond (also referred to as an inverted bond, which is also seen in the art) comprises a 5'-5', 3'-3', 3'-2' or 2'-3' phosphodiester bond between adjacent sugar moieties of the nucleosides.
[0165] An abasic nucleoside that is not at the terminus will have two phosphodiester bonds, one to each adjacent nucleoside, and these can be reverse bonds, or can be 5'-3 phosphodiester bonds or can be one of each.
[0166] Preferred embodiments comprise two abasic nucleosides at the terminus and the penultimate position of the second strand, and wherein the reverse internucleoside bond is between the penultimate (abasic) nucleoside and the antepenultimate nucleoside.
[0167] Preferably, there are two abasic nucleosides at the terminus and the penultimate position of the second strand, and the penultimate nucleoside is linked to the antepenultimate nucleoside by a reverse internucleoside bond and to the terminal nucleoside by a 5'-3' or 3'-5' phosphodiester bond (reading in the direction of the end of the molecule).
[0168] Preferably, a nucleic acid according to the present application comprises one or more abasic nucleosides, optionally wherein one or more abasic nucleosides are in the terminal region of the second strand, and / or wherein at least one abasic nucleoside is linked to an adjacent base nucleoside by a reverse internucleoside bond.
[0169] Typically, the second strand contains 2 consecutive abasic nucleosides in the 5' end region of the second strand, where one such abasic nucleoside is the terminal nucleoside of the 5' end region of the second strand and the other abasic nucleoside is the penultimate nucleoside of the 5' end region of the second strand, wherein: (a) the penultimate abasic nucleoside is linked to the adjacent first base nucleoside of the adjacent 5'-proximal end region by a reverse internucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5'. More typically, (i) the first strand and the second strand each have a length of 23 nucleosides; (ii) two phosphorothioate internucleoside bonds are respectively between three consecutive positions in the 5'-proximal end region of the second strand, wherein the first phosphorothioate internucleoside bond is between the adjacent first base nucleoside and the adjacent second base nucleoside in the 5'-proximal end region of the second strand, and the second phosphorothioate internucleoside bond is between the adjacent second base nucleoside and the adjacent third base nucleoside in the 5'-proximal end region of the second strand; (iii) two phosphorothioate internucleoside bonds are respectively between three consecutive positions in the 5' and 3' end regions of the first strand, whereby the terminal nucleosides respectively located in the 5' and 3' end regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each of the first 5' and 3' penultimate nucleosides is linked to their respective 5' and 3' adjacent antepenultimate nucleosides by phosphorothioate internucleoside bonds; and (iv) the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 3' end region of the second strand.
[0170] Structural examples are as follows (where the specific RNA nucleosides shown are not limiting and can be any RNA nucleoside):
[0171] A 3'-3' reverse bond (and also shows the 5'-3' direction of the last phosphodiester bond between two abasic molecules read towards the end of the molecule)
[0172]
[0173] B shows a 5-5' reverse bond (and also shows the 3'-5' direction of the last phosphodiester bond between two abasic molecules read towards the end of the molecule)
[0174]
[0175] Providing an abasic nucleoside or abasic nucleosides present in a nucleic acid in the presence of a reverse internucleoside bond or bonds (i.e., 5'-5' or 3'-3' reverse internucleoside bonds). The reverse bond occurs due to a change in the orientation of adjacent nucleoside sugars such that the sugar has a 3'–5' orientation, opposite to the conventional 5'–3' orientation (referring to the numbering of the ring atoms on the nucleoside sugar). One or more abasic nucleosides present in the nucleic acids of the present application preferably include such inverted nucleoside sugars.
[0176] In the case where the terminal nucleoside has an inverted orientation, this will result in an “inverted” terminal configuration of the entire nucleic acid. Although some of the structures drawn and cited herein are represented using the conventional 5'–3' direction (referring to the numbering of the ring atoms on the nucleoside sugar), it will be understood that the presence of a terminal nucleoside with an orientation change and a proximal 3'-3' reverse bond will result in the nucleic acid having an overall 5'-5' terminal structure (i.e., the conventional 3' terminal nucleoside becomes the 5' terminal nucleoside). Alternatively, it will be understood that the presence of a terminal nucleoside with an orientation change and a proximal 5'-5' reverse bond will result in the nucleic acid having an overall 3'-3' terminal structure.
[0177] A proximal 3'-3' or 5'-5' reverse bond as described herein can include a reverse bond directly adjacent / linked to a terminal nucleoside with an inverted orientation, such as a single terminal nucleoside with an inverted orientation. Alternatively, a proximal 3'-3' or 5'-5' reverse bond as described herein can include a reverse bond of two or more adjacent nucleosides with an inverted orientation, such as two or more terminal region nucleosides with an inverted orientation, e.g., the terminal and the penultimate nucleoside. In this way, the reverse bond can be linked to the penultimate nucleoside with an inverted orientation. Although one skilled in the art will understand that the inverted orientation as described above can result in the nucleic acid molecule having an overall 3'-3' or 5'-5' terminal structure as described herein, it should also be understood that in the presence of one or more additional reverse bonds and / or nucleosides with an inverted orientation, the overall nucleic acid can have a 3'-5' terminal structure corresponding to the conventionally positioned 5' / 3' termini.
[0178] In one aspect, the nucleic acid can have a 3'-3' reverse bond, and the terminal sugar moiety can contain a 5'OH at the 5' position of the terminal sugar, rather than a 5' phosphate group.
[0179] Thus, those skilled in the art will clearly understand that the 5'-5', 3'-3', and 3'-5' (read along that terminal direction) terminal variants of the more conventional 5'-3' structures (referring to the numbering of the ring atoms on the terminal nucleoside sugar) drawn herein are included within the scope of the present disclosure, where there is one reverse bond or multiple reverse bonds.
[0180] In cases such as where there are inverted internucleoside linkages and / or one or more nucleosides have an inverted orientation resulting in inverted termini, and where the relative position of the linkages (e.g., relative to a linker) or the position of internal features (such as modified nucleosides) is defined relative to the 5’ or 3’ terminus of the nucleic acid, the 5’ or 3’ terminus is the conventional 5’ or 3’ terminus that would exist if there were no inverted linkages, and where the conventional 5’ and 3’ termini are determined by considering the directionality of the majority of internal nucleoside linkages and / or the orientation of the nucleosides within the nucleic acid. From these internal linkages and / or nucleoside orientations, it can be determined which termini of the nucleic acid would constitute the conventional 5’ and 3’ termini of a molecule without inverted linkages (referencing the ring atom numbering on the terminal nucleoside sugar).
[0181] For example, in the structure shown below, the first 2 positions at the 5” terminus have no base residues. If the terminal nucleoside has an inverted orientation, the 5’ terminus shown in the figure below (which is the conventional 5’ terminus) can actually contain a 3’ OH according to the inverted nucleoside at the terminal position. Nevertheless, when read in the standard 5’ [PO4] to 3’ [OH] direction of the nucleic acid molecule (referencing the ring atom numbering on the nucleoside sugar), most of the molecule will contain conventional internucleoside linkages from the 3’ OH of the sugar to the 5’ phosphate of the next sugar, which can be used to determine the conventional 5’ and 3’ termini found in the absence of an inverted end configuration.
[0182] 5’A - A - Me - Me - Me - Me - Me - Me - Me - Me - F - F - F - Me - Me - Me - Me - Me - Me - Me - Me - Me 3’
[0183] The inverted linkages are preferably located at the termini of the nucleic acid (such as RNA), which are away from the ligand portion of the molecule, such as the portion containing GalNAc.
[0184] A GalNAc - siRNA construct having 3’ - GalNAc on the sense strand can have an inverted linkage at the other end of the sense strand.
[0185] In certain embodiments, the present application relates to a nucleic acid for inhibiting the expression of a target gene, which comprises a duplex region that comprises:
[0186] a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand;
[0187] wherein the second strand comprises 2 consecutive abasic nucleosides in the 5’ terminal region of the second strand, wherein one such abasic nucleoside is the terminal nucleoside of the 5’ terminal region of the second strand and the other abasic nucleoside is the penultimate nucleoside of the 5’ terminal region of the second strand, wherein:
[0188] (a) The penultimate abasic nucleoside is linked to an adjacent first base nucleoside in the adjacent 5'-proximal region by a reverse internucleoside bond;
[0189] (b) The reverse bond is a 5-5' reverse bond; and
[0190] (c) When read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5'.
[0191] In certain embodiments, the present application relates to a nucleic acid for inhibiting the expression of a target gene, which comprises a duplex region, and the duplex region comprises:
[0192] A first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand;
[0193] Wherein:
[0194] (i) Preferably, each of the first strand and the second strand has a length of 23 nucleosides (this length of the second strand includes two abasic nucleosides);
[0195] (ii) The second strand contains 2 consecutive abasic nucleosides in the 5'-terminal region of the second strand, wherein one such abasic nucleoside is the terminal nucleoside of the 5'-terminal region of the second strand, and the other abasic nucleoside is the penultimate nucleoside of the 5'-terminal region of the second strand, wherein:
[0196] (a) The penultimate abasic nucleoside is linked to an adjacent first base nucleoside in the adjacent 5'-proximal region by a reverse internucleoside bond;
[0197] (b) The reverse bond is a 5-5' reverse bond; and
[0198] (c) When read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and penultimate abasic nucleosides is 3'-5';
[0199] (iii) Two phosphorothioate internucleoside bonds are respectively present between three consecutive positions in the 5'-proximal region of the second strand, wherein the first phosphorothioate internucleoside bond is present between the first base nucleoside and the adjacent second base nucleoside in the 5'-proximal region of the second strand, and the second phosphorothioate internucleoside bond is present between the second base nucleoside and the adjacent third base nucleoside in the 5'-proximal region of the second strand;
[0200] (iv) Phosphorothioate internucleoside linkages are present between three consecutive positions in the 5' and 3' terminal regions of the first strand, respectively, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside linkages, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside linkage;
[0201] and
[0202] (v) A second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 3' terminal region of the second strand.
[0203] In certain embodiments, the present application relates to a nucleic acid for inhibiting the expression of a target gene, comprising a duplex region that comprises:
[0204] a first strand that is at least partially complementary to a portion of an RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand;
[0205] wherein the second strand comprises 2 consecutive abasic nucleosides in the 5' terminal region of the second strand, present as the following 5' terminal motif,
[0206]
[0207] wherein:
[0208] B represents a nucleobase,
[0209] T represents H, OH or a 2'-ribose modification,
[0210] Z represents the remaining nucleosides of the second strand.
[0211] In certain embodiments, the present application relates to a nucleic acid for inhibiting the expression of a target gene, comprising a duplex region that comprises:
[0212] a first strand that is at least partially complementary to a portion of an RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand;
[0213] wherein the second strand comprises 2 consecutive abasic nucleosides in the 5' terminal region of the second strand, present as the following 5' terminal motif,
[0214]
[0215] wherein:
[0216] B represents a nucleobase,
[0217] T represents H, OH or a 2'-ribose modification,
[0218] V represents O or S (preferably O),
[0219] R represents H or C 1-4 alkyl (preferably H),
[0220] Z represents the remaining nucleosides of the second strand;
[0221] More preferably, it is the following 5'-terminal motif
[0222]
[0223] wherein:
[0224] B represents a nucleobase,
[0225] T represents H, OH or a 2'-ribose modification,
[0226] Z represents the remaining nucleosides of the second strand.
[0227] In certain embodiments, the present application relates to a nucleic acid for inhibiting the expression of a target gene, which comprises a duplex region, and the duplex region comprises:
[0228] a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand;
[0229] wherein the second strand contains 2 consecutive abasic nucleosides in the 5'-terminal region of the second strand and exists as the following 5'-terminal motif,
[0230]
[0231] wherein:
[0232] B represents a nucleobase,
[0233] T represents H, OH or a 2'-ribose modification,
[0234] V represents O or S (preferably O),
[0235] R represents H or C 1-4 alkyl (preferably H),
[0236] Z contains 11 to 26 consecutive nucleosides, preferably 15 to 21 consecutive nucleosides, and more preferably 19 consecutive nucleosides;
[0237] More preferably, it is the following 5'-terminal motif
[0238]
[0239] wherein:
[0240] B represents a nucleobase,
[0241] T represents H, OH or a 2'-ribose modification,
[0242] Z contains 11 to 26 consecutive nucleosides, preferably 15 to 21 consecutive nucleosides, and more preferably 19 consecutive nucleosides.
[0243] In some embodiments, the modification pattern of the second (sense) strand of the nucleic acid according to the present application comprises or consists of:
[0244] ia–ia-Me-Me-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me, where ia represents an inverted abasic nucleoside.
[0245] In such an embodiment, the second strand preferably comprises the following 5'-terminal motif
[0246]
[0247] where:
[0248] B represents the nucleobase of the first nucleoside base in the 5'-terminal region of the second strand,
[0249] T represents a 2'-Me ribose modification,
[0250] Z represents the remaining consecutive nucleoside bases of the second strand.
[0251] In some embodiments, the modification pattern of the second (sense) strand of the nucleic acid according to the present application comprises or consists of:
[0252] ia–ia-Me(s)-Me(s)-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me, where (s) is a phosphorothioate internucleoside bond and ia represents an inverted abasic nucleoside.
[0253] In such an embodiment, the second strand preferably comprises the following 5'-terminal motif
[0254]
[0255] where:
[0256] B represents the nucleobases of the first two nucleoside bases in the 5'-terminal region of the second strand,
[0257] T represents a 2'-Me ribose modification,
[0258] V represents O or S (preferably O),
[0259] R represents H or C1-4 Alkyl (preferably H),
[0260] Z contains 11 to 26 consecutive nucleosides, preferably 15 to 21 consecutive nucleosides, and more preferably 19 consecutive nucleosides;
[0261] More preferably, it is the following 5'-terminal motif
[0262]
[0263] Wherein:
[0264] B represents the nucleobase of the first two base nucleosides in the 5'-terminal region of the second strand,
[0265] T represents 2'-Me ribose modification,
[0266] Z represents the remaining 19 consecutive base nucleosides of the second strand.
[0267] In a preferred embodiment, the modification pattern of the second (sense) strand of the nucleic acid according to the present application comprises or consists of:
[0268] ia–ia-Me(s)-Me(s)-Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me, where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside.
[0269] In such an embodiment, the second strand preferably contains the following 5'-terminal motif
[0270]
[0271] Wherein:
[0272] B represents the nucleobase of the first two base nucleosides in the 5'-terminal region of the second strand,
[0273] T represents 2'-Me ribose modification,
[0274] V represents O or S (preferably O),
[0275] R represents H or C 1-4 Alkyl (preferably H),
[0276] Z contains 11 to 26 consecutive nucleosides, preferably 15 to 21 consecutive nucleosides, and more preferably 19 consecutive nucleosides;
[0277] More preferably, it is the following 5'-terminal motif
[0278]
[0279] Wherein:
[0280] B represents the nucleobase of the first two base nucleosides in the 5'-terminal region of the second strand.
[0281] T represents a 2'-Me ribose modification.
[0282] Z represents the remaining 19 consecutive base nucleosides of the second strand.
[0283] Nucleic acid length
[0284] In one aspect, i) the length of the first strand of the nucleic acid ranges from 17 to 30 nucleosides, preferably from 19 to 25 nucleosides, more preferably 19 or 23 nucleosides; and / or ii) the length of the second strand of the nucleic acid ranges from 17 to 30 nucleosides, preferably from 19 to 25 nucleosides, more preferably 19 or 21 nucleosides.
[0285] Generally, the length of the duplex region of the nucleic acid is from 17 to 30 nucleosides, more preferably 19 or 21 nucleosides in length. Similarly, the length of the complementary region between the first strand and the portion of the RNA transcribed from the target gene is from 17 to 30 nucleosides.
[0286] Nucleic acid modification
[0287] In certain embodiments, the nucleic acids of the present application, such as RNA (e.g., dsiRNA), do not contain further modifications, such as chemical modifications or conjugations known in the art and described herein.
[0288] In other preferred embodiments, the nucleic acids of the present application, such as RNA (e.g., dsiRNA), are further chemically modified to enhance stability or other beneficial features.
[0289] In certain embodiments of the present application, substantially all nucleosides are modified.
[0290] The nucleic acids characterized in the present application can be synthesized or modified by methods recognized in the art, such as those described in “Currentprotocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, the content of which is hereby incorporated by reference herein.
[0291] Modifications include, for example, terminal modifications such as 5'-terminal modifications (phosphorylation, conjugation, inverted linkages) or 3'-terminal modifications (conjugation, DNA nucleosides within RNA or RNA nucleosides within DNA, reverse linkages, etc.); base modifications such as replacement with stable bases, destabilizing bases, or bases that base pair with a library of extended pairing partners, conjugated bases; sugar modifications (e.g., at the 2'-position or 4'-position) or sugar replacements; or backbone modifications including modification or replacement of the phosphodiester bond.
[0292] Specific examples of nucleic acids (such as siRNA compounds) useful in the embodiments described herein include, but are not limited to, RNAs having a modified backbone or no native internucleoside linkages. Nucleic acids (such as RNAs having a modified backbone) include those nucleic acids that do not have a phosphorus atom in their backbone. For the purposes of this specification, and as sometimes referred to in the art, modified nucleic acids (e.g., RNAs) that do not have a phosphorus atom in their internucleoside backbone may also be considered oligonucleosides. In some embodiments, the modified nucleic acid (e.g., siRNA) has a phosphorus atom in its internucleoside backbone.
[0293] Modified nucleic acids (e.g., RNA backbones) include, for example, phosphorothioates, chiral phosphorothioates, dithiophosphates, phosphotriesters, aminoalkyl phosphotriesters, methyl and other alkyl phosphonates (including 3'-alkylene phosphonates and chiral phosphonates), phosphonates, phosphoramidates (including 3'-aminophosphoramidates and aminoalkyl phosphoramidates), phosphorothioamidates, thioalkyl phosphates, thioalkyl phosphotriesters, and boranophosphates having a normal 3'-5' linkage, 2'-5' linkage analogs thereof, and those having reverse polarity (wherein adjacent nucleoside units are joined 5'-3' or 5'-2'). Also included are various salt, mixed salt, and free acid forms.
