Single-domain antibodies targeting BCMA and related materials and applications
By developing single-domain antibodies targeting BCMA coupled with radionuclides, the sensitivity and accuracy of BCMA detection and treatment in the prior art were solved, and efficient and accurate BCMA detection and treatment effects were achieved.
Patent Information
- Application Number
- CN202510827607.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2045-06-20
AI Technical Summary
It is difficult for the prior art to achieve sensitive and efficient detection and precise targeted treatment of BCMA. Traditional antibodies are unstable in narrow pH and temperature ranges, and new therapies such as CAR-T cell therapy and bispecific antibodies have toxic reactions and off-target effects.
Develop single-domain antibodies targeting BCMA, combining single-domain antibodies with high specificity and low molecular weight, for coupling with radionuclides, forming immunoconjugates and probe molecules, for efficient detection and treatment of BCMA.
It realizes efficient and accurate detection and treatment of BCMA, reduces non-specific uptake, improves imaging quality and treatment effect, and is suitable for the diagnosis and efficacy monitoring of BCMA-related tumors.
Smart Images

Figure CN120329445B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of medical technology, and in particular relates to a single-domain antibody targeting BCMA and related materials and applications thereof. Background Art
[0002] Multiple myeloma (MM) is a malignant tumor characterized by the abnormal proliferation of clonal plasma cells, predominantly affecting middle-aged and elderly patients. It is the second most common hematologic malignancy and remains incurable. In normal human tissue, BCMA protein and mRNA are found almost exclusively on plasma cells and are selectively overexpressed during malignant transformation. BCMA promotes tumor cell growth, survival, and drug resistance primarily by activating intracellular signaling cascades involving NFκB, AKT, phosphoinositide 3-kinase (PI3K), STAT3, and MAPK. This consistent expression and near-unique restriction of BCMA on the surface of MM cells in both cell lines and patient samples makes BCMA a highly sought-after target for MM drug discovery and development. Currently, BCMA-targeted drug development is primarily focused on MM, with approved indications for multiple myeloma, AL amyloidosis, and hematologic malignancies. Other drugs currently in development include cancer, non-Hodgkin's lymphoma, B-cell lymphomas, solid tumors, diffuse large B-cell lymphoma, autoimmune diseases, end-stage renal disease, and leukemia.
[0003] BCMA (B-cell maturation antigen), also known as TNFRSF17 or CD269 (UniProt Q02223), is encoded by the 2.92 kb TNFRSF17 gene located on the short arm of chromosome 16 (16p13.13) and consists of three exons and two introns. The BCMA protein is a type III transmembrane glycoprotein consisting of 184 amino acids with a molecular weight of 20.2 kDa and belongs to the tumor necrosis factor (TNF) receptor superfamily. The BCMA protein structure consists of an N-terminal extracellular domain (ECD), a transmembrane domain (TM), and an intracellular domain (ICD). The extracellular N-terminus lacks a signal sequence and contains a conserved motif of six cysteines. The ECD consists of 54 amino acids, the TM contains 23 amino acid residues, and the ICD contains 107 amino acids. BCMA is primarily expressed on the surface of late-stage B cells, short-lived proliferating plasmablasts, and long-lived plasma cells, and to a lesser extent on memory B cells. It is absent from naive B cells, CD34-positive hematopoietic stem cells, and other normal tissue cells. It is highly expressed in malignantly proliferating B lymphocytes (such as myeloma and leukemia cells). Furthermore, by mediating downstream signaling pathways, it plays a critical role in cell survival, proliferation, metastasis, and drug resistance. These properties make it a promising target for immunotherapy, particularly in the treatment of multiple myeloma.
[0004] Traditional antibodies, such as monoclonal (mAb) and polyclonal (pAb), have long been at the forefront of biomedical research, used for diagnostics, analyses, and therapeutics targeting cancer, immune disorders, and infectious diseases. While traditional antibodies serve as the foundation of highly successful research, diagnostic, and therapeutic tools, they also have drawbacks, such as limited stability within narrow pH and temperature ranges and a potential inability to access specific active sites on proteins. In recent years, single-domain antibodies (Nbs), as a novel class of biomolecules, have shown tremendous potential in cancer research, drug development, and treatment due to their unique advantages. Nanobodies are single-chain antibody fragments derived from camelid heavy-chain antibodies and consist of four conserved sequence segments (FR1, FR2, FR3, and FR4) and three highly variable complementarity-determining regions (CDR1, CDR2, and CDR3). Nanobodies lack light chains and are approximately one-tenth the size of traditional antibodies, yet they possess fully functional antigen-binding capacity. Compared to traditional antibodies, Nbs have a longer CDR3 loop, enabling more interactions with antigens and increasing the number of potential targets. The small size of single-domain antibodies enables them to quickly diffuse and penetrate tumor tissue, effectively exerting their effects. They also possess strong specificity, high affinity, high stability, and low immunogenicity. They can be expressed in large quantities in production systems such as Escherichia coli and Saccharomyces cerevisiae, reducing production costs. Furthermore, single-domain antibodies can be modified to extend their half-life and enhance their efficacy.
