Method for cultivating and producing silkworm larvae by using 5-year-old silkworm larvae as culture medium

Abstract

The invention discloses a method for cultivating and producing white muscardine silkworms by using 5-year-old silkworm larvae as a culture medium. The method specifically comprises the following steps: (1) quality improvement and optimization of a mother strain of beauveria bassiana; (2) carrying out stress stimulation culture on the beauveria bassiana solid-liquid mixed leavening agent; (3) carrying out inoculation treatment on a culture medium of 5-year-old silkworm larvae; and (4) white muscardine silkworm spawn running management. According to the method, the silkworm larvae of 5 years old are used as the culture medium to breed and produce the silkworm larva, a new way for preparing the medicinal silkworm larva is provided, and the silkworm larvae of 5 years old can be utilized and converted into the silkworm larva to accumulate nutrition and bioactive components to the greatest extent; the method is not limited by weak infection lethal ability of the beauveria bassiana strain and strong resistance of the hybridized combined silkworm variety, the beauveria bassiana with high bioactive component attribute and the large hybridized combined silkworm variety with rich nutrition and mass can be fully compatible, the quality of the silkworm larva medicinal material is ensured, meanwhile, the yield is remarkably improved, and the method is stable, efficient and wide in development prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and more specifically to a method for cultivating and producing Beauveria bassiana using the fifth-instar silkworm larvae as a culture medium. Background Art

[0002] The traditional Chinese medicinal material Beauveria bassiana is the whole worm of the larvae of the silkworm moth infected with Beauveria bassiana. It was first recorded in "Shennong's Herbal Classic" in the Qin and Han dynasties, stating that it tastes salty and is produced in marshy areas. "It is mainly used for infants' epilepsy and crying at night, expelling three kinds of parasites, removing black spots, making people have a good complexion, and treating male genital ulcers." "The Supplementary Records of Famous Physicians" in the same period listed it as a medium-grade medicinal material, with a pungent taste, being mild and non-toxic. It is mainly used for women's metrorrhagia, red and white leucorrhea, postpartum pain, and removing scars from various sores. It is produced in Yingchuan. It should be collected in April and not allowed to get wet, as wet ones are poisonous and cannot be used. Also, when powdered and applied to carbuncles, the roots will come out by themselves, with extremely good effects. In "Treatise on Medicinal Properties" in the Tang Dynasty, it was said that its nature is slightly warm, "with a small toxicity, treating lockjaw and inducing sweating. It is mainly used for women's metrorrhagia and continuous uterine bleeding. When combined with white fish in clothes and falcon excrement white in equal parts, it can treat sores and remove scars." "Chinese Pharmacopoeia" records that Beauveria bassiana has the effects of calming endogenous wind and stopping convulsions, expelling wind and relieving pain, resolving phlegm and dissipating nodules, and is mainly used for endogenous wind combined with phlegm, epilepsy and convulsions, acute infantile convulsions, tetanus, stroke with deviation of the mouth and eyes, wind-heat headache, red eyes and sore throat, rubella and itching, mumps and parotid swelling. Modern pharmacological research has confirmed that Beauveria bassiana has various pharmacological effects such as hypoglycemic, hypolipidemic, anti-cancer, anti-convulsive, anticoagulant, antibacterial, sedative, hypnotic, and whitening, thus making it play an important role in clinical treatment. With the in-depth research on the pharmacological components and functions of Beauveria bassiana and the continuous development of related new products, the application of Beauveria bassiana in the fields of medicine and food will be more and more extensive, and the production and processing of Beauveria bassiana have broad market prospects.

[0003] Currently, the production process of Beauveria bassiana is to spray a suspension of Beauveria bassiana spores on the body surface of the fifth-instar silkworms. After becoming pathogenic and rigidified, the fungus grows from the inside out to produce conidia, and the finished product is harvested after drying. However, due to the differences in the active ingredients and the infectivity of conidia among Beauveria bassiana strains, as well as the differences in the resistance and individual nutrition among silkworms, in actual production, there are often situations such as poor stability of silkworm disease after inoculation, long disease period, many hollow and thin Beauveria bassiana finished products, and low content of active ingredients, resulting in unstable quality, low yield, high cost, and many difficulties and high difficulty in industrial production. Thus, it can be seen that the existing methods for preparing Beauveria bassiana have obvious deficiencies and defects, and urgent improvement is needed.

[0004] Therefore, how to combine Beauveria bassiana varieties with high active ingredient content with high-quality and high-resistant individual silkworm varieties to ensure high-quality and high-yield production of Beauveria bassiana is an urgent problem for those skilled in the art to solve. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a method for cultivating and producing Beauveria bassiana using the 5th instar silkworm larvae as a culture medium to solve the deficiencies in the prior art.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A method for cultivating and producing Beauveria bassiana using the 5th instar silkworm larvae as a culture medium specifically includes the following steps:

[0008] (1) Quality improvement and optimization of the Beauveria bassiana stock culture

[0009] Inoculate the activated Beauveria bassiana slant stock culture into the empty space at the left end of the medium for quality improvement and optimization of the Beauveria bassiana stock culture for cultivation and quality improvement and optimization, and select the strain with fast growth rate, thick and vigorous growth, and neat edges at the right end of the medium for quality improvement and optimization of the Beauveria bassiana stock culture for standby;

[0010] (2) Stress stimulation culture of the Beauveria bassiana solid-liquid mixed fermentation agent

[0011] Under sterile conditions, inoculate the Beauveria bassiana strain on the right end of the medium for quality improvement and optimization of the Beauveria bassiana stock culture into the medium of the Beauveria bassiana solid-liquid mixed fermentation agent, and culture it statically in the dark environment, then ferment and culture it under magnetic stirring, and then shake the Beauveria bassiana solid-liquid mixed fermentation agent evenly and sub-pack it into the sterilized culture bottles, and continue to culture it statically. When a layer of mycelial skin forms on the surface of the Beauveria bassiana solid-liquid mixed fermentation agent, it is for standby;