[0294] Modified nucleic acids (e.g., RNAs) can also contain one or more substituted sugar moieties. Nucleic acids characterized herein such as siRNAs (e.g., dsiRNAs) can include at the 2'-position one of the following: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted. 2'-O-methyl and 2'-F are preferred modifications.
[0295] In certain preferred embodiments, the nucleic acid comprises at least one modified nucleoside.
[0296] The nucleic acids of the present application can contain one or more modified nucleosides on the first strand and / or the second strand.
[0297] In some embodiments, substantially all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification.
[0298] In some embodiments, all of the nucleosides of the sense strand and substantially all of the nucleosides of the antisense strand comprise a modification.
[0299] In some embodiments, all of the nucleosides of the sense strand and all of the nucleosides of the antisense strand comprise a modification.
[0300] In one embodiment, at least one modified nucleoside is selected from the group consisting of: deoxy-nucleoside, 3'-terminal deoxythymidine (dT) nucleoside, 2'-O-methyl modified nucleoside (also referred to herein as 2'-Me, where Me is methoxy), 2'-fluoro modified nucleoside, 2'-deoxy modified nucleoside, locked nucleoside, unlocked nucleoside, conformationally restricted nucleoside, constrained ethyl nucleoside, abasic nucleoside, 2'-amino modified nucleoside, 2'-O-allyl modified nucleoside, 2'-O-alkyl modified nucleoside, 2'-hydroxy modified nucleoside, 2'-methoxyethyl modified nucleoside, 2'-O-alkyl modified nucleoside, morpholino nucleoside, phosphoramidate, nucleoside comprising a non-natural base, tetrahydropyran modified nucleoside, 1,5-anhydrohexitol modified nucleoside, cyclohexenyl modified nucleoside, nucleoside comprising a phosphorothioate group, nucleoside comprising a methylphosphonate group, nucleoside comprising a 5'-phosphate, and nucleoside comprising a 5'-phosphate mimic. In another embodiment, the modified nucleoside comprises a short sequence of 3'-terminal deoxythymidine nucleoside (dT).
[0301] The modification on the nucleoside can preferably be selected from the group consisting of: including but not limited to LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2'-deoxy, 2'-hydroxy, and combinations thereof. In another embodiment, the modification on the nucleoside is 2'-O-methyl ("2-Me") or 2'-fluoro modification.
[0302] A preferred modification is the modification of the 2'-OH group of the ribose, optionally selected from 2'-Me or 2'-F modification.
[0303] Preferred nucleic acids comprise one or more modified nucleosides on the first strand and / or the second strand to form modified nucleosides, as follows:
[0304] A nucleic acid, wherein the modification is the modification of the 2'-OH group of the ribose, optionally selected from 2'-Me or 2'-F modification.
[0305] A nucleic acid, wherein the first strand and the second strand respectively comprise 2'-Me and 2'-F modifications.
[0306] A nucleic acid, wherein the first strand comprises a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications.
[0307] A nucleic acid, wherein the first strand comprises a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0308] A nucleic acid, wherein the first strand comprises a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three 2'-F modifications.
[0309] A nucleic acid, wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0310] Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7,
[0311] wherein X1 is a thermally destabilizing modification.
[0312] A nucleic acid, wherein the first strand comprises a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of five 2'-F modifications.
[0313] A nucleic acid, wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0314] Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7,
[0315] wherein X1 is a thermally destabilizing modification.
[0316] A nucleic acid, wherein the first strand comprises a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of seven 2'-F modifications.
[0317] A nucleic acid, which comprises at least one thermally destabilizing modification, suitably at one or more positions from position 1 to position 9 of the first strand counted from position 1 of the first strand, and / or at one or more positions on the second strand aligned with positions 1 to 9 of the first strand, wherein the destabilizing modification is selected from modified unlocked nucleic acids (UNA) and glycol nucleic acids (GNA), preferably glycol nucleic acids, more preferably (S)-glycol nucleic acids.
[0318] A nucleic acid as described herein, wherein the first strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleoside positions of its 5' region.
[0319] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 2 to 9 of the 5' region of the first strand.
[0320] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 2 to 8 of the 5' region of the first strand.
[0321] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 3 to 8 of the 5' region of the first strand.
[0322] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 4 to 8 of the 5' region of the first strand.
[0323] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex within nucleoside position 6 or 7 of the 5' region of the first strand.
[0324] A nucleic acid that comprises at least one thermally destabilizing modification of the duplex at position 6 of the first strand, counted from position 1 of the first strand.
[0325] A nucleic acid as described herein, wherein the destabilizing modification comprises at least one glycol nucleic acid (GNA), more preferably (S)-glycol nucleic acid.
[0326] Glycol nucleic acid (GNA), sometimes also called glycerol nucleic acid, is a nucleic acid similar to DNA or RNA, but with a different composition of its sugar-phosphate backbone, using propylene glycol instead of ribose or deoxyribose. Individual GNA nucleotides can form Watson-Crick base pairs with (deoxy)ribonucleotides, but are highly destabilizing if incorporated into a DNA or RNA duplex.
[0327] A nucleic acid as described herein, wherein the destabilizing modification comprises at least one unlocked nucleic acid (UNA).
[0328] The term "UNA" refers to unlocked acyclic nucleic acids, where any bond of the sugar has been removed to form an unlocked "sugar" residue. In one instance, UNA also encompasses monomers in which the bond between C1'-C4' has been removed (i.e., the covalent carbon-oxygen-carbon bond between the C1' and C4' carbon atoms). In another instance, the C2'-C3' bond of the sugar (i.e., the covalent carbon-carbon bond between the C2' and C3' carbon atoms) is removed (see Mikhailov et.al., Tetrahedron Letters, 26(17):2059(1985); and Fluiter et al., Mol. Biosyst., 10:1039(2009), which are incorporated herein by reference in their entirety). The acyclic derivatives provide greater backbone flexibility without affecting Watson-Crick base pairing. Acyclic nucleotides can be linked via 2'-5' or 3'-5' bonds.
[0329] A nucleic acid, wherein the second strand comprises the following 2'-sugar modification pattern (5'-3'):
[0330] (Me)8–(F)3–(Me) 10 。
[0331] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0332] (Me)8–(F)3–(Me) 10 ,
[0333] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleotide positions of its 5' region.
[0334] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0335] (Me)8–(F)3–(Me) 10 ,and
[0336] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleotide positions of its 5' region;
[0337] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0338] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0339] (Me)8–(F)3–(Me) 10 , and
[0340] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 2 to 9 in the 5'-region of the first strand;
[0341] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0342] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0343] (Me)8–(F)3–(Me) 10 , and
[0344] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 2 to 8 in the 5'-region of the first strand;
[0345] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0346] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0347] (Me)8–(F)3–(Me) 10 , and
[0348] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 3 to 8 in the 5'-region of the first strand;
[0349] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0350] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0351] (Me)8–(F)3–(Me) 10 , and
[0352] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 4 to 8 in the 5'-region of the first strand;
[0353] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0354] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0355] (Me)8–(F)3–(Me) 10 , and
[0356] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 6 or 7 in the 5'-region of the first strand;
[0357] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0358] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0359] (Me)8–(F)3–(Me) 10 , and
[0360] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 6 in the 5'-region of the first strand;
[0361] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0362] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise a 2'-sugar modification pattern as follows (5'-3'):
[0363] (Me)8–(F)3–(Me) 10 , and
[0364] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 7 in the 5'-region of the first strand;
[0365] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0366] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise a 2'-sugar modification pattern as follows (5'-3'):
[0367] (Me)8–(F)3–(Me) 10 , and
[0368] wherein the first strand comprises a 2'-sugar modification pattern as follows (5'-3'):
[0369] Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7, wherein X1 is a heat-destabilizing modification.
[0370] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0371] (Me)8–(F)3–(Me) 10 , and
[0372] wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0373] Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification.
[0374] A nucleic acid, wherein the second strand comprises the following 2'-sugar modification pattern (5'-3'):
[0375] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside.
[0376] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0377] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0378] wherein the first strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions of its 5' region.
[0379] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0380] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0381] wherein the first strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions of its 5' region;
[0382] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0383] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0384] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0385] wherein the first strand comprises at least one thermal destabilizing modification of the duplex within nucleoside positions 2 to 9 in the 5'-region of the first strand;
[0386] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0387] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0388] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0389] wherein the first strand comprises at least one thermal destabilizing modification of the duplex within nucleoside positions 2 to 8 in the 5'-region of the first strand;
[0390] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0391] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0392] ia–ia–(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and
[0393] wherein the first strand comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 3 to 8 in the 5'-region of the first strand;
[0394] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0395] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0396] ia–ia–(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and
[0397] wherein the first strand comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 4 to 8 in the 5'-region of the first strand;
[0398] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0399] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0400] ia–ia–(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and
[0401] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 6 or 7 in the 5'-region of the first strand;
[0402] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0403] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0404] ia–ia–(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and
[0405] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 6 in the 5'-region of the first strand;
[0406] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0407] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0408] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0409] wherein the first strand comprises at least one thermally destabilizing modification of the duplex at nucleoside position 7 in the 5'-region of the first strand;
[0410] And wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
[0411] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0412] ia–ia–(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and
[0413] wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0414] Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification.
[0415] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0416] ia–ia–(Me)8–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and
[0417] wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0418] Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7, where X1 is a heat-destabilizing modification.
[0419] In certain embodiments, the nucleic acid, such as an siRNA agent, further comprises at least one phosphorothioate or methylphosphonate internucleoside bond. For example, the phosphorothioate or methylphosphonate internucleoside bond can be at the 3'-end or terminal region of one strand (i.e., the sense strand or the antisense strand); or at the termini of both strands (i.e., the sense strand and the antisense strand).
[0420] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside bond is at the 5'-end or terminal region of one strand (i.e., the sense strand or the antisense strand); or at the termini of both strands (i.e., the sense strand and the antisense strand).
[0421] In certain embodiments, the phosphorothioate or methylphosphonate internucleoside bond is at the 5'- and 3'-ends or terminal regions of one strand (i.e., the sense strand or the antisense strand); or at the termini of both strands (i.e., the sense strand and the antisense strand).
[0422] Any nucleic acid can contain one or more phosphorothioate (PS) modifications within the nucleic acid, such as at least two PS internucleoside bonds at the ends of the strand.
[0423] At least one oligoribonucleotide strand preferably contains at least two consecutive phosphorothioate modifications in the last 3 nucleotides of the oligonucleotide.
[0424] Accordingly, the present application also relates to: a nucleic acid disclosed herein, which comprises phosphorothioate internucleoside bonds between at least two or three consecutive positions, such as at the 5' and / or 3' terminal regions and / or near-terminal regions of the second strand, wherein the near-terminal region preferably adjoins the terminal region where one or more abasic nucleosides of the second strand are located.
[0425] The nucleic acids disclosed herein contain phosphorothioate internucleotide linkages between at least two or three consecutive positions in the 5' and / or 3' terminal regions of the first strand, wherein preferably, the terminal positions in the 5' and / or 3' terminal regions of the first strand are linked to their adjacent positions by phosphorothioate internucleotide linkages.
[0426] The nucleic acid strand can be an RNA containing a phosphorothioate internucleotide linkage between three nucleosides, which are adjacent to two terminal abasic nucleosides.
[0427] In a preferred embodiment, the present application relates to a nucleic acid, wherein two phosphorothioate internucleotide linkages are respectively present between three consecutive positions in the 5' proximal terminal region of the second strand, wherein when read from the 5' end, the first phosphorothioate internucleotide linkage is present between the first base nucleoside and the adjacent second base nucleoside in the 5' proximal terminal region of the second strand, and the second phosphorothioate internucleotide linkage is present between the second base nucleoside and the adjacent third base nucleoside in the 5' proximal terminal region of the second strand.
[0428] In a more preferred embodiment, the present application relates to a nucleic acid, wherein two phosphorothioate internucleotide linkages are respectively present between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides respectively located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleotide linkages, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleotide linkage.
[0429] A nucleic acid, wherein the second strand contains the following 2'-sugar modification pattern (5'-3'):
[0430] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate bond.
[0431] A nucleic acid, which comprises a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleosides, and wherein the nucleosides of the second strand contain the following 2'-sugar modification pattern (5'-3'):
[0432] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate bond, and
[0433] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleoside positions of its 5' region;
[0434] Preferably, two phosphorothioate internucleoside bonds are present respectively between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked via phosphorothioate internucleoside bonds to their respective 5' and 3' adjacent penultimate nucleosides, and each 5' and 3' penultimate nucleoside is linked via a phosphorothioate internucleoside bond to its respective 5' and 3' adjacent antepenultimate nucleoside.
[0435] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0436] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate bond, and
[0437] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleoside positions of its 5' region;
[0438] and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modifications are selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modifications are selected from at least 2'-Me and 2'-F sugar modifications, and the total number of 2'-F sugar modifications in the first strand consists of three, five, or seven 2'-F modifications;
[0439] Preferably, two phosphorothioate internucleoside bonds are present respectively between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked via phosphorothioate internucleoside bonds to their respective 5' and 3' adjacent penultimate nucleosides, and each 5' and 3' penultimate nucleoside is linked via a phosphorothioate internucleoside bond to its respective 5' and 3' adjacent antepenultimate nucleoside.
[0440] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0441] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0442] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 2 to 9 in the 5'-region of the first strand;
[0443] and wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications;
[0444] Preferably, wherein phosphorothioate internucleoside bonds are present between three consecutive positions in the 5'- and 3'-terminal regions of the first strand, whereby the terminal nucleotides located in the 5'- and 3'-terminal regions of the first strand are linked to their respective 5'- and 3'-adjacent penultimate nucleotides by phosphorothioate internucleoside bonds, and each 5'- and 3'-penultimate nucleotide is linked to its respective 5'- and 3'-adjacent antepenultimate nucleotide by a phosphorothioate internucleoside bond.
[0445] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0446] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0447] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 2 to 8 in the 5'-region of the first strand;
[0448] and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications;
[0449] Preferably, two phosphorothioate internucleoside bonds are present between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
[0450] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0451] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0452] wherein the first strand comprises at least one thermally destabilizing modification of the duplex within nucleoside positions 3 to 8 in the 5' region of the first strand;
[0453] and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications;
[0454] Preferably, two phosphorothioate internucleoside bonds are present between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
[0455] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0456] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0457] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside positions 4 to 8 of the 5'-region of the first strand;
[0458] and wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five, or seven 2'-F modifications;
[0459] Preferably, wherein phosphorothioate internucleoside bonds are present between three consecutive positions in the 5'- and 3'-terminal regions of the first strand, whereby the terminal nucleotides located in the 5'- and 3'-terminal regions of the first strand are linked to their respective 5'- and 3'-adjacent penultimate nucleotides by phosphorothioate internucleoside bonds, and each 5'- and 3'-penultimate nucleotide is linked to its respective 5'- and 3'-adjacent antepenultimate nucleotide by a phosphorothioate internucleoside bond.
[0460] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0461] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0462] wherein the first strand comprises at least one heat-destabilizing modification of the duplex within nucleoside position 6 or 7 of the 5'-region of the first strand;
[0463] and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications;
[0464] Preferably, two phosphorothioate internucleoside bonds are present between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
[0465] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first and second strands form a duplex region that is at least 17 nucleosides in length, and wherein the nucleosides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0466] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0467] wherein the first strand comprises at least one heat-destabilizing modification of the duplex at nucleoside position 6 in the 5' region of the first strand;
[0468] and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications;
[0469] Preferably, two phosphorothioate internucleoside bonds are present between three consecutive positions in the 5' and 3' terminal regions of the first strand, whereby the terminal nucleosides located in the 5' and 3' terminal regions of the first strand are linked to their respective 5' and 3' adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5' and 3' penultimate nucleoside is linked to its respective 5' and 3' adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
[0470] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0471] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0472] wherein the first strand comprises at least one thermally destabilizing modification of the duplex at nucleotide position 7 in the 5'-region of the first strand;
[0473] and wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications; specifically, wherein the nucleotides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of three, five, or seven 2'-F modifications;
[0474] Preferably, wherein phosphorothioate internucleoside bonds are present between three consecutive positions in the 5'- and 3'-terminal regions of the first strand, whereby the terminal nucleotides located in the 5'- and 3'-terminal regions of the first strand are linked to their respective 5'- and 3'-adjacent penultimate nucleotides by phosphorothioate internucleoside bonds, and each 5'- and 3'-penultimate nucleotide is linked to its respective 5'- and 3'-adjacent antepenultimate nucleotide by a phosphorothioate internucleoside bond.
[0475] A nucleic acid comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0476] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0477] wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0478] Me(s)F(s)(Me)3–X1–(Me)7–F–Me–F–(Me)5(s)Me(s)Me, where X1 is a heat-destabilizing modification and (s) represents a phosphorothioate bond.
[0479] A nucleic acid comprising a first strand that is at least partially complementary to a portion of RNA transcribed from a target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region that is at least 17 nucleotides in length, and wherein the nucleotides of the second strand comprise the following 2'-sugar modification pattern (5'-3'):
[0480] ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , where ia represents an inverted abasic nucleoside and (s) represents a phosphorothioate bond, and
[0481] wherein the first strand comprises the following 2'-sugar modification pattern (5'-3'):
[0482] Me(s)F(s)(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)5(s)Me(s)Me, where X1 is a heat-destabilizing modification and (s) represents a phosphorothioate bond.
[0483] Position 1 of the first strand or the second strand is the nucleotide closest to the end of the nucleic acid (ignoring any abasic nucleotides), and that nucleotide is joined to the adjacent nucleotide (at position 2) by an internal 3' to 5' bond, with reference to the bond between the sugar moieties of the backbone, and is read in the direction away from the end of the molecule.
[0484] Thus, it can be seen that "position 1 of the sense strand" is the nucleotide closest to the 5' end of the conventional 5' end of the sense strand (excluding abasic nucleotides). Generally, the nucleotide at position 1 of the sense strand is equivalent to the 5' nucleotide of the selected target nucleic acid sequence, and more generally, the sense strand will have nucleotides equivalent to those of the target nucleic acid sequence starting from position 1 of the sense strand, while also allowing acceptable mismatches between the sequences.