[0005] Recent advances in treatment have shown promising therapeutic potential for BCMA-targeted therapies, such as CAR-T cell therapy, bispecific antibodies (BsAbs), and antibody-drug conjugates (ADCs). These novel therapies have demonstrated promising efficacy in patients with relapsed and refractory multiple myeloma (MM), but are also associated with toxicities, including cytokine release syndrome and off-target effects. Furthermore, some patients fail to achieve significant benefit, highlighting the need for more effective monitoring methods to noninvasively assess BCMA expression and treatment response.
[0006] Nuclear medicine technology can detect the in vivo distribution of target molecules by labeling specific molecular probes with radionuclides and using single-photon emission computed tomography (SPECT) or positron emission tomography (PET / CT). 18 F-FDG is widely used in the diagnosis, staging and efficacy monitoring of malignant tumors. However, it has certain limitations in the detection of MM, because the expression of glucose transporter (GLUT1) and hexokinase-2 (HK-2) in MM cells is low, resulting in 18F-FDG has difficulty detecting some intramedullary lesions. In contrast, immunoPET combines the highly specific binding ability of antibodies with the high sensitivity and quantitative analysis advantages of PET imaging, allowing for in vivo visualization of target expression and distribution. This assay holds great potential for the detection of specific targets in multiple myeloma.
[0007] Different types of antibody drug fragments have their own advantages in tumor-targeted diagnosis and treatment. Radiolabeled whole antibodies, due to their large molecular weight, usually need to be combined with radionuclides with longer half-lives, resulting in slow pharmacokinetics, slow blood clearance, and high background signal. However, they can achieve targeted internal irradiation therapy by specifically binding to tumor cells. In contrast, peptide-drug conjugates (PDCs) have the advantages of small molecular weight, excellent tumor penetration, and low immunogenicity, and are suitable for combination with diagnostic nuclides with shorter half-lives (such as 18 F. 68 Ga) conjugation, showing promising potential for clinical translation. Single-domain antibodies (Nb), as the smallest antibody fragments, possess higher antigen affinity, tissue permeability, and faster clearance rates, and are commonly used in molecular imaging and therapeutic delivery. Antibody fragments, by retaining the targeting properties of intact antibodies, offer improved tumor penetration, faster blood clearance, and a higher signal-to-noise ratio, making them promising candidates for immuno-PET imaging agents.
[0008] At present, the research and development of BCMA-targeted probes has made significant progress. For example, the nuclear medicine team of the First Affiliated Hospital of Jinan University recently developed a monoclonal antibody BCMAh230430 targeting BCMA. 89 Zr and 177 After Lu was labeled separately, it demonstrated its effectiveness in non-invasive monitoring of BCMA expression status and radioimmunotherapy in subcutaneous tumors of multiple myeloma (MM). Wei et al. designed two single-domain antibodies targeting BCMA for detection in primary multiple myeloma models. PET imaging analysis showed that the two tracers had comparable diagnostic effects in disseminated MM models and could effectively detect disseminated MM lesions. At the same time, the 68The Ga-labeled BCMA-targeting peptide BP1 demonstrated excellent tumor targeting and in vivo stability in preclinical studies. It primarily accumulated in the kidneys, bladder, and BCMA-positive H929 tumors. Imaging results showed that the peptide bound to the BCMA protein with high specificity. Metabolic studies also showed that it was primarily metabolized through the kidneys, with low background uptake and good imaging effects (Source: Song L, Jiang S, Yang Q, Huang W, Qiu Y, Chen Z, Sun X, Wang T, Wu S, Chen Y, Zeng H, Wang Z, Kang L. Development of a Novel Peptide-Based PET Tracer [ 68 Ga]Ga-DOTA-BP1 for BCMA Detection in Multiple Myeloma. JMed Chem. 2024 Sep 12;67(17):15118-15130. doi: 10.1021 / acs.jmedchem.4c00759.Epub 2024 Aug 21. PMID: 39167092.).