[0012] (3) Inoculation treatment of the 5th instar silkworm larva culture medium

[0013] After selecting the 5th instar silkworm larvae to fast and defecate, sub-pack them into the culture bottles filled with distilled water to fully absorb water and sterilize, and then after removing the liquid in the culture bottles in the sterile operation table, introduce the same volume of sterilized Beauveria bassiana solid-liquid mixed fermentation agent medium to fully soak, and then place each silkworm larva into the culture bottle of the above Beauveria bassiana solid-liquid mixed fermentation agent with mycelial skin;

[0014] (4) Mycelium management of Beauveria bassiana

[0015] Transfer the culture bottles to the sterile mycelium room and continue to culture them in the dark. When the mycelium on the surface of the silkworm body is completely grown and the conidia cover the whole silkworm body, continue to culture until the end of the mycelium stage, collect the semi-finished product of Beauveria bassiana, and dry it in the sun to obtain the finished product of Beauveria bassiana.

[0016] Further, in the above step (1), the preparation method of the optimized medium for Beauveria bassiana mother culture is as follows: Place the culture dish obliquely, pour the optimized left - end medium for Beauveria bassiana mother culture into the culture dish. Under sterile conditions, use a sterile scalpel to remove the optimized left - end medium for Beauveria bassiana mother culture at the bottom that exceeds half of the diameter of the semi - circle. Raise and place the blank end of the culture dish obliquely, pour the optimized right - end medium for Beauveria bassiana mother culture into the blank end of the culture dish, so that the optimized medium for Beauveria bassiana mother culture covers a part of the optimized left - end medium for Beauveria bassiana mother culture at the joint, and let it solidify to obtain the optimized medium for Beauveria bassiana mother culture. Use a sterile punch to make a hole at the center position of the left end for inoculation.

[0017] Furthermore, every 1 L of the above - mentioned optimized left - end medium for Beauveria bassiana mother culture includes: 15 - 18 g of glucose, 2 - 3 g of peptone, 3 - 5 g of ultrafine fermented whole silkworm powder, 1.0 - 1.2 g of magnesium sulfate, 1.5 - 1.8 g of potassium dihydrogen phosphate, 2.0 - 3.0 g of MRS broth, 25 - 30 mL of soy sauce, 18 g of agar, and add water to 1000 mL.

[0018] Furthermore, the above - mentioned ultrafine fermented whole silkworm powder is prepared by taking whole silkworm powder, pig blood clot, and water - soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating Lactobacillus, Candida albicans, and Bacillus subtilis with a live bacteria number ratio of 2:1:2 at a total inoculation amount of 5%. Adjust the material humidity to 50%, culture at 30 - 34 °C for 60 h, and then dry at 100 °C and super - finely pulverize.

[0019] Furthermore, every 1 L of the above - mentioned optimized right - end medium for Beauveria bassiana mother culture includes: 15 - 18 g of glucose, 2 - 3 g of peptone, 1.0 - 1.2 g of magnesium sulfate, 1.5 - 1.8 g of potassium dihydrogen phosphate, 2.0 - 3.0 g of MRS broth, 25 - 30 mL of soy sauce, 1.5 - 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL.

[0020] Further, in the above step (1), the temperature for culture optimization is 26 °C, and the time is 7 - 10 d.

[0021] Further, in the above steps (2) and (3), every 1 L of the Beauveria bassiana solid - liquid mixed fermentation agent medium includes: 15 - 18 g of glucose, 5 - 6 g of water - soluble soybean cake powder, 3 - 5 g of ultrafine fermented silkworm pupa powder, 1.0 - 1.3 g of magnesium sulfate, 1.2 - 1.5 g of potassium dihydrogen phosphate, 2.5 - 3.0 mL of plant active surfactant, 25 - 30 mL of soy sauce, and add water to 1000 mL.

[0022] Furthermore, the above-mentioned ultramicro-fermented silkworm pupa powder is prepared by taking silkworm pupa powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate and 0.03% potassium dihydrogen phosphate to supplement nutrient components, and inoculating Lactobacillus, Candida albicans and Bacillus subtilis with a viable bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material-to-water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, and drying and ultramicro-pulverizing at 100 °C.

[0023] Further, in the above step (2), the temperature for static culture is 24-26 °C, the time is 6 h; the rotation speed of magnetic stirring is 620 rpm; the time for fermentation culture is 9-11 d; the height of the Beauveria bassiana solid-liquid mixed fermentation agent in the culture flask is 1.0-1.5 cm.

[0024] Further, in the above step (3), the silkworm larvae are at the 5th instar for 6-8 days; the time for fasting and defecation is 6 h; the time for sufficient water absorption is 2-3 h; the sterilization temperature is 210 °C, and the time is 120 min; the time for sufficient soaking is 20-30 min.

[0025] Further, in the above step (4), the temperature for dark culture is 24-26 °C, and the humidity is 85-90%; when the surface of the silkworm body is completely covered with bacteria and the conidia grow all over the silkworm body, continue to culture for 8-10 days to end the mycelium growth stage, and collect the semi-finished product of white muscardine silkworm.

[0026] As can be seen from the above technical solutions, compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] 1. The present invention uses Beauveria bassiana to erode silkworm larvae from the outside to the inside to cultivate and produce white muscardine silkworm, which is significantly different from the traditional method of Beauveria bassiana killing silkworm larvae and then growing white mycelia from the inside to the outside to produce conidia to form white muscardine silkworm. At the same time, the present invention can make full use of the silkworm body resources in the best inflation and development stage of silkworms, significantly avoiding the phenomena of multiple inoculations caused by the long killing time of Beauveria bassiana and the death of silkworms due to untimely killing and stiffening and spinning cocoons.