[0485] As used herein, "position 1 of the antisense strand" is the nucleotide closest to the 5' end of the conventional 5' end of the antisense strand (excluding abasic nucleotides). As mentioned above, there will be a complementary region between the sense strand and the antisense strand, such that the antisense strand will also have a region complementary to the above-mentioned target nucleic acid sequence.
[0486] The preferred nucleic acid is double-stranded RNA, which contains 2 adjacent abasic nucleosides at the 5'-end of the second strand and a ligand moiety containing one or more GalNAc ligand moieties at the opposite 3'-end of the second strand. Further preferably, the same nucleic acid may also contain phosphorothioate linkages between nucleotides at positions 1-2 and 2-3 of the second strand, read from position 1 of the second strand.
[0487] The preferred modifications are as follows:
[0488] Modification pattern 1:
[0489] Second strand (5'-3'): ia–ia–Me–Me–Me–Me–Me–Me–Me–Me–F–F–F–Me–Me–Me–Me–Me–Me–Me–Me–Me–Me,
[0490] First strand (5'-3'): Me–F–Me–Me–Me–X1–Me–Me–Me–Me–Me–Me-Me–F–Me–F–Me–Me–Me–Me–Me–Me-Me, where X1 is a heat-destabilizing modification;
[0491] Or modification pattern 2:
[0492] Second strand (5'-3'): ia–ia–Me–Me–Me–Me–Me–Me–Me–Me–F–F–F–Me–Me–Me–Me–Me–Me–Me–Me–Me–Me,
[0493] First strand (5'-3'): Me–F–Me–Me-Me–X1–Me–F–F–Me–Me–Me–Me–F–Me–F–Me–Me–Me–Me–Me–Me–Me, where X1 is a heat-destabilizing modification.
[0494] Particularly preferred modifications are:
[0495] Modification pattern 1:
[0496] Second strand (5'-3'): ia–ia–Me(s)Me(s)Me–Me–Me–Me–Me–Me–F–F–F–Me–Me–Me–Me–Me–Me–Me–Me–Me–Me,
[0497] First strand (5'-3'): Me(s)F(s)Me–Me–Me–X1–Me–Me–Me–Me–Me–Me-Me–F–Me–F–Me–Me–Me–Me–Me(s)Me(s)Me, where X1 is a heat-destabilizing modification;
[0498] Or modification pattern 2:
[0499] Second strand (5’-3’): ia–ia–Me(s)Me(s)Me–Me–Me–Me–Me–Me–F–F–F–Me–Me–Me–Me–Me–Me–Me–Me–Me–Me
[0500] First strand (5’-3’): Me(s)F(s)Me–Me-Me–X1–Me–F–F–Me–Me–Me–Me–F–Me–F–Me–Me–Me–Me–Me(s)Me(s)Me, where X1 is a heat-destabilizing modification.
[0501] Conjugation
[0502] Another modification of the nucleic acids of the present application, such as RNA (e.g., siRNA), involves linking the nucleic acid, such as siRNA, to one or more ligand moieties, for example to enhance the activity, cellular distribution, or cellular uptake (e.g., entry into cells) of the nucleic acid (e.g., siRNA).
[0503] In some embodiments, the ligand moiety can be linked to the nucleic acid, such as an siRNA oligonucleotide, through a cleavable or non-cleavable linker. The term "linker" or "linking group" refers to an organic moiety that connects two parts of a compound (e.g., covalently connects two parts of a compound).
[0504] The ligand can be linked to the 3’ or 5’ end of the sense strand.
[0505] The ligand is preferably conjugated to the 3’ end of the sense strand of the nucleic acid (e.g., siRNA agent).
[0506] Accordingly, the present application in another aspect relates to a conjugate for inhibiting the expression of a target gene in a cell, the conjugate comprising a nucleic acid moiety and one or more ligand moieties, the nucleic acid moiety comprising a nucleic acid as disclosed herein.
[0507] In one aspect, the second strand of the nucleic acid is directly or indirectly (e.g., through a linker) conjugated to one or more ligand moieties, where the ligand moiety is typically present in the terminal region of the second strand, preferably in its 3’ terminal region.
[0508] In certain embodiments, the ligand moiety comprises GalNAc or a GalNAc derivative linked to the nucleic acid (e.g., dsiRNA) through a linker.
[0509] Accordingly, the present application relates to a conjugate, where the ligand moiety comprises:
[0510] i) one or more GalNAc ligands; and / or
[0511] ii) one or more GalNAc ligand derivatives; and / or
[0512] iii) one or more GalNAc ligands conjugated to said nucleic acid via a linker.
[0513] The GalNAc ligand may be conjugated directly or indirectly to the 5' or 3' end region of the second strand of the nucleic acid, preferably to its 3' end region.
[0514] GalNAc ligands are well known in the art and are described in particular in EP3775207A1.
[0515] In some embodiments, the GalNAc ligand is included in Figures 1 to 4 or Figure 5 any of the linkers shown in (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may contain other bonds than phosphodiester bonds, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the present application is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3' end region of the second strand.
[0516] In some embodiments, the GalNAc ligand is included in Figure 3 the linker shown, wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may contain other bonds than phosphodiester bonds, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the present application is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3' end region of the second strand.
[0517] In some embodiments, the GalNAc ligand is included in Figure 5 any of the linkers shown in (Formula XI), wherein the "oligonucleotide" may be any nucleic acid disclosed herein. Thus, the "oligonucleotide" may contain other bonds than phosphodiester bonds, such as one or more phosphorothioate bonds. Preferably, the nucleic acid according to the present application is a double-stranded oligonucleoside as defined herein, and the linker is conjugated to the second strand via a phosphodiester bond, more preferably to the 3' end region of the second strand.
[0518] In some embodiments, the GalNAc ligand is included in Figures 1 to 4 or Figure 5 any of the linkers shown in (Formula XI), wherein the "oligonucleotide" refers to the nucleic acid according to the present application, wherein the nucleic acid according to the present application comprises a modified second strand (5'-3') having the following modification pattern:
[0519] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0520] where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0521] Preferably, wherein the linker is conjugated to the 3'-terminal region of the second strand via a phosphodiester bond.
[0522] In some embodiments, the GalNAc ligand is included in the Figure 3 shown linker, wherein "oligonucleotide" refers to the nucleic acid according to the present application, and the nucleic acid according to the present application comprises a modified second strand (5'-3') having the following modification pattern:
[0523] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0524] where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0525] Preferably, wherein the linker is conjugated to the 3'-terminal region of the second strand via a phosphodiester bond.
[0526] In some embodiments, the GalNAc ligand is included in the Figure 5 (Formula XI) shown linker, wherein "oligonucleotide" refers to the nucleic acid according to the present application, and the nucleic acid according to the present application comprises a modified second strand (5'-3') having the following modification pattern:
[0527] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0528] where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0529] Preferably, wherein the linker is conjugated to the 3'-terminal region of the second strand via a phosphodiester bond.
[0530] In some embodiments, the GalNAc ligand is included in the Figures 1 to 4 or Figure 5 (Formula XI) any of the shown linkers, wherein "oligonucleotide" refers to the nucleic acid according to the present application, and the nucleic acid according to the present application comprises a modified second strand (5'-3') having the following modification pattern:
[0531] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0532] where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0533] and wherein the second strand has the following structure:
[0534]
[0535] wherein:
[0536] T represents a 2’Me ribose modification,
[0537] B represents the nucleobase of the first two nucleosides in the 5’ terminal region of the second strand, and
[0538] Z represents the remaining 19 consecutive nucleosides of the second strand.
[0539] In some embodiments, the GalNAc ligand is included in the Figure 3 linker shown, wherein “oligonucleotide” refers to a nucleic acid according to the present application, and wherein the nucleic acid according to the present application comprises a modified second strand (5’-3’) having the following modification pattern:
[0540] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0541] where (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0542] and wherein the second strand has the following structure:
[0543]
[0544] wherein:
[0545] T represents a 2’Me ribose modification,
[0546] B represents the nucleobase of the first two nucleosides in the 5’ terminal region of the second strand, and
[0547] Z represents the remaining 19 consecutive nucleosides of the second strand.
[0548] In some embodiments, the GalNAc ligand is included in the Figure 5In the linker of formula (XI), wherein "oligonucleotide" refers to a nucleic acid according to the present application, and the nucleic acid according to the present application comprises a modified second strand (5'-3') having the following modification pattern:
[0549] ia–ia-Me(s)Me(s)Me-Me-Me-Me-Me-Me-F-F-F-Me-Me-Me-Me-Me-Me-Me-Me-Me–Me,
[0550] wherein (s) is a phosphorothioate internucleoside bond, and ia represents an inverted abasic nucleoside,
[0551] and wherein the second strand has the following structure:
[0552]
[0553] wherein:
[0554] T represents a 2’Me ribose modification,
[0555] B represents the nucleobase of the first two base nucleosides in the 5'-terminal region of the second strand, and
[0556] Z represents the remaining 19 consecutive base nucleosides of the second strand.
[0557] Vectors and cells
[0558] In one aspect, the present application provides a cell containing a nucleic acid, such as the inhibitory RNA [RNAi] described herein.
[0559] In one aspect, the present application provides a cell comprising a vector as described herein.
[0560] Pharmaceutically acceptable compositions
[0561] In one aspect, the present application provides a pharmaceutical composition for inhibiting the expression of a target gene, the composition comprising a nucleic acid as disclosed herein.
[0562] The pharmaceutically acceptable composition may comprise an excipient and / or a carrier.
[0563] Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffers; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) fillers, such as polypeptides and amino acids; (23) serum components, such as serum albumin, HDL, and LDL; and (22) other non-toxic and compatible substances for pharmaceutical formulations.
[0564] Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropylmethyl cellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silica, stearic acid, metal stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).
[0565] Pharmaceutically acceptable organic or inorganic excipients that do not react detrimentally with the nucleic acid and are suitable for parenteral administration can also be used to formulate the compositions of the present application. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinylpyrrolidone, etc.
[0566] Formulations for topical administration of nucleic acids can include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents (such as alcohols), or solutions of nucleic acids in liquid or solid oil bases. The solutions can also contain buffering agents, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients that do not react detrimentally with the nucleic acid and are suitable for parenteral administration can be used.
[0567] In one embodiment, the nucleic acid or composition is administered in a non-buffered solution. In certain embodiments, the non-buffered solution is saline or water. In other embodiments, the nucleic acid, such as an siRNA agent, is administered in a buffered solution. In such embodiments, the buffered solution can comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. For example, the buffered solution can be phosphate buffered saline (PBS).
[0568] Dose
[0569] The pharmaceutical compositions of the present application can be administered in a dose sufficient to inhibit gene expression. Generally, a suitable dose of the nucleic acid (e.g., siRNA) of the present application will range from about 0.001 to about 200.0 milligrams per kilogram of recipient body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. Generally, a suitable dose of the nucleic acid (e.g., siRNA) of the present application will range from about 0.1 mg / kg to about 5.0 mg / kg, such as about 0.3 mg / kg and about 3.0 mg / kg.
[0570] A repeated dose regimen can include administering a therapeutically effective amount of the nucleic acid, such as siRNA, periodically (e.g., every other day or once a year). In certain embodiments, the nucleic acid (e.g., siRNA) is administered from about once a month to about once a quarter (i.e., about once every three months).
[0571] In various embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose of about 0.01 mg / kg to about 10 mg / kg or 0.5 mg / kg to about 50 mg / kg. In some embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose of about 10 mg / kg to about 30 mg / kg. In certain embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose selected from about 0.5 mg / kg, 1 mg / kg, 1.5 mg / kg, 3 mg / kg, 5 mg / kg, 10 mg / kg, and 30 mg / kg. In certain embodiments, the nucleic acid (e.g., siRNA agent) is administered at a dose of about 0.1 mg / kg to about 5.0 mg / kg once a week, once a month, once every two months, or once a quarter (i.e., once every three months). In certain embodiments, the nucleic acid (e.g., siRNA agent) is administered to a subject once a week. In certain embodiments, the nucleic acid (e.g., siRNA agent) is administered to a subject once a month. In certain embodiments, the nucleic acid (e.g., siRNA agent) is administered once a quarter (i.e., once every three months).
[0572] After the initial treatment regimen, treatment can be carried out at a lower frequency. For example, after administration once a week or once every two weeks for three months, it can be repeated once a month for six months or one year; or for even longer.
[0573] The pharmaceutical composition can be administered once daily, or in two, three or more sub-doses at appropriate intervals during the day, or even by continuous infusion or delivery via a controlled release formulation. In such cases, the nucleic acid (e.g., siRNA) contained in each sub-dose must be correspondingly smaller to achieve the total daily dose. The dosage units can also be combined to be delivered over several days, for example using a conventional sustained release formulation that provides a sustained release of the nucleic acid (e.g., siRNA) over several days. Sustained release formulations are well known in the art and are particularly useful for delivering reagents at specific sites, such as can be used in conjunction with the reagents of the present application. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
[0574] In other embodiments, a single dose of the pharmaceutical composition can be long-acting such that subsequent doses are administered at intervals of no more than 3, 4 or 5 days, or at intervals of no more than 1, 2, 3 or 4 weeks. In some embodiments of the present application, a single dose of the pharmaceutical composition of the present application is administered once a week. In other embodiments of the present application, a single dose of the pharmaceutical composition of the present application is administered once every two months. In certain embodiments, siRNA is administered at about once a month to about once a quarter (i.e., about once every three months), or even once every 6 months or 12 months.
[0575] The effective dose and in vivo half-life of the individual nucleic acids (e.g., siRNA) covered by the present application can be evaluated using conventional methodologies or in vivo testing based on the use of suitable animal models, as is known in the art.
[0576] The pharmaceutical composition of the present application can be administered in a variety of ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be local (e.g., via a transdermal patch), pulmonary, e.g., by inhalation or insufflation of powder or aerosol, including via a nebulizer; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous administration, e.g., via an implanted device; or intracranial administration, e.g., via intracerebral, intrathecal or intraventricular administration. In certain preferred embodiments, the composition is administered by intravenous infusion or injection. In certain embodiments, the composition is administered by subcutaneous injection.
[0577] In one embodiment, the nucleic acid (e.g., siRNA agent) is administered subcutaneously to a subject.
[0578] Nucleic acids (such as siRNA agents) can be delivered in a manner that targets a specific tissue (e.g., specifically hepatocytes).
[0579] Method for inhibiting target gene expression
[0580] The present application also provides a method for inhibiting the expression of a target gene in a cell. The method includes contacting the cell with an amount of the nucleic acid (such as an siRNA agent, such as a double-stranded siRNA agent) of the present application that effectively inhibits the expression of the target gene in the cell, thereby inhibiting the expression of the target gene in the cell. It should be noted that the nucleic acid "for inhibiting the expression of the target gene" is a nucleic acid capable of inhibiting the expression of the target gene, preferably as described below.
[0581] Contacting the cell with the nucleic acid (such as siRNA, such as a double-stranded siRNA agent) can be carried out in vitro or in vivo. Contacting the in vivo cell with the nucleic acid, for example, includes contacting the cell or cell population in a subject (such as a human subject) with the nucleic acid (such as siRNA). A combination of in vitro and in vivo methods of contacting the cell is also possible. As described above, contacting the cell can be direct or indirect. In addition, contacting the cell can be achieved through a targeting ligand moiety (including any ligand moiety described herein or known in the art). In a preferred embodiment, the targeting ligand moiety is a carbohydrate moiety, such as a GalNAc3 ligand, or any other ligand moiety that directs the siRNA agent to the target site.
[0582] As used herein, the term "inhibit" can be used interchangeably with "reduce", "silence", "downregulate", "suppress", and other similar terms, and includes any level of inhibition.
[0583] In some embodiments of the method of the present application, the expression of the target gene is inhibited by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or below the detected level of determination, preferably when determined by qPCR as described herein and / or when siRNA is introduced into the target cell by transfection. In certain embodiments, the method includes a clinically relevant inhibition of target gene expression, for example, as demonstrated by clinically relevant outcomes after treating a subject with an agent that reduces gene expression.
[0584] In some embodiments, when transfected into cells, the nucleic acids of the present application inhibit the expression of a target gene with an IC50 value of less than 2500 pM, 2400 pM, 2300 pM, 2200 pM, 2100 pM, 2000 pM, 1900 pM, 1800 pM, 1700 pM, 1600 pM, 1500 pM, 1400 pM, 1300 pM, 1200 pM, 1100 pM, 1000 pM, 900 pM, 800 pM, 700 pM, 600 pM, 500 pM, 400 pM, 300 pM, 200 pM or 100 pM, as described herein, preferably determined by qPCR, more preferably determined by reverse transcriptase (RT)-qPCR.
[0585] Inhibition of target gene expression can be quantified by the following methods:
[0586] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) can be cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS under an atmosphere of 37 °C and 5% CO2. Then, the cells can be transfected with siRNA duplexes targeting the mRNA or negative control siRNA (siRNA-control; sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:85), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO:84)), using 10x3-fold serial dilutions with a final duplex concentration ranging from 20 nM to 1 pM. Transfection can be carried out by adding 9.7 μL Opti-MEM (ThermoFisher) and 0.3 μL Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture can be incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells can be incubated at 37 °C / 5% CO2 for 24 hours, and then total RNA can be purified using the RNeasy 96 kit (Qiagen). Each duplex can be tested by transfection in replicate wells in a single experiment.
[0587] cDNA synthesis can be carried out using the FastQuant RT (with gDNA enzyme) kit (Tiangen). Real-time fluorescence quantitative PCR (qPCR) can be carried out on an ABI Prism 7900HT or ABI QuantStudio 7 using specific primers for the target gene and human GAPDH (Hs02786624_g1), using the FastStart Universal Probe Master kit (Roche).
[0588] qPCR can be repeated for the cDNA from each well, and the average cycle threshold (Ct) can be calculated. The maximum percentage inhibition of target gene expression and the IC50 value can be calculated using GraphPad Prism 9 with a four-parameter (variable slope) model.
[0589] Alternatively or additionally, the inhibition of target gene expression can be characterized by a decrease in the average relative expression of the target gene.