[0009] Therefore, the development of single-domain antibodies targeting BCMA can be used for the research of BCMA bispecific antibody drugs or BCMA CAR-T cell therapy, and can also be used for radionuclide labeling. As a reagent drug for clinical testing, it has extremely broad application prospects and research value. Summary of the Invention
[0010] The technical problem to be solved by the present invention is how to achieve sensitive and efficient detection and / or precise targeted treatment of BCMA. To solve this technical problem, the present invention provides the following technical solutions.
[0011] The present invention provides a single-domain antibody, which comprises three complementarity determining regions named CDR1, CDR2 and CDR3; the amino acid sequences of CDR1, CDR2 and CDR3 respectively include positions 28 to 35, positions 49 to 60 and positions 97 to 112 of SEQ ID NO: 1.
[0012] In the present invention, the single-domain antibody may be a single-domain antibody that binds to BCMA.
[0013] In the present invention, the binding may be specific binding.
[0014] In some specific embodiments of the present invention, the amino acid sequences of CDR1, CDR2 and CDR3 of the single-domain antibody are positions 28 to 35, positions 49 to 60 and positions 97 to 112 of SEQ ID NO: 1, respectively.
[0015] The single domain antibody may further comprise four framework regions named FR1, FR2, FR3 and FR4,
[0016] The FR1 may include the amino acid sequence shown in at least one of (A11) or (A12):
[0017] (A11) positions 1 to 27 of SEQ ID NO: 1,
[0018] (A12) has an amino acid sequence that is more than 70% identical to (A11);
[0019] The FR2 may include the amino acid sequence shown in at least one of (A21) or (A22):
[0020] (A21) positions 36 to 48 of SEQ ID NO: 1,
[0021] (A22) has an amino acid sequence that is more than 70% identical to (A21);
[0022] The FR3 may include the amino acid sequence shown in at least one of (A31) or (A32):
[0023] (A31) positions 61 to 96 of SEQ ID NO: 1,
[0024] (A32) has an amino acid sequence with more than 70% identity with (A31);
[0025] The FR4 may include the amino acid sequence shown in at least one of (A41) or (A42):
[0026] (A41) positions 113 to 123 of SEQ ID NO: 1,
[0027] (A42) has an amino acid sequence that is more than 70% identical to (A41).
[0028] In the present invention, the single-domain antibody (SDA) consists of three CDRs separated by a "framework region." The framework region aligns the CDRs for specific binding to an antigenic epitope. The CDRs comprise the amino acid residues primarily responsible for antigen binding in an antibody. From the amino-terminus to the carboxyl-terminus, a SDA comprises the following framework region (FR) and CDR regions: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
[0029] In a specific embodiment of the present invention, the amino acid sequences of FR1, FR2, FR3 and FR4 of the single-domain antibody may be positions 1 to 27, positions 36 to 48, positions 61 to 96 and positions 113 to 123 of SEQ ID NO: 1, respectively.
[0030] In the present invention, the amino acid sequence of the single-domain antibody may include SEQ ID NO: 1 or have at least 70% identity with SEQ ID NO: 1.
[0031] In the present invention, the amino acid sequence of the single-domain antibody may be SEQ ID NO: 1.
[0032] In the present invention, the amino acid sequence of the single-domain antibody may also have at least 70% identity with SEQ ID NO: 1.
[0033] Herein, the "identity of more than 70%" or "identity of at least 70%" can specifically be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity.
[0034] The present invention also provides an immunoconjugate, comprising (I) and (II):
[0035] (I) antibodies, including the above-mentioned single domain antibodies;
[0036] (II) Conjugation moiety: The conjugation moiety can be selected from a detectable label, a drug, a toxin, a nucleic acid, a therapeutic isotope or a combination thereof.
[0037] In a specific embodiment of the present invention, the antibody in the immunoconjugate is the above-mentioned single domain antibody.
[0038] In the present invention, the detectable labels include (but are not limited to): radionuclides, fluorescein, enzymes, and colloidal gold.
[0039] The present invention also provides a probe molecule, which contains the above-mentioned single domain antibody.
[0040] In the present invention, the probe molecule may be a radioactive probe.
[0041] In the present invention, the radioactive probe may include the single domain antibody and a radionuclide coupled to the single domain antibody.
[0042] In the present invention, the radionuclides include but are not limited to the following (i) and / or (ii):
[0043] (i) a diagnostic isotope selected from the group consisting of Ga-68 (i.e. 68 Ga), F-18, I-123, Ga-67, Cu-64, Zr-89, C-11, Re-188, or a combination thereof; and / or
[0044] (ii) therapeutic isotopes selected from the group consisting of I-131, I-124, I-125, Lu-177, Tc-99m, In-111, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au -198, Ho-166, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177, or a combination thereof.
[0045] In the present invention, the radioactive nuclide is selected from: Ga-68, F-18, and I-131.