[0028] 2. On the basis of physically killing and destroying the defense ability of silkworm larvae and preserving all their nutritional components and bioactive substances, the present invention improves the infection and utilization ability of Beauveria bassiana solid-liquid mixed fermentation agent with high active ingredient content, enables the perfect combination of Beauveria bassiana variety with high active ingredient content and individual of high-resistant and high-quality silkworm variety to produce high-quality and high-yield medicinal Bombyx batryticatus, and the content of its medicinal components is significantly better than the requirements of the Pharmacopoeia of the People's Republic of China. The silkworm larvae defecate fully before inoculation, and are not fed after inoculation. There is no need to spray antibiotic agents to inhibit bacterial infection. There is no residual feces and drug residues in the Bombyx batryticatus, completely blocking the infection and residue pathways of toxic substances such as Aspergillus flavus, thus ensuring the medicinal safety of Bombyx batryticatus. The key screening indexes of Beauveria bassiana in the present invention are the content of high active ingredients and the utilization and conversion efficiency, and the pathogenicity and rigidification rate of its conidia are not required to be high. The operation difficulty of the cultivation method is significantly reduced, the process is clear, suitable for large-scale promotion, greatly improving the economic and social benefits.

[0029] 3. The present invention uses the 5th instar silkworm larvae as the culture medium to cultivate and produce Bombyx batryticatus, providing a new way to prepare medicinal Bombyx batryticatus, which can maximize the utilization and conversion of the 5th instar silkworm larvae to accumulate nutrients and bioactive components for Bombyx batryticatus, and is not restricted by the dual limitations of the weak infection and lethal ability of Beauveria bassiana strains and the strong resistance of hybrid combination silkworm varieties. It can fully compatible the Beauveria bassiana with high bioactive component attributes and the hybrid combination silkworm variety with rich nutrition and large quality, ensuring the quality of Bombyx batryticatus medicinal materials while significantly increasing the yield, stable and efficient, with broad development prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the colony morphology diagram of Beauveria bassiana strain in Example 2;

[0031] Figure 2 It is the mycelium growth diagram of liquid strain of Beauveria bassiana in Example 2;

[0032] Figure 3 It is the diagram of the formation of mycelial skin after the end of liquid fermentation of Beauveria bassiana in Example 2;

[0033] Figure 4 It is the diagram of the silkworm infected by Beauveria bassiana and growing conidia in Example 2. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0035] Example 1

[0036] Isolation, Screening and Identification of Beauveria bassiana

[0037] Fresh Beauveria bassiana-infected silkworm samples were collected from sericulturists in different regions of Hunan. On a sterile workbench, the surfaces of the above fresh Beauveria bassiana-infected silkworm samples were disinfected with 75% ethanol for 30 s, burned in the flame of an alcohol lamp for 3 s, and then rinsed 3 times with sterile water. The Beauveria bassiana-infected silkworm samples were soaked in a sterilized solid-liquid mixed fermentation agent medium for Beauveria bassiana for 5 min, and then suspended in a narrow-mouth conical flask containing 150 mL of the sterilized solid-liquid mixed fermentation agent medium for Beauveria bassiana and left hanging in the air. They were cultured at a constant temperature and humidity in the dark. When a certain amount of Beauveria bassiana conidia appeared on the surface of the solid-liquid mixed fermentation agent medium for Beauveria bassiana, fermentation culture was carried out at 620 rpm with magnetic stirring at a temperature of 26-28 °C for 8-10 d. Samples with a large amount of mycelium, a high content of active ingredients in the mycelium, and a large yield of conidia were selected, and an appropriate amount of mycelium was inoculated into the left-middle hole of the optimized mother culture of Beauveria bassiana. The culture was continued in the dark environment. Further, a single Beauveria bassiana colony was picked from the right-end medium of the optimized mother culture of Beauveria bassiana for further purification culture. The operation was repeated many times. After subculture screening and purification culture on the optimized mother culture medium of Beauveria bassiana, a pure strain with a fast growth rate and strong conidia-producing ability was obtained at the right end for standby. Further comprehensive identification data analysis, including the morphological characteristics of the isolated and cultured mycelium, microscopic features, and ITS sequence homology comparison results showing the highest homology with the ITS sequence of Beauveria bassiana, confirmed that this strain belongs to Beauveria bassiana and was named CKS-611.

[0038] The ITS sequence of Beauveria bassiana CKS-611 is as follows:

[0039] AAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAA。

[0040] When isolating and screening Beauveria bassiana, first, using the large mycelium yield, high content of active ingredients in mycelium, and large conidia yield as indicators, the target strain suitable for the fermentation culture of the solid-liquid mixed fermentation agent of Beauveria bassiana was quickly and accurately screened. Then, through the transfer of the solid-liquid mixed fermentation agent of Beauveria bassiana to the mother strain of Beauveria bassiana, the culture medium was optimized for quality improvement to quickly obtain a stable purified target strain for standby.

[0041] Among them, the preparation method of the culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana is as follows: place the culture dish obliquely, pour the left-end culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana into the culture dish, under sterile conditions, use a sterile scalpel to remove the left-end culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana whose bottom layer exceeds the semi-circle diameter, raise and place the blank end of the culture dish obliquely, pour the right-end culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana into the blank end of the culture dish, so that the right-end culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana covers a part of the left-end culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana at the joint, and let it solidify to obtain the culture medium for quality improvement and optimization of the mother strain of Beauveria bassiana. Use a sterile punch to punch holes at the center position of the left end for inoculation.

[0042] For every 1 L of the optimized left - end medium for Beauveria bassiana mother culture, it includes: 16 g of glucose, 3 g of peptone, 3 g of ultra - micro - fermented whole silkworm powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 g of MRS broth, 26 mL of soy sauce, 18 g of agar, and add water to 1000 mL; The ultra - micro - fermented whole silkworm powder is made from whole silkworm powder, pig blood clots, and water - soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating Lactobacillus, Candida albicans, and Bacillus subtilis with a total inoculation amount of 5% (the viable cell number ratio of each strain is 2:1:2), adjusting the material humidity to about 50%, culturing at 30 - 34 °C for 60 h, and then drying at 100 °C and ultra - micro - pulverizing.