[0590] In some embodiments, when cells are transfected with 0.1 nM of the nucleic acid of the present application, the average relative expression of the target gene is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, as described herein, preferably determined by qPCR, more preferably determined by reverse transcriptase (RT)-qPCR.
[0591] In some embodiments, when cells are transfected with 5 nM of the nucleic acid of the present application, the average relative expression of the target gene is less than 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4 or 0.3, as described herein, preferably determined by qPCR, more preferably determined by reverse transcriptase (RT)-qPCR.
[0592] The average relative expression of the target gene can be quantified by the following method:
[0593] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) can be cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS in an atmosphere of 37 °C and 5% CO2. Cells can be transfected with siRNA duplexes targeting mRNA or negative control siRNA (siRNA-control; sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:85), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO:84)) at a final duplex concentration of 5 nM and 0.1 nM. Transfection can be carried out by adding 9.7 μL of Opti-MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) to 10 μL of each siRNA duplex. The mixture can be incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. The cells can be incubated at 37 °C / 5% CO2 for 24 hours, and then total RNA can be purified using the RNeasy 96 kit (Qiagen). Each duplex can be tested by transfection in duplicate wells in two independent experiments.
[0594] cDNA synthesis can be carried out using the FastQuant RT (with gDNA enzyme) kit (Tiangen). Real-time fluorescence quantitative PCR (qPCR) can be performed on an ABIPrism 7900HT or ABI QuantStudio 7 using specific primers for the target gene and human GAPDH (Hs02786624_g1), and the FastStart Universal Probe Master kit (Roche).
[0595] qPCR can be repeated for the cDNA from each well, and the average Ct can be calculated. Relative target gene expression can be calculated using the comparative Ct (ΔΔCt) method based on the average Ct value, normalized to GAPDH and relative to untreated cells.
[0596] Inhibition of target gene expression can be manifested by a decrease in the amount of mRNA of the target gene compared to a suitable control.
[0597] In other embodiments, inhibition of target gene expression can be evaluated based on a decrease in a parameter related to the function of gene expression, such as protein expression or signal pathway. Example target genes as shown herein are HCII, ZPI, and B4GALT1.
[0598] Methods for treating or preventing diseases related to target gene expression
[0599] This application also provides a method for reducing or inhibiting target gene expression in cells using the nucleic acids (such as siRNA) of this application or a composition containing the nucleic acids (such as siRNA) of this application. The method includes contacting the cells with the nucleic acids (such as dsiRNA) of this application and maintaining the cells for a sufficient time to obtain degradation of the mRNA transcript of the target, thereby inhibiting the expression of the target gene in the cells. Reduction of gene expression can be evaluated by any method known in the art.
[0600] In the methods of this application, the cells can be contacted in vitro or in vivo, i.e., the cells can be in a subject.
[0601] Cells suitable for treatment using the methods of this application can be any cells that express a target gene related to a disease associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder, such as hemophilia, specifically when the target gene is ZPI or HCII.
[0602] Alternatively, cells suitable for treatment using the methods of this application can be any cells that express a target gene related to diabetes or cardiovascular disease, specifically when the target gene is B4GALT1.
[0603] The in vivo method of the present application may include administering to a subject a composition containing a nucleic acid (eg, siRNA) of the present application, wherein the nucleic acid (eg, siRNA) includes a nucleotide sequence that is complementary to at least a portion of an RNA transcript of a target gene of a mammal to be treated.
[0604] The present application also provides a method for treating a subject in need. The method of treatment of the present application includes administering a nucleic acid (e.g., siRNA) of the present application to a subject (e.g., a subject that can benefit from reducing or inhibiting the expression of a target gene) in a therapeutically effective amount, such as a nucleic acid (e.g., siRNA) of a target gene or a pharmaceutical composition comprising a nucleic acid of a targeted gene.
[0605] The disease to be treated may be associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder, for example, hemophilia, for example when the target gene is HCII or ZPI disclosed herein.
[0606] Haemophilia (or hemophilia) is a primarily inherited genetic disorder that impairs the body's ability to form blood clots, a process needed to stop bleeding. This causes subjects to bleed longer after an injury, bruise easily, and have an increased risk of bleeding into the joints or brain. Subjects with mild forms of the disease may only experience symptoms after an accident or during surgery. Bleeding into the joints (also called haemarthrosis), can result in permanent damage, while bleeding into the brain can cause long-term headaches, seizures, or a decreased level of consciousness.
[0607] There are two main types of hemophilia: hemophilia A (occurs due to low amounts of clotting factor VIII) and hemophilia B (occurs due to low levels of clotting factor IX). They are usually inherited from a parent through the X chromosome that carries a non-functional gene. Rarely, new mutations can occur during early development, or due to the formation of antibodies against clotting factors, and hemophilia may develop later in life. Other types include hemophilia C (occurs due to low levels of clotting factor XI), von Willebrand disease (occurs due to low levels of a substance called von Willebrand factor), and parahemophilia (occurs due to low levels of clotting factor V). Hemophilia A, B, and C prevent the proper functioning of the intrinsic pathway; this clotting pathway is necessary when the endothelium of blood vessels is damaged. Acquired hemophilia is associated with cancer, autoimmune diseases, and pregnancy. Diagnosis is made by testing the blood's ability to clot and its levels of clotting factors.
[0608] In certain embodiments, the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, are suitable for treating, or treating hemophilia A, B, and / or C. In certain embodiments, the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, are suitable for treating, or treating hemophilia A and / or B. In certain embodiments, the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, are suitable for treating, or treating acquired hemophilia. In certain embodiments, the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, are suitable for treating, or treating von Willebrand disease. In certain embodiments, the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, are suitable for treating, or treating parahemophilia.
[0609] Without wishing to be bound by theory, treatment with the nucleic acids of the present application may lead to an increase in the level of clotting factors, thereby reducing or preventing bleeding. Accordingly, in a preferred embodiment, treatment with the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, can reduce or prevent bleeding episodes in a subject with hemophilia. In another preferred embodiment, treatment with the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, can reduce or prevent joint bleeding in a subject with hemophilia. In certain embodiments, treatment with the nucleic acids of the present application, specifically those that inhibit the expression of ZPI or HCII, can reduce or prevent muscle or cerebral bleeding in a subject with hemophilia.
[0610] The disease to be treated can be diabetes, specifically when the target gene is B4GALT1 as disclosed herein.
[0611] As used herein, the term "diabetes" according to the present application refers to a group of metabolic diseases in which a subject has hyperglycemia, either because the body cannot produce enough insulin or because the cells do not respond to the insulin produced. There are mainly three types of diabetes: (1) Type 1 diabetes (T1D): caused by the body's inability to produce insulin and currently requires artificial insulin injection. (Also known as insulin-dependent diabetes mellitus (IDDM for short) and juvenile diabetes); (2) Type 2 diabetes (T2D): caused by insulin resistance, a condition in which cells cannot use insulin properly, sometimes accompanied by absolute insulin deficiency. (Previously known as non-insulin-dependent diabetes mellitus (NIDDM for short) and adult-onset diabetes); (3) Gestational diabetes (GD): refers to pregnant women who have never had diabetes before and have high blood sugar levels during pregnancy. It may occur before T2D.
[0612] In certain embodiments, the nucleic acids according to the present application, specifically nucleic acids that inhibit B4GALT1 expression, or pharmaceutical compositions comprising said nucleic acids are used for the treatment of diabetes, preferably type 2 diabetes (T2D).
[0613] The disease to be treated can be a cardiovascular disease, specifically when the target gene is B4GALT1 as disclosed herein.
[0614] As used herein, the term "cardiovascular disease" refers to any disorder, disease or disease state associated with, caused by or resulting in an abnormal structure or function of the heart or the blood vessels supplying the heart, thereby impairing the normal function of the heart. Cardiovascular diseases may include coronary artery disease, atherosclerosis, myocardial infarction, arteriosclerosis, hypertension, angina pectoris, deep vein thrombosis, stroke, congestive heart failure or arrhythmia. In a preferred embodiment, the cardiovascular disease is coronary artery disease.
[0615] In certain embodiments, the nucleic acids according to the present application, specifically nucleic acids that inhibit B4GALT1 expression, or pharmaceutical compositions comprising said nucleic acids are used for the treatment of cardiovascular diseases, preferably coronary artery disease.
[0616] The nucleic acids of the present application (e.g., siRNA) can be administered as "naked" nucleic acids or "naked" siRNA, and can be administered without a pharmaceutical composition. The naked nucleic acid can be in a suitable buffer solution. The buffer solution can comprise acetate, citrate, gliadin, carbonate or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmotic pressure of the buffer solution can be adjusted such that it is suitable for administration to a subject.
[0617] Alternatively, the nucleic acids of the present application (e.g., siRNA) can be administered as a pharmaceutical composition (e.g., a dsiRNA liposomal formulation).
[0618] In one embodiment, the method comprises administering a composition characterized herein such that the expression of the target gene is reduced, for about 1, 2, 3, 4, 5, 6, 7, 8, 12, 16, 18, 24 hours, 28, 32 or about 36 hours. In one embodiment, the reduction in the expression of the target gene persists for a longer period, such as at least about two days, three days, four days or more days, such as about one week, two weeks, three weeks or four weeks or longer, such as about 1 month, 2 months or 3 months.
[0619] A therapeutically effective amount of a nucleic acid (e.g., siRNA), such as from about 0.01 mg / kg to about 200 mg / kg, can be administered to a subject to treat a disease associated with a hemostatic disorder (such as a disease associated with a hemostatic disorder, such as hemophilia) or to prevent or treat diabetes or cardiovascular disease.
[0620] Nucleic acids (such as siRNA) can be administered by intravenous infusion periodically over a period of time. In certain embodiments, after an initial treatment regimen, treatment can be performed at a lower frequency. Administration of siRNA can reduce the level of the gene product of the target gene, for example, by at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% in the cells or tissues of a patient, or below the level of detection of the assay used. In certain embodiments, administration results in clinical stabilization or preferably a clinically relevant reduction of at least one sign or symptom of a target gene-related disorder.
[0621] Alternatively, nucleic acids (such as siRNA) can be administered subcutaneously, i.e., by subcutaneous injection. One or more injections can be used to deliver the desired daily dose of nucleic acid (such as siRNA) to a subject. The injections can be repeated over a period of time. The administration can be repeated periodically. In certain embodiments, after an initial treatment regimen, treatment can be performed at a lower frequency. The repeated dose regimen can include periodic administration of a therapeutically effective amount of nucleic acid, such as once every other day or once a year. In certain embodiments, the nucleic acid is administered from about once a month to about once a quarter (i.e., about once every three months).
[0622] In one aspect, the present application can be applied to the compounds, methods, compositions or uses numbered 1-101 below, wherein any reference to a formula in items 1-101 refers only to those formulas defined within items 1-101. These formulas are reproduced in Figure 5 . Specifically, the oligonucleotide moiety represented by Z in any of the following items can include a nucleic acid for inhibiting the expression of ZPI, HCII or B4GALT1 as defined below.
[0623] 1. A compound comprising the following structure:
[0624]
[0625] Wherein:
[0626] Each occurrence of R1 is independently selected from the group consisting of hydrogen, methyl and ethyl;
[0627] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen and nitro;
[0628] Each occurrence of X1 and X2 is independently selected from the group consisting of methylene, oxygen and sulfur;
[0629] m is an integer from 1 to 6;
[0630] n is an integer from 1 to 10;
[0631] q, r, s, t, v are independently integers from 0 to 4, provided that:
[0632] (i) q and r cannot both be 0 at the same time; and
[0633] (ii) s, t and v cannot all be 0 at the same time;
[0634] Z is an oligonucleotide moiety.
[0635] 2. The compound according to item 1, wherein R1 is hydrogen each time it appears.
[0636] 3. The compound according to item 1, wherein R1 is methyl.
[0637] 4. The compound according to item 1, wherein R1 is ethyl.
[0638] 5. The compound according to any one of items 1 to 4, wherein R2 is hydroxyl.
[0639] 6. The compound according to any one of items 1 to 4, wherein R2 is halogen.
[0640] 7. The compound according to item 6, wherein R2 is fluorine.
[0641] 8. The compound according to item 6, wherein R2 is chlorine.
[0642] 9. The compound according to item 6, wherein R2 is bromine.
[0643] 10. The compound according to item 6, wherein R2 is iodine.
[0644] 11. The compound according to item 6, wherein R2 is nitro.
[0645] 12. The compound according to any one of items 1 to 11, wherein X1 is methylene.
[0646] 13. The compound according to any one of items 1 to 11, wherein X1 is oxygen.
[0647] 14. The compound according to any one of items 1 to 11, wherein X1 is sulfur.
[0648] 15. The compound according to any one of items 1 to 14, wherein X2 is methylene.
[0649] 16. The compound according to any one of items 1 to 15, wherein X2 is oxygen.
[0650] 17. The compound according to any one of items 1 to 16, wherein X2 is sulfur.
[0651] 18. The compound according to any one of items 1 to 17, wherein m = 3.
[0652] 2. The compound according to any one of items 1 to 18, wherein n = 6.
[0653] 20. The compound according to items 13 and 15, wherein X1 is oxygen and X2 is methylene, and preferably wherein:
[0654] q = 1,
[0655] r = 2,
[0656] s = 1,
[0657] t = 1,
[0658] v = 1.
[0659] 21. The compound according to items 12 and 15, wherein both X1 and X2 are methylene, and preferably wherein:
[0660] q = 1,
[0661] r = 3,
[0662] s = 1,
[0663] t = 1,
[0664] v = 1.
[0665] 22. The compound according to any one of items 1 to 21, wherein Z is:
[0666]
[0667] wherein:
[0668] Z1, Z2, Z3, Z4 are each independently oxygen or sulfur upon each occurrence; and
[0669] One of the bonds between P and Z2 and between P and Z3 is a single bond and the other is a double bond.
[0670] 23. The compound according to item 22, wherein the oligonucleoside is an RNA compound capable of regulating, preferably inhibiting, the expression of a target gene.
[0671] 24. The compound according to item 23, wherein the RNA compound comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein each of the first strand and the second strand has 5' and 3' ends.
[0672] 25. The compound according to item 24, wherein the RNA compound is linked to an adjacent phosphate at the 5' end of its second strand.
[0673] 26. A compound according to item 24, wherein the RNA compound is linked to an adjacent phosphate at the 3' end of its second strand.
[0674] 27. A compound of formula (II):
[0675]
[0676] 28. A compound of formula (III):
[0677]
[0678] 29. A compound according to item 27 or 28, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' end of its second strand.
[0679] 30. A composition comprising a compound of formula (II) as defined in item 27, and a compound of formula (III) as defined in item 28, optionally subject to item 29.
[0680] 31. A composition according to item 30, wherein the compound of formula (III) as defined in item 28 is present in an amount of 10 to 15% by weight of the composition.
[0681] 32. A compound of formula (IV):
[0682]
[0683] 33. A compound of formula (V):
[0684]
[0685] 34. A compound according to item 32 or 33, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' end of its second strand.
[0686] 35. A composition comprising a compound of formula (IV) as defined in item 32, and a compound of formula (V) as defined in item 33, optionally subject to item 34.
[0687] 36. The composition according to item 35, wherein the compound of formula (V) as defined in item 33 is present in an amount of 10 to 15% by weight of the composition.
[0688] 37. A compound as defined in any one of items 1 to 29 or 32 to 34, wherein the oligonucleoside comprises an RNA duplex, and the RNA duplex further comprises one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position.
[0689] 38. The compound according to item 37, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.
[0690] 39. A compound as defined in any one of items 1 to 29, or 32 to 34, or 37 to 38, wherein the oligonucleoside further comprises one or more degradation protection moieties at one or more termini.
[0691] 40. The compound according to item 39, wherein the one or more degradation protection moieties are not present at the termini of the oligonucleoside chain carrying the ligand moiety, and / or wherein the one or more degradation protection moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, wherein the inverted abasic nucleosides are present at the distal end of the chain carrying the ligand moiety.
[0692] 41. A compound as defined in any one of items 1 to 29, or 32 to 34, or 37 to 40, wherein the ligand moiety as described in formula (I) in item 1 comprises one or more ligands.
[0693] 42. The compound according to item 41, wherein the ligand moiety as described in formula (I) in item 1 comprises one or more carbohydrates.
[0694] 43. The compound according to item 42, wherein the one or more carbohydrates can be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, or polysaccharides.
[0695] 44. The compound according to item 43, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties, and / or one or more mannose moieties.
[0696] 45. The compound according to item 44, wherein the one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.
[0697] 46. The compound according to item 45, which comprises two or three N-acetylgalactosamine moieties.
[0698] 47. A compound according to any one of items 41 to 46, wherein said one or more ligands are connected in a linear configuration or a branched configuration.
[0699] 48. A compound according to item 47, wherein said one or more ligands are connected in a bi-antennal or tri-antennal branched configuration.
[0700] 49. A compound according to items 46 to 48, wherein the moiety as described in formula (I) in item 1:
[0701]
[0702] is any one of formula (VIa), (VIb) or (VIc), preferably formula (VIa):
[0703]
[0704] wherein:
[0705] A I is hydrogen, or a suitable hydroxyl protecting group;
[0706] a is an integer of 2 or 3; and
[0707] b is an integer from 2 to 5; or
[0708]
[0709] wherein:
[0710] A I is hydrogen, or a suitable hydroxyl protecting group;
[0711] a is an integer of 2 or 3; and
[0712] c and d are independently integers from 1 to 6; or
[0713]
[0714] wherein:
[0715] A I is hydrogen, or a suitable hydroxyl protecting group;
[0716] a is an integer of 2 or 3; and
[0717] e is an integer from 2 to 10.
[0718] 50. A compound according to items 46 to 48, wherein the moiety as described in formula (I) in item 1:
[0719]
[0720] is formula (VII):
[0721]
[0722] Wherein:
[0723] A I is hydrogen;
[0724] a is an integer of 2 or 3.
[0725] 51. A compound according to item 49 or 50, wherein a = 2.
[0726] 52. A compound according to item 49 or 50, wherein a = 3.
[0727] 53. A compound according to item 49, wherein b = 3.