[0046] In some embodiments of the invention, the radionuclide is Ga-68.
[0047] In the present invention, "Ga-68" and " 68 Ga" has the same meaning.
[0048] In some embodiments of the present invention, the probe is 68 Ga-NOTA-PFBC01 single domain antibody labeled probe.
[0049] The present invention also provides a reagent or kit comprising the above-mentioned single domain antibody, immunoconjugate and / or probe molecule.
[0050] In the present invention, the reagent or kit may have at least one of the following uses:
[0051] (B1) Recognize or assist in recognizing BCMA protein;
[0052] (B2) binds to or assists in binding to BCMA protein;
[0053] (B3) Detecting or assisting in detecting whether the sample to be tested contains BCMA protein;
[0054] (B4) detecting or assisting in detecting the BCMA protein content in the sample to be tested;
[0055] (B5) Identify or assist in identifying BCMA protein-positive diseases;
[0056] (B6) targeting BCMA protein;
[0057] (B7) Diagnosis of diseases related to BCMA protein.
[0058] In the present invention, the reagent or kit may further include a carrier acceptable in detection science.
[0059] In the present invention, the assay-acceptable carrier may be a non-toxic, inert aqueous carrier medium.
[0060] In the present invention, the carrier acceptable in detection is one or more reagents selected from the following group: isotope tracers, contrast agents, flow detection reagents, cell immunofluorescence detection reagents, nanomagnetic particles and imaging agents.
[0061] In some embodiments of the present invention, the detection agent may be a contrast agent. Furthermore, the contrast agent may also include other agents used for imaging.
[0062] In some embodiments of the present invention, the contrast agent is a contrast agent for MRI (magnetic resonance imaging) or CT (computerized tomography).
[0063] In some embodiments of the present invention, the imaging agent simultaneously chelates two or more signals, such as Ga-68 and Gd, which are used for PET / CT and MRI; or Tc-99m and a fluorescent agent, which are used for SPECT / CT and fluorescence detection.
[0064] In some embodiments of the present invention, the detection reagent can be used for in vivo detection.
[0065] In some embodiments of the present invention, the dosage form of the detection reagent is liquid or powder (such as aqueous solution, injection, lyophilized powder, tablet, buccal preparation, inhaler).
[0066] The present invention also provides a polypeptide comprising the above-mentioned single domain antibody.
[0067] In the present invention, the polypeptide may be a BCMA antibody or an antigen-binding fragment thereof.
[0068] In some embodiments of the present invention, the BCMA antibody or antigen-binding fragment thereof includes, but is not limited to, a recombinant single-domain antibody, a bivalent single-domain antibody, a multivalent single-domain antibody, a multispecific single-domain antibody, a single heavy-chain antibody, a Fab, a Fab' fragment, a F(ab')2 fragment, a minimum recognition unit (MRU), an Fv antibody, a single-chain antibody, or a heavy-chain antibody.
[0069] In some embodiments of the present invention, the polypeptide is a recombinant single-domain antibody with a 6×His tag. The amino acid sequence of the recombinant single-domain antibody is SEQ ID NO: 3. In SEQ ID NO: 3, positions 2 to 124 are identical to those in SEQ ID NO: 1.
[0070] The present invention also provides a pharmaceutical composition, which may include the above-mentioned single domain antibody, the immunoconjugate, the probe molecule and / or the polypeptide.
[0071] In the present invention, the pharmaceutical composition may further include a pharmaceutically acceptable carrier.
[0072] In the present invention, the pharmaceutical composition also contains other drugs for treating tumors.
[0073] The present invention also provides the use of the above-mentioned single domain antibody, the immunoconjugate, the probe molecule or the polypeptide in at least one of the following (C1) to (C7),
[0074] (C1) Preparing a detection reagent, a detection kit, a detection plate or a developer for identifying or assisting in identifying BCMA protein;
[0075] (C2) preparing a detection reagent, a detection kit, a detection plate or a developer that binds or assists in binding to BCMA protein;
[0076] (C3) Preparing detection reagents, detection kits, detection plates or developing agents for detecting or assisting in detecting the expression level of BCMA in cells;
[0077] (C4) Preparation of detection reagents, test kits, test plates or developing agents for diagnosing or assisting in the diagnosis of BCMA-positive diseases;
[0078] (C5) Preparation of detection reagents, test kits, test plates or imaging agents for diagnosis or auxiliary diagnosis of BCMA-positive disease staging;
[0079] (C6) Preparation of detection reagents, test kits, test plates or developing agents for monitoring or assisting in monitoring the therapeutic effects of BCMA-positive diseases;
[0080] (C7) Preparing a pharmaceutical composition for treating and / or preventing BCMA-positive diseases.