[0043] For every 1 L of the optimized right - end medium for Beauveria bassiana mother culture, it includes: 17 g of glucose, 3 g of peptone, 1.0 g of magnesium sulfate, 1.6 g of potassium dihydrogen phosphate, 2.0 g of MRS broth, 28 mL of soy sauce, 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL.

[0044] For every 1 L of the solid - liquid mixed fermentation agent medium for Beauveria bassiana, it includes: 15 g of glucose, 6 g of water - soluble soybean cake powder, 5 g of ultra - micro - fermented silkworm pupa powder, 1.3 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 mL of plant active surfactant, 30 mL of soy sauce, and add water to 1000 mL; The ultra - micro - fermented silkworm pupa powder is made from silkworm pupa powder, pig blood clots, and water - soluble soybean cake powder in a mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating Lactobacillus, Candida albicans, and Bacillus subtilis with a viable cell number ratio of 2:1:2 at a total inoculation amount of 15%, with a material - to - water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, drying at 100 °C and ultra - micro - pulverizing.

[0045] Example 2

[0046] A method for cultivating and producing Beauveria bassiana using the 5th - instar silkworm larvae as the culture medium, specifically including the following steps:

[0047] (1) Optimization of Beauveria bassiana mother culture

[0048] Inoculate the activated Beauveria bassiana slant mother culture into the empty space of the optimized left - end medium for Beauveria bassiana mother culture, culture at 26 °C for 10 d for optimization, and select the strain with fast growth rate, thick and vigorous growth, and neat edges in the optimized right - end medium for Beauveria bassiana mother culture for standby;

[0049] Among them, the preparation method of the optimized medium for improving the quality of Beauveria bassiana mother culture is as follows: Place the culture dish obliquely, pour the optimized left - end medium for improving the quality of Beauveria bassiana mother culture into the culture dish. Under sterile conditions, use a sterile scalpel to remove the optimized left - end medium of Beauveria bassiana mother culture at the bottom that exceeds half of the semicircle diameter. Raise and place the blank end of the culture dish obliquely, pour the optimized right - end medium for improving the quality of Beauveria bassiana mother culture into the blank end of the culture dish, so that the optimized right - end medium for improving the quality of Beauveria bassiana mother culture covers a part of the optimized left - end medium for improving the quality of Beauveria bassiana mother culture at the joint, and let it solidify to obtain the optimized medium for improving the quality of Beauveria bassiana mother culture. Use a sterile punch to make a hole at the center position of the left end for inoculation;

[0050] Each 1 L of the optimized left - end medium for improving the quality of Beauveria bassiana mother culture includes: 16 g of glucose, 3 g of peptone, 3 g of ultra - micro fermented whole silkworm powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 g of MRS broth, 26 mL of soy sauce, 18 g of agar, and add water to 1000 mL. The ultra - micro fermented whole silkworm powder is prepared by mixing whole silkworm powder, pig blood clot, and water - soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating Lactobacillus, Candida albicans, and Bacillus subtilis (the viable cell number ratio of each strain is 2:1:2) with a total inoculation amount of 5%. Adjust the moisture content of the material to 50%, culture at 32 °C for 60 h, and then dry and ultra - micro pulverize at 100 °C;

[0051] Each 1 L of the optimized right - end medium for improving the quality of Beauveria bassiana mother culture includes: 17 g of glucose, 3 g of peptone, 1.0 g of magnesium sulfate, 1.6 g of potassium dihydrogen phosphate, 2.0 g of MRS broth, 28 mL of soy sauce, 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL;

[0052] (2) Stress - stimulation culture of Beauveria bassiana solid - liquid mixed fermentation agent

[0053] Under sterile conditions, inoculate the Beauveria bassiana strain on the optimized right - end medium for improving the quality of Beauveria bassiana mother culture into the Beauveria bassiana solid - liquid mixed fermentation agent medium. In the dark environment, statically culture at a temperature of 24 °C for 6 h, then ferment and culture under magnetic stirring at 620 rpm for 11 d. Then shake the Beauveria bassiana solid - liquid mixed fermentation agent evenly and sub - package it into sterilized culture bottles. The height of the Beauveria bassiana solid - liquid mixed fermentation agent in the culture bottle is 1.5 cm, and continue to statically culture at a temperature of 26 °C. When a thin layer of mycelial film forms on the surface of the Beauveria bassiana solid - liquid mixed fermentation agent, it is reserved for use;

[0054] Among them, each 1 L of the solid-liquid mixed fermentation agent culture medium of Beauveria bassiana includes: 15 g of glucose, 6 g of water-soluble soybean cake powder, 5 g of ultra-fine fermented silkworm pupa powder, 1.3 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 mL of plant active surfactant, 30 mL of soy sauce, and add water to 1000 mL; the ultra-fine fermented silkworm pupa powder is made from silkworm pupa powder, pig blood clot and water-soluble soybean cake powder according to the mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculating Lactobacillus, Candida albicans and Bacillus subtilis with a viable bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material-water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, and drying and ultra-fine pulverization at 100 °C;

[0055] (3) Inoculation treatment of the 5th instar silkworm larva culture medium

[0056] After selecting 5th instar silkworm larvae at 8 days old and fasting them for defecation for 6 h, they are sub-packed into culture bottles containing a certain amount of distilled water, fully absorbing water for 3 h, sterilized at 210 °C for 120 min, and then after removing the liquid in the culture bottles in a sterile operating table, introducing the same volume of sterilized solid-liquid mixed fermentation agent culture medium of Beauveria bassiana to fully soak for 30 min, and then placing each silkworm larva into the above-mentioned culture bottle with a Beauveria bassiana solid-liquid mixed fermentation agent with a thin mycelial pellicle;

[0057] (4) Mycelium management of Beauveria bassiana

[0058] Move the culture bottles into a sterile mycelium growth room, continue dark cultivation at a temperature of 26 °C and a humidity of 90%, when the mycelium growth on the surface of the silkworm body is complete and the conidia cover the silkworm body, continue cultivation for 8 days until the mycelium growth stage ends, collect the semi-finished product of Beauveria bassiana, and dry it in the sun to obtain the finished product of Beauveria bassiana.