[0728] 54. A compound of formula (VIII):
[0729]
[0730] 55. A compound of formula (IX):
[0731]
[0732] 56. A compound according to item 54 or 55, wherein the oligonucleotide comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' end of its second strand.
[0733] 57. A composition comprising a compound of formula (VIII) as defined in item 54, and a compound of formula (IX) as defined in item 55, optionally subject to item 56.
[0734] 58. A composition according to item 57, wherein the compound of formula (IX) as defined in item 55 is present in an amount of 10 to 15% by weight of the composition.
[0735] 59. A compound of formula (X):
[0736]
[0737] 60. A compound of formula (XI):
[0738]
[0739] 61. A compound according to item 59 or 60, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' end of its second strand.
[0740] 62. A composition comprising a compound of formula (X) as defined in item 59, and a compound of formula (XI) as defined in item 60, optionally subordinate to item 61.
[0741] 63. The composition according to item 62, wherein the compound of formula (XI) as defined in item 60 is present in an amount of 10 to 15% by weight of the composition.
[0742] 64. A compound as defined in any one of items 54 to 63, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex further comprising one or more riboses modified at the 2' position, preferably a plurality of riboses modified at the 2' position.
[0743] 65. The compound according to item 64, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.
[0744] 66. The compound according to any one of items 54 to 65, wherein the oligonucleoside further comprises one or more degradation protection moieties at one or more ends.
[0745] 67. The compound according to item 66, wherein the one or more degradation protection moieties are not present at the ends of the oligonucleoside chain carrying the ligand moiety, and / or wherein the one or more degradation protection moieties are selected from phosphorothioate internucleoside linkages, dithiophosphonate internucleoside linkages, and inverted abasic nucleosides, wherein the inverted abasic nucleoside is present at the distal end of the chain carrying the ligand moiety, as shown in any one of formulas (VIII), (IX), (X), or (XI) in items 54, 55, 59, or 60.
[0746] 68. A method for preparing a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67 and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62, 63, which comprises reacting compounds of formulas (XII) and (XIII):
[0747]
[0748]
[0749] wherein:
[0750] Each occurrence of R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl;
[0751] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen, and nitro;
[0752] Each occurrence of X1 and X2 is independently selected from the group consisting of methylene, oxygen, and sulfur;
[0753] m is an integer from 1 to 6;
[0754] n is an integer from 1 to 10;
[0755] q, r, s, t, v are independently integers from 0 to 4, provided that:
[0756] (i) q and r cannot both be 0 at the same time; and
[0757] (ii) s, t, and v cannot all be 0 at the same time;
[0758] Z is an oligonucleoside moiety;
[0759] And, where appropriate, deprotection of the ligand and / or annealing of the second strand of the oligonucleoside moiety is carried out.
[0760] 69. The method according to item 68, wherein the compound of formula (XII) is prepared by reacting the compounds of formulas (XIV) and (XV):
[0761]
[0762] Each occurrence of R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl;
[0763] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen, and nitro;
[0764] Each occurrence of X1 and X2 is independently selected from the group consisting of methylene, oxygen, and sulfur;
[0765] q, r, s, t, v are independently integers from 0 to 4, provided that:
[0766] (i) q and r cannot both be 0 at the same time; and
[0767] (ii) s, t, and v cannot all be 0 at the same time;
[0768] Z is an oligonucleoside moiety.
[0769] 70. A method according to item 68 for preparing a compound according to any one of items 20, 25, 27, 29, 54, 56, and / or a composition according to any one of items 30, 31, 57, 58, wherein:
[0770] The compound of formula (XII) is of formula (XIIa):
[0771]
[0772] And the compound of formula (XIII) is of formula (XIIIa):
[0773]
[0774] Wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' end of its second strand.
[0775] 71. A method according to item 68 for preparing a compound according to any one of items 20, 25, 28, 29, 55, 56, and / or a composition according to any one of items 30, 31, 57, 58, wherein:
[0776] The compound of formula (XII) is of formula (XIIb):
[0777]
[0778] And the compound of formula (XIII) is of formula (XIIIa):
[0779]
[0780] Wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' end of its second strand.
[0781] 72. A method according to item 68 for preparing a compound according to any one of items 21, 26, 32, 34, 59, 61, and / or a composition according to any one of items 35, 36, 62, 63, wherein:
[0782] The compound of formula (XII) is of formula (XIIc):
[0783]
[0784] and the compound of formula (XIII) is of formula (XIIIa):
[0785]
[0786] wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' terminus of its second strand.
[0787] 73. A method according to item 68 for preparing a compound according to any one of items 21, 26, 33, 34, 60, 61, and / or a composition according to any one of items 35, 36, 62, 63, wherein:
[0788] the compound of formula (XII) is of formula (XIId):
[0789]
[0790] and the compound of formula (XIII) is of formula (XIIIa):
[0791]
[0792] wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' terminus of its second strand.
[0793] 74. A method according to any one of items 70 to 73, wherein:
[0794] the compound of formula (XIIIa) is of formula (XIIIb):
[0795]
[0796] 75. A method according to item 69, dependent on items 70 to 73, wherein:
[0797] the compound of formula (XIV) is of formula (XIVa) or formula (XIVb):
[0798]
[0799] and the compound of formula (XV) is of formula (XVa) or formula (XIVb):
[0800]
[0801]
[0802] wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein (i) the RNA duplex is linked at the 5' terminus of its second strand to an adjacent phosphate in formula (XV a), or (ii) the RNA duplex is linked at the 3' terminus of its second strand to an adjacent phosphate in formula (XV b).
[0803] 76. A compound of formula (XII):
[0804]
[0805] wherein:
[0806] R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl each time it appears;
[0807] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen, and nitro;
[0808] X1 and X2 are independently selected from the group consisting of methylene, oxygen, and sulfur each time they appear;
[0809] q, r, s, t, v are independently integers from 0 to 4, provided that:
[0810] (i) q and r cannot both be 0 at the same time; and
[0811] (ii) s, t, and v cannot all be 0 at the same time;
[0812] Z is an oligonucleoside moiety.
[0813] 77. A compound of formula (XII a):
[0814]
[0815] 78. A compound of formula (XII b):
[0816]
[0817] 79. A compound of formula (XII c):
[0818]
[0819] 80. Compounds of formula (XIId):
[0820]
[0821] 81. Compounds of formula (XIII):
[0822]
[0823] Wherein:
[0824] R1 is independently selected from the group consisting of hydrogen, methyl and ethyl each time it appears;
[0825] m is an integer from 1 to 6;
[0826] n is an integer from 1 to 10.
[0827] 82. Compounds of formula (XIIIa):
[0828]
[0829] 83. Compounds of formula (XIIIb):
[0830]
[0831] 84. Compounds of formula (XIV):
[0832]
[0833] Wherein:
[0834] R1 is selected from the group consisting of hydrogen, methyl and ethyl;
[0835] R2 is selected from the group consisting of hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen and nitro;
[0836] X2 is selected from the group consisting of methylene, oxygen and sulfur;
[0837] s, t, v are independently integers from 0 to 4, provided that s, t and v cannot all be 0 at the same time.
[0838] 85. Compounds of formula (XIVa):
[0839]
[0840] 86. Compounds of formula (XIVb):
[0841]
[0842] 87. Compounds of formula (XV):
[0843]
[0844] Wherein:
[0845] Each occurrence of R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl;
[0846] X1 is selected from the group consisting of methylene, oxygen, and sulfur;
[0847] q and r are independently integers from 0 to 4, provided that q and r cannot both be 0 at the same time;
[0848] Z is an oligonucleoside moiety.
[0849] 88. A compound of formula (XVa):
[0850]
[0851] 89. A compound of formula (XVb):
[0852]
[0853] 90. Use of a compound according to any one of items 76, 81 to 84, 87 in the preparation of a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62, and 63.
[0854] 91. Use of a compound according to item 85 in the preparation of a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62, and 63, wherein R2 = F.
[0855] 92. Use of a compound according to item 86 in the preparation of a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61, and 64 to 67, and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62, and 63, wherein R2 = OH.
[0856] 93. Use of a compound according to item 77 in the preparation of a compound according to any one of items 20, 25, 27, 29, 54, 56, and / or a composition according to any one of items 30, 31, 57, 58.
[0857] 94. Use of a compound according to item 78 in the preparation of a compound according to any one of items 20, 25, 28, 29, 55, 56, and / or a composition according to any one of items 30, 31, 57, 58.
[0858] Use of the compound according to item 79 in the preparation of a compound according to any one of items 21, 26, 32, 34, 59, 61, and / or a composition according to any one of items 35, 36, 62, 63.
[0859] Use of the compound according to item 80 in the preparation of a compound according to any one of items 21, 26, 33, 34, 60, 61, and / or a composition according to any one of items 35, 36, 62, 63.
[0860] Use of the compound according to item 88 in the preparation of a compound according to any one of items 20, 25, 27 to 29, 54 to 56, and / or a composition according to any one of items 30, 31, 57, 58.
[0861] Use of the compound according to item 89 in the preparation of a compound according to any one of items 21, 26, 32 to 34, 59 to 61, and / or a composition according to any one of items 35, 36, 62, 63.
[0862] A compound or composition obtainable or obtained by a method according to any one of items 68 to 75.
[0863] A pharmaceutical composition comprising a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 to 67, and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62 and 63, and a pharmaceutically acceptable carrier, diluent or excipient.
[0864] Use of a compound according to any one of items 1 to 29, 32 to 34, 37 to 56, 59 to 61 and 64 - 67, and / or a composition according to any one of items 30, 31, 35, 36, 57, 58, 62 and 63 for treatment.
[0865] On the other hand, the present application can be applied to the compounds, methods, compositions or uses of the following clauses numbered 1 - 56, wherein any reference to a formula in the clauses refers only to those formulas defined within clauses 1 - 56. These formulas are reproduced in Figure 6 Specifically, the oligonucleotide moiety represented by Z in any of the following items may comprise a nucleic acid for inhibiting the expression of ZPI, HCII or B4GALT1 as defined below.
[0866] 1. A compound comprising the following structure:
[0867]
[0868] Wherein:
[0869] r and s are independently integers selected from 1 to 16; and
[0870] Z is an oligonucleotide moiety.
[0871] 2. The compound according to clause 1, wherein s is an integer selected from 4 to 12.
[0872] 3. The compound according to clause 2, wherein s is 6.
[0873] 4. The compound according to any one of clauses 1 to 3, wherein r is an integer selected from 4 to 14.
[0874] 5. The compound according to clause 4, wherein r is 6.
[0875] 6. The compound according to clause 4, wherein r is 12.
[0876] 7. The compound according to clause 5, which is subordinate to item 3.
[0877] 8. The compound according to clause 6, which is subordinate to item 3.
[0878] 9. The compound according to any one of clauses 1 to 8, wherein Z is:
[0879]
[0880] Wherein:
[0881] Z1, Z2, Z3, Z4 are independently oxygen or sulfur each time they appear; and
[0882] One bond between P and Z2 and one bond between P and Z3 is a single bond and the other is a double bond.
[0883] 10. The compound according to any one of clauses 1 to 9, wherein the oligonucleotide is an RNA compound capable of regulating, preferably inhibiting, the expression of a target gene.
[0884] 11. The compound according to clause 10, wherein the RNA compound comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends.
[0885] 12. The compound according to clause 11, preferably also subordinate to items 3 and 6, wherein the RNA compound is linked to an adjacent phosphate at the 5' end of its second strand.
[0886] 13. A compound according to clause 11, preferably also subordinate to items 3 and 5, wherein the RNA compound is linked to an adjacent phosphate at the 3'-end of its second strand.
[0887] 14. A compound of formula (II), preferably subordinate to item 12:
[0888]
[0889] 15. A compound of formula (III), preferably subordinate to item 13:
[0890]
[0891] 16. A compound as defined in any one of items 1 to 15, wherein the oligonucleoside comprises an RNA duplex, and the RNA duplex further comprises one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position.
[0892] 17. A compound according to clause 16, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro and 2'-deoxy.
[0893] 18. A compound according to any one of clauses 1 to 17, wherein the oligonucleoside further comprises one or more degradation protection moieties at one or more termini.
[0894] 19. A compound according to clause 18, wherein the one or more degradation protection moieties are not present at the termini of the oligonucleoside chain carrying the linker / ligand moiety, and / or wherein the one or more degradation protection moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages and inverted abasic nucleosides, and the inverted abasic nucleoside is present at the distal end of the same strand as the terminus carrying the linker / ligand moiety.
[0895] 20. A compound according to any one of clauses 1 to 19, wherein the ligand moiety as described in formula (I) in item 1 comprises one or more ligands.
[0896] 21. A compound according to clause 20, wherein the ligand moiety as described in formula (I) in item 1 comprises one or more carbohydrate ligands.
[0897] 22. A compound according to clause 21, wherein the one or more carbohydrates can be monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides or polysaccharides.
[0898] 23. A compound according to clause 22, wherein the one or more carbohydrates comprise one or more galactose moieties, one or more lactose moieties, one or more N-acetylgalactosamine moieties and / or one or more mannose moieties.
[0899] 24. A compound according to clause 23, wherein said one or more carbohydrates comprise one or more N-acetyl-galactosamine moieties.
[0900] 25. A compound according to clause 24, which comprises two or three N-acetylgalactosamine moieties.
[0901] 26. A compound according to any one of the preceding items, wherein said one or more ligands are linked in a linear configuration or a branched configuration.
[0902] 27. A compound according to clause 26, wherein said one or more ligands are linked in a bi-antennary or tri-antennary branched configuration.
[0903] 28. A compound according to clauses 20 to 27, wherein the moiety as described in formula (I) in item 1:
[0904]
[0905] is any one of formula (IV), (V) or (VI), preferably formula (IV):
[0906]
[0907] wherein:
[0908] A I is hydrogen, or a suitable hydroxyl protecting group;
[0909] a is an integer of 2 or 3; and
[0910] b is an integer from 2 to 5; or
[0911]
[0912] wherein:
[0913] A I is hydrogen, or a suitable hydroxyl protecting group;
[0914] a is an integer of 2 or 3; and
[0915] c and d are independently integers from 1 to 6; or
[0916]
[0917] wherein:
[0918] A I is hydrogen, or a suitable hydroxyl protecting group;
[0919] a is an integer of 2 or 3; and
[0920] e is an integer from 2 to 10.
[0921] 29. A compound according to any one of clauses 1 to 28, wherein said moiety as described by formula (I) in item 1:
[0922]
[0923] is of formula (VII):
[0924]
[0925] wherein:
[0926] A I is hydrogen;
[0927] a is an integer of 2 or 3.
[0928] 30. A compound according to clause 28 or 29, wherein a = 2.
[0929] 31. A compound according to clause 28 or 29, wherein a = 3.
[0930] 32. A compound according to clause 28, wherein b = 3.
[0931] 33. A compound of formula (VIII):
[0932]
[0933] 34. A compound of formula (IX):
[0934]
[0935] 35. A compound according to clause 33 or 34, wherein the oligonucleoside comprises an RNA duplex, and the RNA duplex further comprises one or more riboses modified at the 2'-position, preferably a plurality of riboses modified at the 2'-position.
[0936] 36. A compound according to clause 35, wherein the modification is selected from 2'-O-methyl, 2'-deoxy-fluoro, and 2'-deoxy.
[0937] 37. A compound according to any one of clauses 33 to 36, wherein the oligonucleoside further comprises one or more degradation protection moieties at one or more termini.
[0938] 38. A compound according to clause 37, wherein said one or more degradation protection moieties are not present at the termini of the oligonucleoside chain carrying the linker / ligand moiety, and / or wherein said one or more degradation protection moieties are selected from phosphorothioate internucleoside linkages, phosphorodithioate internucleoside linkages, and inverted abasic nucleosides, wherein the inverted abasic nucleoside is present distally on the same chain as the terminus carrying the linker / ligand moiety.
[0939] 39. A compound according to clause 33, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' terminus of its second strand.
[0940] 40. A compound according to clause 34, wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' terminus of its second strand.
[0941] 41. A method of preparing a compound according to any one of clauses 1 to 40, which comprises reacting compounds of formula (X) and (XI):
[0942]
[0943] wherein:
[0944] r and s are independently integers selected from 1 to 16; and
[0945] Z is an oligonucleoside moiety;
[0946] and, where appropriate, deprotecting the ligand and / or annealing the second strand of the oligonucleoside.
[0947] 42. A method according to clause 41, for preparing a compound according to any one of clauses 6, 8 to 14, 16 to 33 and 35 to 40, wherein:
[0948] The compound of formula (X) is of formula (Xa):
[0949]
[0950] and the compound of formula (XI) is of formula (XIa):
[0951]
[0952] wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' termini, and wherein the RNA duplex is linked to an adjacent phosphate at the 5' terminus of its second strand.
[0953] 43. A method according to clause 41 for preparing a compound according to any one of clauses 5, 7, 9 to 13, 15 to 32, and 34 to 40, wherein:
[0954] The compound of formula (X) is of formula (Xb):
[0955]
[0956] And the compound of formula (XI) is of formula (XIa):
[0957]
[0958]
[0959] Wherein the oligonucleoside comprises an RNA duplex, the RNA duplex comprising a first strand and a second strand, wherein the first strand is at least partially complementary to the RNA sequence of the target gene, and the second strand is at least partially complementary to the first strand, and wherein the first strand and the second strand each have 5' and 3' ends, and wherein the RNA duplex is linked to an adjacent phosphate at the 3' end of its second strand.
[0960] 44. A method according to clause 42 or 43, wherein:
[0961] The compound of (XIa) is of formula (XIb):
[0962]
[0963] 45. A compound of formula (X):
[0964]
[0965] Wherein:
[0966] r is independently an integer selected from 1 to 16; and
[0967] Z is an oligonucleoside moiety.
[0968] 46. A compound of formula (Xa):
[0969]
[0970] 47. A compound of formula (Xb):
[0971]
[0972] 48. A compound of formula (XI):
[0973]
[0974] Wherein:
[0975] s is independently an integer selected from 1 to 16; and
[0976] Z is an oligonucleotide moiety.