[0059] Example 3

[0060] A method for cultivating and producing Beauveria bassiana using 5th instar silkworm larvae as the culture medium, specifically including the following steps:

[0061] (1) Quality improvement and optimization of the Beauveria bassiana mother strain

[0062] Inoculate the activated Beauveria bassiana slant mother strain into the empty space at the left end of the Beauveria bassiana mother strain quality improvement and optimization culture medium, cultivate at 26 °C for 8 d for quality improvement and optimization, and select the strain with fast growth rate, thick and vigorous growth, and neat edges at the right end of the Beauveria bassiana mother strain quality improvement and optimization culture medium for standby;

[0063] Among them, the preparation method of the optimized medium for improving the quality of Beauveria bassiana mother culture is as follows: Place the culture dish obliquely, pour the left-end medium for improving the quality of Beauveria bassiana mother culture into the culture dish, and under sterile conditions, use a sterile scalpel to remove the left-end medium for improving the quality of Beauveria bassiana mother culture at the bottom that exceeds the semicircle diameter. Raise and place the blank end of the culture dish obliquely, pour the right-end medium for improving the quality of Beauveria bassiana mother culture into the blank end of the culture dish, so that the right-end medium for improving the quality of Beauveria bassiana mother culture covers a part of the left-end medium for improving the quality of Beauveria bassiana mother culture at the joint, and solidify to obtain the optimized medium for improving the quality of Beauveria bassiana mother culture. Use a sterile punch to punch holes at the center position of the left end for inoculation;

[0064] Each 1 L of the left-end medium for improving the quality of Beauveria bassiana mother culture includes: 16 g of glucose, 3 g of peptone, 3 g of ultra-fine fermented whole silkworm powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 g of MRS broth, 26 mL of soy sauce, 18 g of agar, and add water to 1000 mL; The ultra-fine fermented whole silkworm powder is made by taking whole silkworm powder, pig blood clot, and water-soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating Lactobacillus, Candida albicans, and Bacillus subtilis with a total inoculation amount of 5% (the viable bacteria number ratio of each strain is 2:1:2), adjusting the material humidity to 50%, culturing at 32 °C for 60 h, and then drying and ultra-finely pulverizing at 100 °C;

[0065] Each 1 L of the right-end medium for improving the quality of Beauveria bassiana mother culture includes: 17 g of glucose, 3 g of peptone, 1.0 g of magnesium sulfate, 1.6 g of potassium dihydrogen phosphate, 2.0 g of MRS broth, 28 mL of soy sauce, 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL;

[0066] (2) Stress stimulation culture of Beauveria bassiana solid-liquid mixed fermentation agent

[0067] Under sterile conditions, inoculate the Beauveria bassiana strain on the right-end medium for improving the quality of Beauveria bassiana mother culture into the Beauveria bassiana solid-liquid mixed fermentation agent medium. In the dark environment, statically culture at a temperature of 26 °C for 6 h, then ferment and culture under magnetic stirring at 620 rpm for 9 d. Then shake the Beauveria bassiana solid-liquid mixed fermentation agent well and sub-pack it into a sterilized culture bottle. The height of the Beauveria bassiana solid-liquid mixed fermentation agent in the culture bottle is 1.0 cm, and continue to statically culture at a temperature of 25 °C. When a thin layer of mycelial skin forms on the surface of the Beauveria bassiana solid-liquid mixed fermentation agent, it is reserved for use;

[0068] Among them, each 1 L of the solid-liquid mixed fermentation agent medium for Beauveria bassiana includes: 18 g of glucose, 5 g of water-soluble soybean cake powder, 4 g of ultra-fine fermented silkworm pupa powder, 1.0 g of magnesium sulfate, 1.2 g of potassium dihydrogen phosphate, 3.0 mL of plant active surfactant, 27 mL of soy sauce, and water is added to 1000 mL; the ultra-fine fermented silkworm pupa powder is prepared by taking silkworm pupa powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculating Lactobacillus, Candida albicans and Bacillus subtilis with a viable bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material-water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, and drying and ultra-fine pulverization at 100 °C;

[0069] (3) Inoculation treatment of the 5th instar silkworm larva medium

[0070] Select 5th instar silkworm larvae at 6 days old, fast them from eating and defecate for 6 h, then sub-pack them into culture bottles containing a certain amount of distilled water and let them fully absorb water for 2 h, sterilize at 210 °C for 120 min, then remove the liquid in the culture bottles in a sterile operation table, introduce the same volume of sterilized solid-liquid mixed fermentation agent medium for Beauveria bassiana to fully soak for 25 min, and then place each silkworm larva into the culture bottle with the solid-liquid mixed fermentation agent for Beauveria bassiana with a thin fungal skin;

[0071] (4) Mycelium management of Beauveria bassiana

[0072] Move the culture bottles into a sterile mycelium growth room, continue dark cultivation at a temperature of 24 °C and a humidity of 88%. When the mycelium grows completely on the surface of the silkworm body and the conidia cover the silkworm body, continue cultivation for 9 days until the mycelium growth stage ends. Collect the semi-finished products of Beauveria bassiana and dry them in the sun to obtain the finished products of Beauveria bassiana.