[0977] 49. A compound of formula (XIa):
[0978]
[0979] 50. A compound of formula (XIb):
[0980]
[0981] 51. Use of a compound according to any one of clauses 45 and 48 to 50 in the preparation of a compound according to any one of clauses 1 to 40.
[0982] 52. Use of a compound according to clause 46 in the preparation of a compound according to any one of clauses 6, 8 to 14, 16 to 33 and 35 to 40.
[0983] 53. Use of a compound according to clause 47 in the preparation of a compound according to any one of clauses 5, 7, 9 to 13, 15 to 32 and 34 to 40.
[0984] 54. A compound or composition obtainable or obtained by a method according to any one of clauses 41 to 44.
[0985] 55. A pharmaceutical composition comprising a compound according to any one of clauses 1 to 40, and a pharmaceutically acceptable carrier, diluent or excipient.
[0986] 56. Use of a compound according to any one of clauses 1 to 40 for treatment. Examples
[0987] The present application will be more fully understood by reference to the following examples. However, they should not be construed as limiting the scope of the present application. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or changes can be conceived by those skilled in the art, and such modifications or changes should all be included within the spirit and scope of the present application and the scope of the claims.
[0988] Example 1: Synthesis of Tether 1
[0989] General experimental conditions:
[0990] Thin layer chromatography (TLC) was performed on silica gel-coated aluminum plates with a 254 nm fluorescent indicator (from Macherey-Nagel). Compounds were visualized under ultraviolet light (UV) (254 nm) or after spraying with 5% H2SO4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich) and heating. Flash chromatography was performed using a Biotage Isolera One flash chromatograph equipped with a dual-variable UV wavelength detector (200 - 400 nm) using Biotage Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
[0991] All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and the solvents were purchased from Carl Roth GmbH + Co. KG. D-galactosamine pentaacetate was purchased from AK scientific.
[0992] At 60 °C, HPLC / ESI-MS was performed on a Waters Acquity UPLC Protein BEH C4 column( 1.7 μm, 2.1 x 100 mm) on a Dionex UltiMate 3000 RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer. The solvent system consisted of solvent A (H2O containing 0.1% formic acid) and solvent B (acetonitrile (ACN) containing 0.1% formic acid). A gradient of 5 - 100% B was employed over 15 minutes at a flow rate of 0.4 mL / min. Detector and conditions: Corona charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.
[0993] 1H and 1 13C NMR spectra were recorded at room temperature on a Varian spectrometer at 500 MHz( 13 1H NMR) and 125 MHz( 1 13C NMR). Chemical shifts are in ppm, referenced to the solvent residual peaks (CDCl3 – 13 1H NMR: δ at 7.26 ppm and 1 13C NMR δ at 77.2 ppm; DMSO-d6 – 13 1H NMR: δ at 2.50 ppm and 1 13C NMR δ at 39.5 ppm; 1313C NMR δ is 39.5 ppm). Coupling constants are in Hertz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).
[0994] Synthetic route of the conjugate structural unit TriGalNAc tether 1:
[0995]
[0996] Preparation of compound 2: Under argon, D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL), and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 hours. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and concentrated to give the title compound as a yellow oil, which was purified by flash chromatography (gradient elution: 0 - 10% MeOH in DCM, 10 CV). A colorless oil product was obtained (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).
[0997]
[0998] Preparation of compound 4: Under argon, compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) were dissolved in anhydrous DCM (40 mL), and molecular sieves (5 g) were added to the solution. The mixture was stirred at room temperature for 1 hour. Then TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) was added to the mixture and the reaction was stirred overnight. The molecular sieves were filtered off, the filtrate was diluted with DCM (100 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0 - 3% MeOH in DCM, 10 CV) to give the title product as a pale yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11 Calculated value for is 504.21. Found value was 505.4. 11H NMR (500 MHz, CDCl3) δ 6.21 - 6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz, 1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23 - 4.08 (m, 3H), 3.91 - 3.80 (m, 3H), 3.74 - 3.59 (m, 9H), 3.49 - 3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13 13C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).
[0999]
[1000] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL, 1:1 v / v), and palladium / carbon (Pd / C) (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycling (3x) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound as a colorless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). This compound can be used without further purification. MS: C 20 H 34 N2O 11 Calculated value for is 478.2. Measured value is 479.4.
[1001]
[1002] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL 1:1 v / v), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 eq.) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH2Cl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure, and the resulting crude material was purified by flash chromatography (gradient elution: 0 - 10% EtOAc in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated for 639.3. Found 640.9. 1 H NMR (500 MHz, DMSO-d6) δ 7.38 - 7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 13 C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).
[1003]
[1004] Preparation of Compound 8: Under argon, Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH2Cl2 (1 mL), trifluoroacetic acid (TFA, 1 mL) was added, and the reaction was stirred at room temperature for 1 h. The solvent was removed under reduced pressure, and the residue was co-evaporated with toluene (5 mL) three times and dried under high vacuum to give the compound in the form of the TFA salt (0.183 g, 98%). The compound was used without further purification. MS: C 21 H 29 NO 11 Calculated for 471.6. Found 472.4.
[1005]
[1006] Preparation of Compound 9: Dissolve CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 eq.) in N,N-dimethylformamide (DMF) (25 mL). Then add N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) to the solution and stir the reaction for 72 h. Remove the solvent under reduced pressure, dissolve the residue in DCM (100 mL) and wash with saturated aqueous NaHCO3 solution (100 mL). Dry the organic layer over Na2SO4, evaporate the solvent and purify the crude product by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 14 CV). Obtain a pale yellow oily product (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O 41 The calculated value is 1852.9. The measured value is 1854.7. 1 1H NMR (500 MHz, DMSO-d6) δ 7.90 - 7.80 (m, 10H), 7.65 - 7.62 (m, 4H), 7.47 - 7.43 (m, 3H), 7.38 - 7.32 (m, 8H), 5.24 - 5.22 (m, 3H), 5.02 - 4.97 (m, 4H), 4.60 - 4.57 (m, 3H), 4.07 - 3.90 (m 10H), 3.67 - 3.36 (m, 70H), 3.23 - 3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80 - 1.78 (m, 17H). 1313C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).
[1007]
[1008] Preparation of Compound 10: Tribranched GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) was dissolved in MeOH (15 mL), and 3 drops of acetic acid (AcOH) and Pd / C (30 mg) were added. The reaction mixture was degassed by vacuum / argon cycling (3x) and hydrogenated overnight under balloon pressure. After completion of the reaction, mass spectrometry analysis was performed, and the resulting mixture was filtered through a thin layer of diatomaceous earth. The solvent was evaporated and the obtained residue was dried under high vacuum and used for the next step without further purification. A pale yellow oily product (0.24 g, quantitative yield) was obtained. MS: C 73 H 119 N7O 39 Calculated value for is 1718.8. Measured value is 1719.3.
[1009]
[1010] Preparation of Compound 11: Commercially available suberic acid bis(N-hydroxysuccinimide ester) (3.67 g, 9.9 mmol, 1.0 eq.) was dissolved in DMF (5 mL), and triethylamine (1.2 mL) was added. A solution of 3-azido-1-propylamine (1.0 g, 9.9 mmol, 1.0 eq.) in DMF (5 mL) was added dropwise to this solution. The reaction was stirred at room temperature for 3 hours. The reaction mixture was diluted with EtOAc (100 mL) and washed with water (50 mL). The organic layer was separated, dried over Na2SO4 and the solvent was removed under reduced pressure. The crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 16 CV). A white solid product (1.54 g, 43%, rf = 0.71 (5% MeOH in DCM)) was obtained. MS: C 15 H 23The calculated value of N5O5 is 353.4. The measured value is 354.3.
[1011]
[1012] Preparation of TriGalNAc(12): Under argon, the trisaccharide GalNAc compound 10 (0.35 g, 0.24 mmol, 1.0 eq.) and compound 11 (0.11 g, 0.31 mmol, 1.5 eq.) were dissolved in DCM (5 mL), and triethylamine (0.1 mL, 0.61 mmol, 3.0 eq.) was added. The reaction was stirred overnight at room temperature. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was evaporated and the crude product obtained was purified by flash chromatography (elution gradient: 0 - 10% MeOH in DCM, 20 CV) to give the title compound as a white fluffy solid (0.27 g, 67%, rf = 0.5 (10% MeOH in DCM)). MS: C 84 H 137 N 11 O 41 The calculated value is 1957.1. The measured value is 1959.6.
[1013] Conjugation of Linker 1 to the siRNA strand: Monofluoro cyclooctyne (MFCO) is conjugated at the 5'- or 3'-terminus
[1014] 5'-terminal MFCO conjugation
[1015]
[1016] 3'-terminal MFCO conjugation
[1017]
[1018] General conditions for MFCO conjugation: The amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer (pH 9.6) / dimethyl sulfoxide (DMSO) (4:6 (v / v)), and a one molar equivalent of a DMF solution of 35 mM MFCO-C6-NHS ester (Berry & Associates, catalog number LK 4300) was added to this solution. The reaction was carried out at room temperature, and after 1 hour, another one molar equivalent of the MFCO solution was added. The reaction was allowed to proceed for another hour and monitored by LC / MS. At least two molar equivalents excess of the MFCO NHS ester reagent relative to the amino-modified oligonucleotide is required to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered through a 1.2 μm filter from Sartorius, and then Purified on a Pure instrument (GE Healthcare) by reverse phase (RP HPLC).
[1019] Purification was carried out using a Waters XBridge C18 Prep 19x 50mm column. Buffer A was 100 mM TEAAc pH 7, and buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. The UV trace was recorded at 280 nm. A gradient of 0 - 100% B was employed over 60 column volumes.
[1020] The fractions containing the full-length conjugated oligonucleotides were pooled, precipitated in the refrigerator with 3 M NaOAc, pH 5.2 and 85% ethanol, and the collected pellet was dissolved in water. The sample was desalted by size exclusion chromatography and concentrated using a speed-vac concentrator to give the conjugated oligonucleotides with a separation yield of 40 - 80%.
[1021] 5’-GalNAc-T1 conjugate
[1022]
[1023] 3’-GalNAc-T1 conjugate
[1024]
[1025] General procedure for TriGalNAc conjugation: The MFCO-modified single strand was dissolved in water at 2000 OD / mL, and a DMF solution of one equivalent of compound 12 (10 mM) was added to this solution. The reaction was carried out at room temperature, and after 3 hours, a 0.7 molar equivalent solution of compound 12 was added. The reaction was allowed to proceed overnight and was monitored for completion by LCMS. The conjugate was diluted 15-fold in water, filtered through a 1.2 μm filter from Sartorius, and then purified by RP HPLC on a Pure instrument (GE Healthcare).
[1026] RP HPLC purification was carried out using a Waters XBridge C18 Prep 19x 50mm column. Buffer A was 100 mM triethylammonium acetate (pH 7), buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. The UV trace was recorded at 280 nm. A gradient of 0 - 100% B was employed over 60 column volumes.
[1027] The components containing full-length conjugated oligonucleotides were mixed, precipitated in the refrigerator with 3M NaOAc, pH 5.2 and 85% ethanol, and the collected precipitate was dissolved in water to obtain an oligonucleotide solution of approximately 1000 OD / mL. The O-acetate was removed by adding 20% ammonia water. The quantitative removal of these protecting groups was verified by LC-MS.
[1028] Desalting of the conjugate was performed by size exclusion chromatography using Sephadex G25 fine resin (GE Healthcare) on a Pure (GE Healthcare) instrument to obtain a conjugated oligonucleotide with a separation yield of 50 - 70%.
[1029] The following protocol further lists the synthetic route:
[1030] Scheme 1:
[1031]
[1032] Scheme 2:
[1033]
[1034] Scheme 3:
[1035]
[1036] Scheme 4:
[1037]
[1038] Scheme 5:
[1039]
[1040] Example 2: Duplex Annealing
[1041] To generate the desired siRNA duplex, two complementary strands were annealed by mixing equimolar aqueous solutions of the two strands. The mixture was placed in a water bath at 70 °C for 5 minutes and then cooled to ambient temperature over 2 hours. The duplex was lyophilized for 2 days and stored at -20 °C.
[1042] On a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system, on Superdex TMThe duplexes were analyzed by analytical SEC HPLC on a 75 Increase 5 / 150GL column 5 x 153 - 158 mm (Cytiva). The mobile phase consisted of 1x PBS containing 10% acetonitrile. An isocratic gradient was run at a flow rate of 1.5 mL / min for 10 min at room temperature. UV traces were recorded at 260 and 280 nm. Water (LC-MS grade) was purchased from Sigma-Aldrich and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
[1043] Example 3: Synthesis of Tether 2
[1044] General experimental conditions
[1045] Thin-layer chromatography (TLC) was performed on silica-coated aluminum plates with a 254 nm fluorescent indicator (from Macherey-Nagel). Compounds were visualized under UV (254 nm) or after spraying with 5% H2SO4 in methanol (MeOH) or ninhydrin reagent according to Stahl (from Sigma-Aldrich) and heating. Flash chromatography was performed using a Biotage Isolera One flash chromatograph equipped with a bivariate UV wavelength detector (200 - 400 nm) using Biotage Silica 10, 25, 50 or 100 g columns (Uppsala, Sweden).
[1046] All moisture-sensitive reactions were carried out under anhydrous conditions using dry glassware, anhydrous solvents and an argon atmosphere. All commercially available reagents were purchased from Sigma-Aldrich and solvents were purchased from Carl Roth GmbH + Co. KG. D-galactosamine pentaacetate was purchased from AK scientific.
[1047] An Acquity UPLC Protein BEH C4 column from Waters was used (1.7 μm, 2.1 x 100 mm) HPLC / ESI-MS was performed at 60 °C on a Dionex UltiMate 3000 RS UHPLC system and a Thermo Scientific MSQ Plus mass spectrometer. The solvent system consisted of solvent A (H2O containing 0.1% formic acid) and solvent B (acetonitrile (ACN) containing 0.1% formic acid). A gradient of 5 - 100% B was employed over 15 minutes at a flow rate of 0.4 mL / min. Detector and conditions: Corona charged aerosol detection (from esa). Nebulizer temperature: 25 °C. N2 pressure: 35.1 psi. Filter: Corona.
[1048] At room temperature on a Varian spectrometer at 500 MHz ( 1 1H NMR) and 125 MHz ( 13 13C NMR) recordings 1 1H and 13 13C NMR spectra. Chemical shifts are in ppm, referenced to the solvent residual peaks (CDCl3 – 1 1H NMR: δ at 7.26 ppm and 13 13C NMR δ at 77.2 ppm; DMSO-d6 – 1 1H NMR: δ at 2.50 ppm and 13 13C NMR δ at 39.5 ppm). Coupling constants are in Hz. Signal splitting patterns are described as singlet (s), doublet (d), triplet (t), or multiplet (m).
[1049] Synthetic route of the conjugate structural unit TriGalNAc linker 2:
[1050]
[1051] Preparation of compound 2: Under argon, D-galactosamine pentaacetate (3.00 g, 7.71 mmol, 1.0 eq.) was dissolved in anhydrous dichloromethane (DCM) (30 mL), and trimethylsilyl trifluoromethanesulfonate (TMSOTf, 4.28 g, 19.27 mmol, 2.5 eq.) was added. The reaction was stirred at room temperature for 3 hours. The reaction mixture was diluted with DCM (50 mL) and washed with cold saturated aqueous NaHCO3 (100 mL) and water (100 mL). The organic layer was separated, dried over Na2SO4 and concentrated to give the title compound as a yellow oil, which was purified by flash chromatography (gradient elution: 0 - 10% MeOH in DCM, 10 CV). A colorless oil product was obtained (2.5 g, 98%, rf = 0.45 (2% MeOH in DCM)).
[1052]
[1053] Preparation of Compound 4: Under argon, dissolve Compound 2 (2.30 g, 6.98 mmol, 1.0 eq.) and azido-PEG3-OH (1.83 g, 10.5 mmol, 1.5 eq.) in anhydrous DCM (40 mL), and add molecular sieves (5 g) to the solution. Stir the mixture at room temperature for 1 hour. Then add TMSOTf (0.77 g, 3.49 mmol, 0.5 eq.) to the mixture and stir the reaction overnight. Filter the molecular sieves, dilute the filtrate with DCM (100 mL) and wash with cold saturated aqueous NaHCO3 solution (100 mL) and water (100 mL). Separate the organic layer, dry it over Na2SO4 and remove the solvent under reduced pressure. Purify the crude product by flash chromatography (gradient elution: 0 - 3% MeOH in DCM, 10 CV) to obtain the title product as a pale yellow oil (3.10 g, 88%, rf = 0.25 (2% MeOH in DCM)). MS: C 20 H 32 N4O 11 The calculated value for is 504.21. The found value is 505.4. 1 H NMR (500 MHz, CDCl3) δ 6.21 - 6.14 (m, 1H), 5.30 (dd, J = 3.4, 1.1 Hz, 1H), 5.04 (dd, J = 11.2, 3.4 Hz, 1H), 4.76 (d, J = 8.6 Hz, 1H), 4.23 - 4.08 (m, 3H), 3.91 - 3.80 (m, 3H), 3.74 - 3.59 (m, 9H), 3.49 - 3.41 (m, 2H), 2.14 (s, 3H), 2.02 (s, 3H), 1.97 (d, J = 4.2 Hz, 6H). 13 C NMR (125 MHz, CDCl3) δ 170.6 (C), 170.5 (C), 170.4 (C), 170.3 (C), 102.1 (CH), 71.6 (CH), 70.8 (CH), 70.6 (CH), 70.5 (CH), 70.3 (CH2), 69.7 (CH2), 68.5 (CH2), 66.6 (CH2), 61.5 (CH2), 23.1 (CH3), 20.7 (3xCH3).
[1054]
[1055] Preparation of Compound 5: Compound 4 (1.00 g, 1.98 mmol, 1.0 eq.) was dissolved in a mixture of ethyl acetate (EtOAc) and MeOH (30 mL, 1:1 v / v), and Pd / C (100 mg) was added. The reaction mixture was degassed by vacuum / argon cycling (3x) and hydrogenated overnight under balloon pressure. The reaction mixture was filtered through celite and washed with EtOAc (30 mL). The solvent was removed under reduced pressure to give the title compound as a colorless oil (0.95 g, quantitative yield, rf = 0.25 (10% MeOH in DCM)). The compound was used without further purification. MS: C 20 H 34 N2O 11 Calculated value for is 478.2. Measured value is 479.4.