[0073] Example 4

[0074] A method for cultivating and producing Beauveria bassiana using 5th instar silkworm larvae as a medium, specifically including the following steps:

[0075] (1) Quality improvement and optimization of the Beauveria bassiana mother strain

[0076] Inoculate the activated Beauveria bassiana slant mother strain into the empty space at the left end of the medium for quality improvement and optimization of the Beauveria bassiana mother strain, cultivate at 26 °C for 9 d for quality improvement and optimization, and select the strain with fast growth rate, thick and vigorous growth, and neat edges at the right end of the medium for quality improvement and optimization of the Beauveria bassiana mother strain for standby;

[0077] Among them, the preparation method of the optimized medium for improving the quality of Beauveria bassiana mother culture is as follows: Place the culture dish obliquely, pour the optimized left-end medium for improving the quality of Beauveria bassiana mother culture into the culture dish. Under sterile conditions, use a sterile scalpel to remove the optimized left-end medium of Beauveria bassiana mother culture at the bottom that exceeds the semicircle diameter. Raise and place the blank end of the culture dish obliquely, pour the optimized right-end medium for improving the quality of Beauveria bassiana mother culture into the blank end of the culture dish, so that the optimized right-end medium for improving the quality of Beauveria bassiana mother culture covers a part of the optimized left-end medium for improving the quality of Beauveria bassiana mother culture at the joint, and solidify to obtain the optimized medium for improving the quality of Beauveria bassiana mother culture. Use a sterile punch to punch holes at the center position of the left end for inoculation;

[0078] Each 1 L of the optimized left-end medium for improving the quality of Beauveria bassiana mother culture includes: 16 g of glucose, 3 g of peptone, 3 g of ultra-fine fermented whole silkworm powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 g of MRS broth, 26 mL of soy sauce, 18 g of agar, and add water to 1000 mL; The ultra-fine fermented whole silkworm powder is prepared by mixing whole silkworm powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculating Lactobacillus, Candida albicans, Bacillus subtilis (the viable cell number ratio of each strain is 2:1:2) at a total inoculation amount of 5%, adjusting the material humidity to 50%, culturing at 32 °C for 60 h, and then drying and ultra-finely pulverizing at 100 °C;

[0079] Each 1 L of the optimized right-end medium for improving the quality of Beauveria bassiana mother culture includes: 17 g of glucose, 3 g of peptone, 1.0 g of magnesium sulfate, 1.6 g of potassium dihydrogen phosphate, 2.0 g of MRS broth, 28 mL of soy sauce, 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL;

[0080] (2) Stress stimulation culture of Beauveria bassiana solid-liquid mixed fermenter

[0081] Under sterile conditions, inoculate the Beauveria bassiana strain on the optimized right-end medium for improving the quality of Beauveria bassiana mother culture into the Beauveria bassiana solid-liquid mixed fermenter medium. In the dark environment, statically culture at a temperature of 25 °C for 6 h, then ferment and culture under magnetic stirring at 620 rpm for 10 d. Then shake the Beauveria bassiana solid-liquid mixed fermenter well and sub-pack it into a sterilized culture bottle. The height of the Beauveria bassiana solid-liquid mixed fermenter in the culture bottle is 1.3 cm, and continue to statically culture at a temperature of 24 °C. When a thin layer of mycelial skin forms on the surface of the Beauveria bassiana solid-liquid mixed fermenter, it is reserved for use;

[0082] Among them, each 1 L of the solid-liquid mixed fermentation agent medium for Beauveria bassiana includes: 16 g of glucose, 6 g of water-soluble soybean cake powder, 3 g of ultra-fine fermented silkworm pupa powder, 1.1 g of magnesium sulfate, 1.3 g of potassium dihydrogen phosphate, 2.8 mL of plant active surfactant, 25 mL of soy sauce, and add water to 1000 mL; the ultra-fine fermented silkworm pupa powder is prepared from silkworm pupa powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculating Lactobacillus, Candida albicans and Bacillus subtilis with a viable bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material-to-water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, and drying and ultra-finely pulverizing at 100 °C;

[0083] (3) Inoculation treatment of the 5th instar silkworm larva medium

[0084] Select 5th instar silkworm larvae at 7 days old, fast them for defecation for 6 h, then sub-pack them into culture bottles containing a certain amount of distilled water and let them fully absorb water for 2.5 h, sterilize at 210 °C for 120 min, and then after clearing the liquid in the culture bottles in a sterile operation table, introduce the same volume of sterilized solid-liquid mixed fermentation agent medium for Beauveria bassiana and soak them fully for 20 min, and then place each silkworm larva into the above-mentioned culture bottles with the solid-liquid mixed fermentation agent of Beauveria bassiana with a thin fungal skin;

[0085] (4) Mycelium management of Beauveria bassiana

[0086] Move the culture bottles into a sterile mycelium growth room, continue dark cultivation at a temperature of 25 °C and a humidity of 86%. When the mycelium growth on the silkworm body surface is complete and the conidia cover the silkworm body, continue cultivation for 9 days until the mycelium growth stage ends. Collect the semi-finished products of Beauveria bassiana and dry them in the sun to obtain the finished products of Beauveria bassiana.

[0087] Example 5

[0088] A method for cultivating and producing Beauveria bassiana using 5th instar silkworm larvae as the medium, specifically including the following steps:

[0089] (1) Quality improvement and optimization of the Beauveria bassiana mother strain

[0090] Inoculate the activated Beauveria bassiana slant mother strain into the empty space at the left end of the medium for quality improvement and optimization of the Beauveria bassiana mother strain, cultivate at 26 °C for 7 d for quality improvement and optimization, and select the strain with fast growth rate, thick and vigorous growth, and neat edges at the right end of the medium for quality improvement and optimization of the Beauveria bassiana mother strain for standby;