[1056]
[1057] Preparation of Compound 7: Tris{[2-(tert-butoxycarbonyl)ethoxy]methyl}-methylamine 6 (3.37 g, 6.67 mmol, 1.0 eq.) was dissolved in a mixture of DCM / water (40 mL, 1:1 v / v), and Na2CO3 (0.18 g, 1.7 mmol, 0.25 eq.) was added with vigorous stirring. Benzyl chloroformate (2.94 mL, 20.7 mmol, 3.10 eq.) was added dropwise to the previous mixture, and the reaction was stirred at room temperature for 24 h. The reaction mixture was diluted with CH2Cl2 (100 mL) and washed with water (100 mL). The organic layer was separated and dried over Na2SO4. The solvent was removed under reduced pressure, and the resulting crude material was purified by flash chromatography (gradient elution: 0 - 10% EtOAc in cyclohexane, 12 CV) to give the title compound as a pale yellow oil (3.9 g, 91%, rf = 0.56 (10% EtOAc in cyclohexane)). MS: C 33 H 53 NO 11 Calculated value for is 639.3. Measured value is 640.9. 1 1H NMR (500 MHz, DMSO-d6) δ 7.38 - 7.26 (m, 5H), 4.97 (s, 2H), 3.54 (t, 6H), 3.50 (s, 6H), 2.38 (t, 6H), 1.39 (s, 27H). 1313C NMR (125 MHz, DMSO-d6) δ 170.3 (3xC), 154.5 (C), 137.1 (C), 128.2 (2xCH), 127.7 (CH), 127.6 (2xCH), 79.7 (3xC), 68.4 (3xCH2), 66.8 (3xCH2), 64.9 (C), 58.7 (CH2), 35.8 (3xCH2), 27.7 (9xCH3).
[1058]
[1059] Preparation of Compound 8: Under argon, Cbz-NH-tris-Boc-ester 7 (0.20 g, 0.39 mmol, 1.0 eq.) was dissolved in CH2Cl2 (1 mL), trifluoroacetic acid (TFA, 1 mL) was added, and the reaction was stirred at room temperature for 1 hour. The solvent was removed under reduced pressure, and the residue was co-evaporated with toluene (5 mL) three times and dried under high vacuum to obtain the compound in the form of the TFA salt (0.183 g, 98%). The compound can be used without further purification. MS: C 21 H 29 NO 11 Calculated value for is 471.6. Measured value is 472.4.
[1060]
[1061] Preparation of Compound 9: CbzNH-tris-COOH 8 (0.72 g, 1.49 mmol, 1.0 eq.) and GalNAc-PEG3-NH2 5 (3.56 g, 7.44 mmol, 5.0 eq.) were dissolved in N,N-dimethylformamide (DMF) (25 mL). Then N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) (2.78 g, 7.44 mmol, 5.0 eq.), 1-hydroxybenzotriazole hydrate (HOBt) (1.05 g, 7.44 mmol, 5.0 eq.) and N,N-diisopropylethylamine (DIPEA) (2.07 mL, 11.9 mmol, 8.0 eq.) were added to the solution and the reaction was stirred for 72 hours. The solvent was removed under reduced pressure, the residue was dissolved in DCM (100 mL), and washed with saturated aqueous NaHCO3 solution (100 mL). The organic layer was dried over Na2SO4, the solvent was evaporated and the crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 14 CV). A pale yellow oily product was obtained (1.2 g, 43%, rf = 0.20 (5% MeOH in DCM)). MS: C 81 H 125 N7O41 The calculated value is 1852.9. The measured value is 1854.7. 1 H NMR (500 MHz, DMSO-d6) δ 7.90 - 7.80 (m, 10H), 7.65 - 7.62 (m, 4H), 7.47 - 7.43 (m, 3H), 7.38 - 7.32 (m, 8H), 5.24 - 5.22 (m, 3H), 5.02 - 4.97 (m, 4H), 4.60 - 4.57 (m, 3H), 4.07 - 3.90 (m 10H), 3.67 - 3.36 (m, 70H), 3.23 - 3.07 (m, 25H), 2.18 (s, 10H), 2.00 (s, 13H), 1.89 (s, 11H), 1.80 - 1.78 (m, 17H). 13 C NMR (125 MHz, DMSO-d6) δ 170.1 (C), 169.8 (C), 169.7 (C), 169.4 (C), 169.2 (C), 169.1 (C), 142.7 (C), 126.3 (CH), 123.9 (CH), 118.7 (CH), 109.7 (CH), 100.8 (CH), 70.5 (CH), 69.8 (CH), 69.6 (CH), 69.5 (CH), 69.3 (CH2), 69.0 (CH2), 68.2 (CH2), 67.2 (CH2), 66.7 (CH2), 61.4 (CH2), 22.6 (CH2), 22.4 (3xCH3), 20.7 (9xCH3).
[1062]
[1063] Preparation of Compound 10: Dissolve the tris-antennary GalNAc compound 9 (0.27 g, 0.14 mmol, 1.0 eq.) in MeOH (15 mL), add 3 drops of acetic acid (AcOH) and Pd / C (30 mg). Degas the reaction mixture by vacuum / argon cycling (3x) and hydrogenate overnight under balloon pressure. After completion of the reaction, perform mass spectrometry analysis and filter the resulting mixture through a thin layer of diatomaceous earth. Evaporate the solvent and dry the obtained residue under high vacuum and use it for the next step without further purification. Obtain a pale yellow oily product (0.24 g, quantitative yield). MS: C 73 H 119 N7O 39 The calculated value is 1718.8. The measured value is 1719.3.
[1064]
[1065] Preparation of Compound 14: Under argon, tris - antennary GalNAc compound 10 (0.45 g, 0.26 mmol, 1.0 eq.), HBTU (0.19 g, 0.53 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.3 mmol, 5.0 eq.) were dissolved in DCM (10 mL). A solution of compound 13 (0.14 g, 0.53 mmol, 2.0 eq.) in DCM (5 mL) was added dropwise to this mixture. The reaction was stirred overnight at room temperature. The solvent was removed, and the residue was dissolved in EtOAc (50 mL), washed with water (50 mL) and dried over Na2SO4. The solvent was evaporated, and the crude material was purified by flash chromatography (gradient elution: 0 - 5% MeOH in DCM, 20 CV). A white fluffy solid product was obtained (0.25 g, 48%, rf = 0.4 (10% MeOH in DCM)). MS: C 88 H 137 N7O 42 Calculated value for 1965.1. Measured value for 1965.6.
[1066]
[1067] Preparation of TriGalNAc (15): Tris - antennary GalNAc compound 14 (0.31 g, 0.15 mmol, 1.0 eq.) was dissolved in EtOAc (15 mL), and Pd / C (40 mg) was added. The reaction mixture was degassed using a vacuum / argon cycle (3x) and hydrogenated overnight under balloon pressure. Completion of the reaction was monitored by mass spectrometry, and the resulting mixture was filtered through a thin layer of diatomaceous earth. The solvent was removed under reduced pressure, and the resulting residue was dried overnight under high vacuum. The residue was used for conjugation with oligonucleotides without further purification (0.28 g, quantitative yield). MS: C 81 H 131 N7O 42 Calculated value for 1874.9. Measured value for 1875.3.
[1068] Conjugation of Linker 2 with siRNA Strand: TriGalNAc Linker 2 (GalNAc - T2) was conjugated at the 5’ - terminus or 3’ - terminus
[1069] 5’ - GalNAc - T2 conjugate
[1070]
[1071] 3’ - GalNAc - T2 conjugate
[1072]
[1073] Preparation of TriGalNAc linker 2 NHS ester: To a solution of carboxylic acid linker 2 (Compound 15, 227 mg, 121 μmol) in DMF (2.1 mL) was added N-hydroxysuccinimide (NHS) (15.3 mg, 133 μmol) and N,N'-diisopropylcarbodiimide (DIC) (19.7 μL, 127 μmol). The solution was stirred at room temperature for 18 h and used for the subsequent conjugation reaction without purification.
[1074] General procedure for triGalNAc linker 2 conjugation: The amine-modified single strand was dissolved at 700 OD / mL in 50 mM carbonate / bicarbonate buffer (pH 9.6) / DMSO (4:6 (v / v)), and a DMF solution of one molar equivalent of linker 2 NHS ester (57 mM) was added to this solution. The reaction was carried out at room temperature, and after 1 h, another molar equivalent of the NHS ester solution was added. The reaction was allowed to proceed for another hour, and the progress of the reaction was monitored by LCMS. At least two molar equivalents excess of the NHS ester reagent relative to the amino-modified oligonucleoside was required to achieve quantitative consumption of the starting material. The reaction mixture was diluted 15-fold with water, filtered once through a 1.2 μm filter from Sartorius, and then purified by reverse phase (RP HPLC) on a Pure (GE Healthcare) instrument.
[1075] Purification was carried out using a Waters XBridge C18 Prep 19x 50 mm column. Buffer A was 100 mM TEAA pH 7, and buffer B was buffer A containing 95% acetonitrile. The flow rate was 10 mL / min, and the temperature was 60 °C. A UV trace at 280 nm was recorded. A gradient of 0 - 100% B was employed within 60 column volumes.
[1076] The fractions containing the full-length conjugated oligonucleoside were pooled, precipitated in the freezer with 3 M NaOAc, pH 5.2 and 85% ethanol, and then dissolved in water at 1000 OD / mL. O-acetates were removed with 20% aqueous ammonium hydroxide until complete (monitored by LC-MS).
[1077] Desalting of the conjugate was carried out by size exclusion chromatography on a Pure (GE Healthcare) instrument using Sephadex G25 fine resin (GE Healthcare) to give the conjugated oligonucleotide with an isolated yield of 60 - 80%.
[1078] The conjugate was characterized by HPLC-MS analysis on a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system equipped with a Compact ESI-Qq-TOF mass spectrometer (Bruker Daltonics) using a 2.1 x 50 mm XBridge C18 column (Waters). Buffer A was a solution of 16.3 mM triethylamine, 100 mM HFIP in H2O (1% MeOH), and buffer B was buffer A containing 95% MeOH. The flow rate was 250 μL / min and the temperature was 60 °C. UV traces were recorded at 260 and 280 nm. A gradient of 1 - 100% B was employed over 31 minutes.
[1079] The following protocol further outlines the synthetic route:
[1080] Scheme 6:
[1081]
[1082] Scheme 7:
[1083]
[1084] Scheme 8:
[1085]
[1086] Scheme 9:
[1087]
[1088] Example 4: Duplex Annealing
[1089] To generate the desired siRNA duplex, two complementary strands were annealed by mixing equimolar aqueous solutions of the two strands. The mixture was placed in a 70 °C water bath for 5 minutes and then cooled to ambient temperature over 2 hours. The duplex was lyophilized for 2 days and stored at -20 °C.
[1090] On a Dionex Ultimate 3000 (Thermo Fisher Scientific) HPLC system, on a Superdex TMThe duplex was analyzed by analytical SEC HPLC on a 75 Increase 5 / 150GL column 5 x 153 - 158 mm (Cytiva). The mobile phase consisted of 1x PBS containing 10% acetonitrile. An isocratic gradient was run at a flow rate of 1.5 mL / min for 10 min at room temperature. UV traces were recorded at 260 and 280 nm. Water (LC-MS grade) was purchased from Sigma-Aldrich, and phosphate-buffered saline (PBS; 10x, pH 7.4) was purchased from GIBCO (Thermo Fisher Scientific).
[1091] Example 5: Alternative synthetic route for the conjugate structural unit TriGalNAc - linker 2:
[1092]
[1093]
[1094] Conjugation of linker 2 with the siRNA strand: TriGalNAc linker 2 (GalNAc-T2) was conjugated at the 5'-end or 3'-end
[1095] Conjugation conditions
[1096]
[1097] Pre-activation: At 25 °C, TFA-O-PFP (15 μl, 21 eq.) was added to a solution of compound 15 (16 μmol, 4 eq.) in DMF (160 μL), followed by DIPEA (23 μl, 32 eq.). The tube was shaken at 25 °C for 2 h. The reaction was quenched with H2O (10 μL).
[1098] Coupling: The resulting mixture was diluted with DMF (400 μl), and then an oligoamine solution (4.0 μmol in 10x PBS, pH 7.4, 500 μL; final oligoamine (oligo) concentration in the organic and aqueous solutions: 4 μmol / ml = 4 mM) was added. The tube was shaken at 25 °C for 16 h, and the reaction was analyzed by LCMS. The resulting mixture was treated with 28% NH4OH (4.5 ml) and shaken at 25 °C for 2 h. The mixture was analyzed by LCMS, concentrated, and purified by IP-RP HPLC to yield the oligonucleotide conjugated to linker 2 GalNAc.
[1099] 5'-GalNAc-T2 conjugate
[1100]
[1101] 3'-GalNAc-T2 conjugate
[1102]
[1103] Example 6: Solid-phase synthesis method: scale ≤ 1 μmol
[1104] The sense and antisense strands of siRNA were synthesized on a MerMadel 92X synthesizer, which has a commercially available solid support made of controlled pore glass with a universal linker (universal CPG, loading capacity 40 μmol / g; LGC Biosearch or Glen Research).
[1105] RNA phosphoramidites were purchased from ChemGenes or Hongene.
[1106] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
[1107] The 2'-F phosphoramidites used were as follows: 5'-dimethoxytrityl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytrityl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytrityl-deoxythymidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
[1108] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M, except for 2'-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). 0.02 M iodine in acetonitrile / pyridine / H2O (DNAchem) was used as the oxidation reagent. 0.2 M PADS (TCI) in acetonitrile / pyridine 1:1 v / v was used to thiolate the phosphorothioate bond. 0.25 M mM5-ethylthiotetrazole (ETT) in acetonitrile was used as the activator solution.
[1109] Inverted abasic phosphoramidite, 3-O-dimethoxytrityl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).
[1110] In each cycle, DMT was removed by the deblocking solution (3% TCA in DCM (DNAchem)).
[1111] The coupling time was 180 seconds. The oxidizer contact time was set to 80 seconds and the thiolation time was 2 * 100 seconds.
[1112] At the end of the synthesis, the oligonucleotide was cleaved from the solid support using NH4OH:EtOH solution 4:1 (v / v) (TCI) at 45 °C for 20 hours. Then the solid support was filtered off, the filter was thoroughly washed with H2O, and the volume of the mixed solution was reduced by evaporation under reduced pressure.
[1113] An Amicon Ultra-2 centrifugal filtration device was used; the oligonucleotide was treated with PBS buffer (10x, Teknova, pH 7.4, sterile) by ultrafiltration, or by EtOH precipitation with 1 M sodium acetate to form the sodium salt.
[1114] Single-strand identity was evaluated by MS ESI-, then annealed in water to form the final double-stranded siRNA, and duplex purity was evaluated by size exclusion chromatography.
[1115] Example 7: Solid-phase synthesis method: scale ≥ 5 μmol
[1116] The sense and antisense strands of siRNA were synthesized on a MerMade12 synthesizer with a commercially available solid support made of controlled pore glass with a universal linker (universal CPG, loading 40 μmol / g; LGC Biosearch or Glen Research) at a scale of 5 μmol. At 12 μmol on 3'-PT-amino modifier C6 CPG Synthesize the sense strand for 3'-conjugation on a solid support with a loading of 86 μmol / g (LGC).
[1117] RNA phosphoramidites were purchased from ChemGenes or Hongene.
[1118] The 2'-O-methyl phosphoramidites used were as follows: 5'-(4,4'-dimethoxytriphenylmethyl)-N-benzoyl-adenosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytriphenylmethyl)-N-acetyl-cytidine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytriphenylmethyl)-N-isobutyryl-guanosine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytriphenylmethyl)-uridine 2'-O-methyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
[1119] The 2'-F phosphoramidites used were as follows: 5'-dimethoxytriphenylmethyl-N-benzoyl-deoxyadenosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytriphenylmethyl-N-acetyl-deoxycytidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-dimethoxytriphenylmethyl-N-isobutyryl-deoxyguanosine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-dimethoxytriphenylmethyl-deoxythymidine 2'-fluoro-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.
[1120] Inverted abasic phosphoramidite, 3-O-dimethoxytriphenylmethyl-2-deoxyribose-5-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was purchased from Chemgenes (ANP-1422) or Hongene (OP-040).
[1121] All phosphoramidites were dissolved in anhydrous acetonitrile (Honeywell Research Chemicals) at a concentration of 0.05 M, except for 2'-O-methyl-uridine phosphoramidite which was dissolved in DMF / MeCN (1:4, v / v). 0.02 M iodine in acetonitrile / pyridine / H2O (DNAchem) was used as the oxidation reagent. 0.2 M PADS (TCI) in acetonitrile / pyridine 1:1 v / v was used for thiolation of the phosphorothioate bond. 0.25 M mM 5-ethylthiotetrazole (ETT) in acetonitrile was used as the activator solution.
[1122] In each cycle, DMT was removed using the deblocking solution (DCM (DNAchem) with 3% TCA).
[1123] For the strands synthesized on universal CPG, coupling was performed with 8 eq. of amidite for 130 seconds. The oxidation time was 47 seconds and the thiolation time was 210 seconds.
[1124] For the strands synthesized on 3'-PT-amino modifier C6 CPG, coupling was performed with 8 eq. of amidite for 2 * 150 seconds. The oxidation time was 47 seconds and the thiolation time was 250 seconds.
[1125] At the end of synthesis, the oligonucleotide was cleaved from the solid support using an NH4OH:EtOH solution 4:1 (v / v) (TCI) at 45 °C for 20 hours. The solid support was then filtered off, the filter was thoroughly washed with H2O, and the volume of the mixed solution was reduced by evaporation under reduced pressure.
[1126] The oligonucleotide was treated by EtOH precipitation with 1 M sodium acetate to form the sodium salt.