[0091] Among them, the preparation method of the optimized medium for improving the quality of Beauveria bassiana stock culture is as follows: Place the culture dish obliquely, pour the optimized left-end medium for improving the quality of Beauveria bassiana stock culture into the culture dish, and under sterile conditions, use a sterile scalpel to remove the optimized left-end medium of Beauveria bassiana stock culture at the bottom that exceeds the semi-circle diameter. Raise and place the blank end of the culture dish obliquely, pour the optimized right-end medium for improving the quality of Beauveria bassiana stock culture into the blank end of the culture dish, so that the optimized right-end medium for improving the quality of Beauveria bassiana stock culture covers a part of the optimized left-end medium for improving the quality of Beauveria bassiana stock culture at the joint, and solidify to obtain the optimized medium for improving the quality of Beauveria bassiana stock culture. Use a sterile punch to punch holes at the center position of the left end for inoculation;

[0092] Each 1 L of the optimized left-end medium for improving the quality of Beauveria bassiana stock culture includes: 16 g of glucose, 3 g of peptone, 3 g of ultra-fine fermented whole silkworm powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 3.0 g of MRS broth, 26 mL of soy sauce, 18 g of agar, and add water to 1000 mL; The ultra-fine fermented whole silkworm powder is prepared by taking whole silkworm powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculating Lactobacillus, Candida albicans, Bacillus subtilis (the viable cell number ratio of each strain is 2:1:2) with a total inoculation amount of 5%, adjusting the material humidity to 50%, culturing at 32 °C for 60 h, and then drying and ultra-finely pulverizing at 100 °C;

[0093] Each 1 L of the optimized right-end medium for improving the quality of Beauveria bassiana stock culture includes: 17 g of glucose, 3 g of peptone, 1.0 g of magnesium sulfate, 1.6 g of potassium dihydrogen phosphate, 2.0 g of MRS broth, 28 mL of soy sauce, 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL;

[0094] (2) Stress stimulation culture of Beauveria bassiana solid-liquid mixed fermentation agent

[0095] Under sterile conditions, inoculate the Beauveria bassiana strain on the optimized right-end medium for improving the quality of Beauveria bassiana stock culture into the Beauveria bassiana solid-liquid mixed fermentation agent medium. In the dark environment, statically culture at a temperature of 26 °C for 6 h, then ferment and culture under magnetic stirring at 620 rpm for 9 d. Then shake the Beauveria bassiana solid-liquid mixed fermentation agent well and sub-pack it into a sterilized culture bottle. The height of the Beauveria bassiana solid-liquid mixed fermentation agent in the culture bottle is 1.4 cm, and continue to statically culture at a temperature of 24 °C. When a thin layer of mycelial skin forms on the surface of the Beauveria bassiana solid-liquid mixed fermentation agent, it is reserved for use;

[0096] Among them, each 1 L of the Beauveria bassiana solid-liquid mixed fermentation agent culture medium includes: 17 g of glucose, 5 g of water-soluble soybean cake powder, 5 g of ultra-fine fermented silkworm pupa powder, 1.2 g of magnesium sulfate, 1.5 g of potassium dihydrogen phosphate, 2.6 mL of plant active surfactant, 28 mL of soy sauce, and water is added to 1000 mL; the ultra-fine fermented silkworm pupa powder is prepared from silkworm pupa powder, pig blood clot and water-soluble soybean cake powder in a mass ratio of 3:1:1, supplemented with 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement the nutrient components, and inoculated with Lactobacillus, Candida albicans and Bacillus subtilis with a viable bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material-water ratio of 1:0.5, a temperature of 30 °C, a fermentation time of 3 d, and dried at 100 °C and ultra-finely pulverized;

[0097] (3) Inoculation treatment of the 5th instar silkworm larva culture medium

[0098] Select 5th instar silkworm larvae at 8 days old, fast them from eating and defecate for 6 h, then sub-pack them into culture bottles containing a certain amount of distilled water, allow them to fully absorb water for 3 h, sterilize at 210 °C for 120 min, and then in a sterile operation bench, after clearing the liquid in the culture bottle, introduce the same volume of sterilized Beauveria bassiana solid-liquid mixed fermentation agent culture medium and soak for 28 min, and then place the silkworm larvae one by one into the culture bottle with the Beauveria bassiana solid-liquid mixed fermentation agent with a thin mycelial skin;

[0099] (4) Mycelium management of Beauveria bassiana

[0100] Move the culture bottle into a sterile mycelium room, continue dark cultivation at a temperature of 26 °C and a humidity of 85%, when the mycelium on the surface of the silkworm body is completely developed and the conidia cover the silkworm body, continue cultivation for 9 days until the mycelium stage ends, collect the semi-finished product of Beauveria bassiana, and dry it in the sun to obtain the finished product of Beauveria bassiana.

[0101] Performance test

[0102] Respectively take the Beauveria bassiana prepared in Examples 2-5, the commercially available Beauveria bassiana in a certain city in Sichuan (Commercially available 1) and the commercially available Beauveria bassiana in Guangxi (Commercially available 2), respectively test their active ingredient contents, and compare them with the standards of the Pharmacopoeia of the People's Republic of China.

[0103] The results are shown in Table 1.

[0104] Table 1 Comparative analysis of the active ingredient contents of Beauveria bassiana in Examples 2-5 with commercially available 1-2 and the pharmacopoeia standard

[0105]

[0106] As can be seen from Table 1, the active ingredient contents of Beauveria bassiana in Examples 2-5 are all superior to those of commercially available 1-2 and the pharmacopoeia standard.

[0107] The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for cultivating and producing Beauveria bassiana using the 5th instar larvae of Bombyx mori as a culture medium, characterized in that, Specifically, it includes the following steps: (1) Quality improvement and optimization of Beauveria bassiana mother culture Inoculate the activated Beauveria bassiana slant mother culture into the empty space in the left - end medium for the quality improvement and optimization of Beauveria bassiana mother culture for cultivation and quality improvement. Select the strain with fast growth rate, thick and vigorous growth, and neat edges in the right - end medium of the quality improvement and optimization of Beauveria bassiana mother culture for standby; (2) Stress - stimulated cultivation of Beauveria bassiana solid - liquid mixed fermentation agent Under sterile conditions, inoculate the Beauveria bassiana strain on the right - end medium of the quality improvement and optimization of Beauveria bassiana mother culture into the Beauveria bassiana solid - liquid mixed fermentation agent medium, statically cultivate in the dark environment, then ferment and cultivate under magnetic stirring. Then shake the Beauveria bassiana solid - liquid mixed fermentation agent evenly and sub - pack it into the sterilized culture bottles, and continue static cultivation. When a layer of mycelial skin forms on the surface of the Beauveria bassiana solid - liquid mixed fermentation agent, it is for standby; (3) Inoculation treatment of the medium for 5th - instar silkworm larvae After selecting 5th - instar silkworm larvae, fasting them to defecate, sub - pack them into culture bottles filled with distilled water to fully absorb water and sterilize. Then, after removing the liquid in the culture bottles in the sterile operation table, introduce the same volume of sterilized Beauveria bassiana solid - liquid mixed fermentation agent medium to fully soak them. Then place each silkworm larva into the culture bottle of the Beauveria bassiana solid - liquid mixed fermentation agent with the above - mentioned mycelial skin one by one; (4) Mycelium growth management of Beauveria bassiana - infected silkworms Transfer the culture bottles into a sterile mycelium - growth room and continue dark cultivation. When the mycelium growth on the surface of the silkworm body is complete and the conidia cover the silkworm body, continue cultivation until the end of the mycelium - growth stage. Collect the semi - finished product of Beauveria bassiana - infected silkworms and dry them in the sun to obtain the finished product of Beauveria bassiana - infected silkworms.

2. The method for cultivating and producing Beauveria bassiana using the fifth-instar silkworm larvae as a culture medium according to claim 1, characterized in that, In step (1), the preparation method of the medium for the quality improvement and optimization of Beauveria bassiana mother culture is as follows: Place the culture dish obliquely, pour the left - end medium for the quality improvement and optimization of Beauveria bassiana mother culture into the culture dish. Under sterile conditions, use a sterile scalpel to remove the left - end medium for the quality improvement and optimization of Beauveria bassiana mother culture whose bottom layer exceeds the semi - circle diameter. Raise and place the blank end of the culture dish obliquely, pour the right - end medium for the quality improvement and optimization of Beauveria bassiana mother culture into the blank end of the culture dish, so that the medium for the quality improvement and optimization of Beauveria bassiana mother culture covers a part of the left - end medium for the quality improvement and optimization of Beauveria bassiana mother culture at the joint, and solidify to obtain the medium for the quality improvement and optimization of Beauveria bassiana mother culture. Use a sterile punch to punch a hole at the center position of the left end for inoculation.

3. A method for cultivating and producing Beauveria bassiana using the fifth-instar silkworm larvae as a culture medium according to claim 2, characterized in that, Every 1L of the left - end medium for the quality improvement and optimization of Beauveria bassiana mother culture includes: 15 - 18g of glucose, 2 - 3g of peptone, 3 - 5g of ultra - fine fermented whole silkworm powder, 1.0 - 1.2g of magnesium sulfate, 1.5 - 1.8g of potassium dihydrogen phosphate, 2.0 - 3.0g of MRS broth, 25 - 30mL of soy sauce, 18g of agar, and add water to 1000mL.

4. A method for cultivating and producing Beauveria bassiana using the 5th instar larvae of Bombyx mori as a culture medium, as claimed in claim 3, wherein, The ultra - fine fermented whole silkworm powder is prepared by mixing whole silkworm powder, pig blood clot, and water - soluble soybean cake powder in a mass ratio of 3:2:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrients, and inoculating with Lactobacillus, Candida albicans, and Bacillus subtilis with a live - bacteria number ratio of 2:1:2 at a total inoculation amount of 5%. Adjust the moisture content of the material to 50%, cultivate at 30 - 34°C for 60h, and then dry and ultra - finely pulverize at 100°C.

5. A method for cultivating and producing Beauveria bassiana using the 5th instar larvae of Bombyx mori as a culture medium, characterized in that, For every 1 L of the optimized right - end culture medium for Beauveria bassiana mother culture, it includes: 15 - 18 g of glucose, 2 - 3 g of peptone, 1.0 - 1.2 g of magnesium sulfate, 1.5 - 1.8 g of potassium dihydrogen phosphate, 2.0 - 3.0 g of MRS broth, 25 - 30 mL of soy sauce, 1.5 - 2.0 mL of plant active surfactant, 18 g of agar, and add water to 1000 mL.

6. A method for cultivating and producing Beauveria bassiana using the 5th instar larvae of Bombyx mori as a culture medium, characterized in that, In step (2) and step (3), for every 1 L of the solid - liquid mixed fermentation agent culture medium for Beauveria bassiana, it includes: 15 - 18 g of glucose, 5 - 6 g of water - soluble soybean cake powder, 3 - 5 g of ultra - fine fermented silkworm pupa powder, 1.0 - 1.3 g of magnesium sulfate, 1.2 - 1.5 g of potassium dihydrogen phosphate, 2.5 - 3.0 mL of plant active surfactant, 25 - 30 mL of soy sauce, and add water to 1000 mL.

7. A method for cultivating and producing Beauveria bassiana using the 5th instar larvae of Bombyx mori as a culture medium, as claimed in claim 6, characterized in that, The ultra - fine fermented silkworm pupa powder is prepared by taking silkworm pupa powder, pig blood clot and water - soluble soybean cake powder in a mass ratio of 3:1:1, adding 0.6% sucrose, 0.3% magnesium sulfate, 0.03% potassium dihydrogen phosphate to supplement nutrient components, and inoculating Lactobacillus, Candida albicans and Bacillus subtilis with a live bacteria number ratio of 2:1:2 at a total inoculation amount of 15%, with a material - to - water ratio of 1:0.5, at a temperature of 30 °C, for a fermentation time of 3 d, and then drying at 100 °C and ultra - finely pulverizing.

Images