[1127] Single-stranded oligonucleotides were purified by IP-RP HPLC on an Xbridge BEH C18 5 μm, 19 x 150 mm (Waters) column with a gradient increase of B in A. Mobile phase A: aqueous solution of 240 mM HFIP, 7 mM TEA and 5% methanol; Mobile phase B: methanol solution of 240 mM HFIP, 7 mM TEA.
[1128] The single-strand purity and identity were evaluated by UPLC / MS ESI- on an Xbridge BEH C18 2.5 μm, 3 x 50 mm (Waters) column with a gradient increase of B in A. Mobile phase A: aqueous solution of 100 mM HFIP, 5 mM TEA; Mobile phase B: 20% Mobile phase A: 80% acetonitrile (v / v).
[1129] The sense strand was conjugated according to the protocol provided in any one of Examples 1, 3 or 5.
[1130] The sense and antisense strands were then annealed in water to form the final double-stranded siRNA, and the duplex purity was evaluated by size exclusion chromatography.
[1131] Example 8 Nucleic Acid Sequence
[1132] The siRNA oligonucleotides suitable for use according to the present application can target HCII, ZPI, or B4GALT1. The complete DNA sequences of the HCII, ZPI, and B4GALT1 targets are as follows (SEQ ID NO: 1, 2, and 3), respectively:
[1133] SEQ ID NO:1 (HCII)
[1134]
[1135] SEQ ID NO:2 (ZPI)
[1136]
[1137] SEQ ID NO:3 (B4GALT1)
[1138]
[1139] Table 1 below provides the oligonucleotide mRNA target sequences for HCII, ZPI, and B4GALT1, and the corresponding positions in the transcripts NM_000185.4 (HCII), NM_016186.3 (ZPI), and NM_001497.4 (B4GALT1).
[1140] Table 1
[1141] SEQ ID NO Oligonucleotide mRNA target sequence 5’→3’ Starting position on the reference sequence Reference sequence ID SEQ ID NO:4 CACAACCACAACUUCCGGCUGAA 974 NM_000185.4 SEQ ID NO:5 CAAAAAAGCAUGACAAACAGAAC 1193 NM_000185.4 SEQ ID NO:6 CUCUUCAGGAGGAAUUUUGGGUA 674 NM_000185.4 SEQ ID NO:7 AAAAGCAUGACAAACAGAACUCG 1196 NM_000185.4 SEQ ID NO:8 UUCUCAACUGCAUCUACUUCAAA 915 NM_000185.4 SEQ ID NO:9 UUGCCUUCAUCCACAAGGAUUUU 992 NM_016186.3 SEQ ID NO:10 CCUACCAAGGAAAUGCCACCAUG 1370 NM_016186.3 SEQ ID NO:11 CGAAAGAUCUCCAUGAGGCACGA 760 NM_016186.3 SEQ ID NO:12 GCCUCCACCUUUGACAAGAAUUU 1324 NM_016186.3 SEQ ID NO:13 GGGGAGUUUUGCCUUCAUCCACA 984 NM_016186.3 SEQ ID NO:14 GUAAACUUGAAUUUCCUAUGUAU 2209 NM_001497.4 SEQ ID NO:15 AACUUGAAUUUCCUAUGUAUUUU 2212 NM_001497.4 SEQ ID NO:16 GACUUUUCCAAAGUGCCUUAAAA 3445 NM_001497.4 SEQ ID NO:17 UUCAGUAUUUUGGAGGUGUCUCU 1019 NM_001497.4
[1142] Table 2 provides the unmodified first (antisense) and corresponding unmodified second (sense) strand sequences of the siRNA oligonucleotides (targeting HCII, ZPI, and B4GALT1) according to the present application, and the corresponding positions in the entire gene sequences of SEQ ID NO:1, 2, or 3, as shown below.
[1143] Table 2
[1144]
[1145]
[1146] Table 3 provides the modified first (antisense) sequences of the siRNA oligonucleotides (targeting HCII, ZPI, and B4GALT1) according to the present application, and the corresponding unmodified first (antisense) sequences, as shown below.
[1147] Table 3
[1148]
[1149]
[1150] Table 4 provides the modified second (sense) sequences of the siRNA oligonucleotides (targeting HCII, ZPI, and B4GALT1) according to the present application, and the corresponding unmodified second (sense) sequences, as shown below.
[1151] Table 4
[1152]
[1153]
[1154] As shown in Table 4 above, some of the modified second strand sequences include the preferred 5’iaia motif. However, it should also be understood that the scope of these modified second strand sequences also includes Me / F modified second strands that do not have the 5’iaia motif.
[1155] Table 5 lists the duplexes, and the duplex IDs refer to the modified antisense and sense IDs in Tables 3 and 4 above.
[1156] Table 5
[1157]
[1158]
[1159] Definitions provided in the table above:
[1160] A - Adenosine
[1161] C - Cytidine
[1162] G - Guanosine
[1163] T - Thymine
[1164] m - 2’ - O - methyl
[1165] f - 2’ fluoro
[1166] s - phosphorothioate bond
[1167] ia - inverted abasic nucleoside
[1168] o - heat - destabilizing modification
[1169] Example 9: Inhibitory Screening of Target Gene Expression in Human Huh7 Cells
[1170] Huh7 cells (a human hepatocyte - derived cell line obtained from the JCRB cell bank) were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS in an atmosphere of 37 °C and 5% CO2. Cells were transfected with siRNA duplexes targeting mRNA or a negative - control siRNA (siRNA - control; sense strand 5’ - UUCUCCGAACGUGUCACGUTT - 3’ (SEQ ID NO:85), antisense strand 5’ - ACGUGACACGUUCGGAGAATT - 3’ (SEQ ID NO:84)), with a final duplex concentration of 5 nM and 0.1 nM. For transfection, 9.7 μL of Opti - MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) were added to 10 μL of each siRNA duplex. The mixture was incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells were incubated at 37 °C / 5% CO2 for 24 hours, and then total RNA was purified using the RNeasy 96 kit (Qiagen). Each duplex was tested by transfection in duplicate wells in two independent experiments.
[1171] cDNA synthesis was performed using the FastQuant RT (with gDNA enzyme) kit (Tiangen). Real-time fluorescence quantitative PCR (qPCR) was performed on an ABIPrism 7900HT or ABI QuantStudio 7 using specific primers for the target gene and human GAPDH (Hs02786624_g1), and the FastStart Universal Probe Master kit (Roche).
[1172] qPCR was repeated for the cDNA from each well, and the average Ct was calculated. Relative HCII expression was calculated using the comparative Ct (ΔΔCt) method based on the average Ct values, normalized to GAPDH and relative to untreated cells. Based on the results of the preliminary screening, siRNA duplexes showing good activity were selected for dose-response tracking.
[1173] Example 10: Dose-response of target gene expression in human Huh7 cells
[1174] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS under an atmosphere of 37 °C and 5% CO2. Cells were transfected with siRNA duplexes targeting the mRNA or negative control siRNA (siRNA-control; sense strand 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO:85), antisense strand 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO:84)) using 10x3-fold serial dilutions, with the final duplex concentration ranging from 20 nM to 1 pM. For transfection, 9.7 μL of Opti-MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) were added to 10 μL of each siRNA duplex. The mixture was incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells were incubated at 37 °C / 5% CO2 for 24 hours, and then total RNA was purified using the RNeasy 96 kit (Qiagen). Each duplex was tested by transfection in duplicate wells in a single experiment.
[1175] cDNA synthesis was performed using the FastQuant RT (with gDNA enzyme) kit (Tiangen). Real-time fluorescence quantitative PCR (qPCR) was performed on an ABIPrism 7900HT or ABIQuantStudio 7 using specific primers for the target gene and human GAPDH (Hs02786624_g1), and the FastStart Universal Probe Master kit (Roche).
[1176] qPCR was repeated for cDNA from each well, and the average Ct was calculated. Relative HCII expression was calculated using the comparative Ct (ΔΔCt) method based on the average Ct value, normalized to GAPDH and relative to untreated cells. The maximum percentage inhibition of HCII expression and the IC50 value were calculated using GraphPad Prism 9 with a four-parameter (variable slope) model.
[1177] Example 11: Dose-response of ZPI and B4GALT1 inhibition in human Huh7 cells
[1178] Huh7 cells (a human hepatocyte-derived cell line obtained from the JCRB cell bank) were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS under an atmosphere of 37 °C and 5% CO2. Cells were transfected with siRNA duplexes designed against the target or negative control siRNA at concentrations of 0.1 nM and 1 nM. For transfection, 9.7 μL of Opti-MEM (ThermoFisher) and 0.3 μL of Lipofectamine RNAiMAX (ThermoFisher) were added to 10 μL of each siRNA duplex. The mixture was incubated at room temperature for 15 minutes and then added to 100 μL of complete growth medium containing 20,000 Huh7 cells. Cells were incubated at 37 °C / 5% CO2 for 24 hours, and then total RNA was purified using the RNeasy 96 kit (Qiagen). Each duplex was tested by transfection in duplicate wells, and the experiment was repeated three times.
[1179] cDNA synthesis was performed using the FastQuant RT (with gDNA enzyme) kit (Tiangen). Real-time fluorescence quantitative PCR (qPCR) was performed on an ABIPrism 7900HT or ABIQuantStudio 7 using specific primers for human B4GALT1 (Hs00155245_m1), human ZPI (Hs01547819_m1), and human GAPDH (Hs02786624_g1), and the TaqMan Gene Expression Assay kit (ThermoFisher Scientific).
[1180] qPCR was repeated for cDNA from each well, and the average Ct was calculated. Relative target expression was calculated using the comparative Ct (ΔΔCt) method based on the average Ct value, normalized to GAPDH and relative to untreated cells.
[1181] To inhibit ZPI, siRNA duplexes ETXM1201 and ETXM1227 ( Figure 8 ) were tested. To inhibit B4GALT1, siRNA duplexes ETXM1764 and ETXM1231 ( Figure 9 ) and ETXM1772 and ETXM1232 ( Figure 10 ) were tested.
[1182] This application is not limited to the scope of the specifically disclosed embodiments, and these embodiments are provided, for example, to illustrate various aspects of the application. Various modifications to the compositions and methods will become apparent in light of the description and teachings herein. Such changes can be made without departing from the true scope and spirit of the disclosure, and such changes are intended to fall within the scope of the disclosure.
[1183] If there is any ambiguity between the sequences in this specification and the sequences in the attached sequence listing, the sequences provided herein are considered to be the correct sequences.
Claims
1. A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleotides; wherein the second strand comprises 2 consecutive abasic nucleosides in the 5'-terminal region of the second strand, one of the abasic nucleosides comprised is the terminal nucleoside of the 5'-terminal region of the second strand, and the other abasic nucleoside is the penultimate nucleoside of the 5'-terminal region of the second strand, wherein: (a) the penultimate abasic nucleoside is linked to the adjacent first base nucleoside of the adjacent 5'-proximal region by a reverse internucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read towards the end comprising the end and the penultimate abasic nucleoside, the bond between the end and the penultimate abasic nucleoside is 3'-5', and wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleoside positions of its 5'-region.
2. A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of the RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleotides, and wherein the nucleosides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'): ia-ia-(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and wherein the first strand comprises at least one heat-destabilizing modification of the duplex within the first 9 nucleoside positions of its 5'-region.
3. The nucleic acid according to claim 1 or 2, wherein the destabilizing modification is selected from unlocked nucleic acid (UNA) and glycol nucleic acid (GNA).
4. The nucleic acid according to claim 3, wherein the destabilizing modification comprises at least one unlocked nucleic acid (UNA).
5. The nucleic acid according to claim 3, wherein the destabilizing modification comprises at least one glycol nucleic acid (GNA), specifically at least one (S)-glycol nucleic acid.
6. The nucleic acid according to any one of the preceding claims, wherein at least one heat-destabilizing modification of the duplex is located within nucleoside positions 2 to 9, preferably nucleoside positions 2 to 8, more preferably nucleoside positions 3 to 8, more preferably nucleoside positions 4 to 8, and most preferably at nucleoside position 6 or 7 in the 5'-region of the first strand.
7. The nucleic acid according to any one of claims 1 to 6, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, provided that the total number of 2'-F sugar modifications in the first strand does not consist of four or six 2'-F modifications.
8. The nucleic acid according to claim 7, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three, five or seven 2'-F modifications.
9. The nucleic acid according to claim 8, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is selected from at least 2'-Me and 2'-F sugar modifications, wherein the total number of 2'-F sugar modifications in the first strand consists of three 2'-F modifications.
10. The nucleic acid according to claim 8, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of five 2'-F modifications.
11. The nucleic acid according to claim 8, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern, wherein the modification is at least selected from 2'-Me and 2'-F sugar modifications, and wherein the total number of 2'-F sugar modifications in the first strand consists of seven 2'-F modifications.
12. The nucleic acid according to claim 9, wherein the nucleosides of the first strand comprise the following 2'-sugar modification pattern (5'-3'): Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification.
13. The nucleic acid according to claim 10, wherein the nucleosides of the first strand comprise the following 2'-sugar modification pattern (5'-3'): Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification.
14. The nucleic acid according to any one of the preceding claims, wherein two phosphorothioate internucleoside bonds are respectively present between three consecutive positions in the 5'-proximal end region of the second strand, and wherein when read from the 5'-end, the first phosphorothioate internucleoside bond is present between the first base nucleoside and the adjacent second base nucleoside in the 5'-proximal end region of the second strand, and the second phosphorothioate internucleoside bond is present between the second base nucleoside and the adjacent third base nucleoside in the 5'-proximal end region of the second strand.
15. The nucleic acid according to any one of the preceding claims, wherein two phosphorothioate internucleoside bonds are respectively present between three consecutive positions in the 5'- and 3'-terminal regions of the first strand, whereby the terminal nucleosides respectively located in the 5'- and 3'-terminal regions of the first strand are linked to their respective 5'- and 3'-adjacent penultimate nucleosides by phosphorothioate internucleoside bonds, and each 5'- and 3'-penultimate nucleoside is linked to its respective 5'- and 3'-adjacent antepenultimate nucleoside by a phosphorothioate internucleoside bond.
16. A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a duplex region having a length of at least 17 nucleosides, and wherein the nucleosides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'): ia-ia-(Me)8–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and and wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern (5'-3') selected from one of the following: Me–F–(Me)3–X1–(Me)7–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification; Me–F–(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)7, wherein X1 is a thermally destabilizing modification.
17. A nucleic acid for inhibiting the expression of a target gene, comprising a first strand that is at least partially complementary to a portion of an RNA transcribed from the target gene, and a second strand that is at least partially complementary to the first strand, wherein the first strand and the second strand form a double-stranded region having a length of at least 17 nucleosides, and wherein the nucleosides of the second strand comprise the following 2'-sugar and abasic modification pattern (5'-3'): ia-ia-Me(s)Me(s)(Me)6–(F)3–(Me) 10 , wherein ia represents an inverted abasic nucleoside, and (s) represents a phosphorothioate bond, wherein the nucleosides of the first strand comprise a 2'-sugar modification pattern (5'-3') selected from one of the following: Me(s)F(s)(Me)3–X1–(Me)7–F–Me–F–(Me)5(s)Me(s)Me, wherein X1 is a heat-destabilizing modification; Me(s)F(s)(Me)3–X1–Me–(F)2–(Me)4–F–Me–F–(Me)5(s)Me(s)Me, wherein X1 is a heat-destabilizing modification.
18. The nucleic acid according to any one of claims 2 to 17, wherein two consecutive abasic nucleosides in the 5'-terminal region of the second strand, one of the abasic nucleosides being the terminal nucleoside of the 5'-terminal region of the second strand and the other abasic nucleoside being the penultimate nucleoside of the 5'-terminal region of the second strand, wherein: (a) The penultimate abasic nucleoside is linked to an adjacent first-base nucleoside in the adjacent 5'-proximal region by a reverse internucleoside bond; (b) the reverse bond is a 5-5' reverse bond; and (c) when read towards the end containing the terminal and penultimate abasic nucleosides, the bond between the terminal and the penultimate abasic nucleoside is 3'-5'.
19. The nucleic acid according to any one of the preceding claims, wherein the second strand of the nucleic acid is directly or indirectly conjugated to one or more ligand moieties in the 3'-terminal region of the second strand.
20. The nucleic acid according to claim 19, wherein the ligand moiety comprises: one or more N-acetylgalactosamine (GalNAc) ligands, and / or one or more derivatives of N-acetylgalactosamine (GalNAc) ligands, and / or one or more N-acetylgalactosamine (GalNAc) ligands and / or their derivatives, which are conjugated to the nucleic acid through a linker.
21. The nucleic acid according to claim 20, having the structure: wherein: R1 is independently selected from the group consisting of hydrogen, methyl, and ethyl each time it appears; R2 is selected from the group consisting of: hydrogen, hydroxy, -OC 1-3 alkyl, -C(=O)OC 1-3 alkyl, halogen and nitro; X1 and X2 are independently selected from the group consisting of methylene, oxygen, and sulfur each time they appear; m is an integer from 1 to 6; n is an integer from 1 to 10; q, r, s, t, v are independently integers from 0 to 4, provided that: (i) q and r cannot both be 0 at the same time; and (ii) s, t, and v cannot all be 0 at the same time; Z is an oligonucleoside.
22. The nucleic acid according to claim 20, having the structure: wherein: r and s are independently integers selected from 1 to 16; and Z is an oligonucleoside.
23. The nucleic acid according to any one of the preceding claims, wherein the nucleic acid is an siRNA oligonucleoside.
24. A pharmaceutical composition comprising the nucleic acid according to any one of the preceding claims, and a pharmaceutically acceptable excipient or carrier.
25. Use of the nucleic acid or pharmaceutical composition according to any one of the preceding claims for treatment.
26. Use of a nucleic acid or pharmaceutical composition according to any one of the preceding claims for preventing or treating a disease associated with a hemostatic disorder, such as a disease associated with a hemostatic disorder, for example, hemophilia.
27. Use of a nucleic acid or pharmaceutical composition according to any one of the preceding claims for preventing or treating diabetes.
28. Use of a nucleic acid or pharmaceutical composition according to any one of the preceding claims for preventing or treating cardiovascular diseases.
Citation Information
Patent Citations
Sirnas with vinylphosphonate at the 5' end of the antisense strand
EP3775207A1