[0081] The present invention also provides the use of the above-mentioned single domain antibody, immunoconjugate, probe molecule, reagent or kit, polypeptide or / and pharmaceutical composition in any of the following items:
[0082] (D1) Recognize or assist in recognizing BCMA protein;
[0083] (D2) binds to or assists in binding to BCMA protein;
[0084] (D3) Detecting or assisting in detecting the BCMA expression level in cells;
[0085] (D4) Diagnosis or auxiliary diagnosis of BCMA-positive diseases;
[0086] (D5) Diagnosis or auxiliary diagnosis of BCMA-positive disease staging;
[0087] (D6) Monitoring or assisting in monitoring the treatment efficacy of BCMA-positive diseases;
[0088] (D7) Treatment and / or prevention of BCMA-positive diseases.
[0089] Substance X or a composition comprising substance X, used as a developing agent, also falls within the scope of protection of the present invention. The substance X may be the single domain antibody and / or the polypeptide.
[0090] The present invention also provides the above-mentioned single-domain antibody or polypeptide as a reagent for binding to BCMA protein.
[0091] The present invention also provides the above-mentioned single domain antibody or polypeptide for use as an imaging agent.
[0092] The present invention also provides a method for detecting BCMA protein, comprising the step of detecting BCMA protein using the above-mentioned single domain antibody, immunoconjugate, probe molecule, reagent or kit.
[0093] The present invention also provides a method for diagnosing a BCMA-positive disease, comprising the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject to diagnose a BCMA-positive disease.
[0094] The present invention also provides a method for staging or assisting in staging a BCMA-positive disease, comprising the step of administering an effective dose of the above-mentioned immunoconjugate or probe molecule to a subject to staging or assisting in staging the BCMA-positive disease.
[0095] The use of substance X or a composition comprising substance X as a medicine also falls within the scope of protection of the present invention. The substance X may be the single domain antibody or the polypeptide.
[0096] In certain embodiments of the present invention, the drug may be a drug for treating a BCMA-positive disease or a drug for diagnosing a BCMA-positive disease.
[0097] The present invention also provides use of the above-mentioned single-domain antibodies, polypeptides, drugs or pharmaceutical compositions for preventing and / or treating BCMA-positive diseases.
[0098] The present invention also provides a method for treating and / or preventing BCMA-positive diseases, comprising the step of administering to a subject an effective dose of the above-mentioned single-domain antibody, polypeptide, drug or pharmaceutical composition to treat and / or prevent BCMA-positive diseases.
[0099] In the present invention, the subject is BCMA positive.
[0100] The medicine or pharmaceutical composition may further comprise an agent capable of killing tumor cells.
[0101] In the present invention, the preparation capable of killing tumor cells is at least one of chemical drugs, biological drugs, nano drugs, radioactive drugs, photothermal therapy drugs or photodynamic therapy drugs that can kill tumor cells; or, it is at least one of alkylating agents, antimetabolites, anti-tumor natural drugs, anti-tumor antibiotics, hormones, metal complexes or tumor radiotargeting markers.
[0102] In the present invention, the application, use or method may be aimed at the diagnosis and treatment of diseases.
[0103] In the present invention, the application, use or method may not be aimed at the diagnosis and treatment of a disease, and its direct purpose is only to obtain an intermediate result.
[0104] The present invention also provides a biomaterial, which may be any of the following:
[0105] (E1) a nucleic acid molecule encoding the above-mentioned single domain antibody,
[0106] (E2) an expression cassette containing the nucleic acid molecule described in (E1),
[0107] (E3) a recombinant vector containing the nucleic acid molecule described in (E1) and / or the expression cassette described in (E2),
[0108] (E4) a recombinant cell containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) and / or the recombinant vector described in (E3),
[0109] (E5) A recombinant microorganism containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) and / or the recombinant vector described in (E3).
[0110] In the above-mentioned biological materials, the nucleic acid molecule (E1) may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0111] In the present invention, the nucleic acid (E1) may be the DNA molecule described in (F1) or (F2) below, or RNA transcribed from the DNA molecule:
[0112] (F1) the nucleotide sequence of the coding strand is the DNA molecule shown in SEQ ID NO: 2;
[0113] (F2) has more than 70% identity with (F1) and encodes a DNA molecule of the above-mentioned single-domain antibody.
[0114] In the present invention, (E2) the expression cassette refers to a DNA capable of expressing the single-domain antibody in a host cell, and the DNA may include not only a promoter for initiating transcription of the single-domain antibody encoding gene, but also a terminator for terminating transcription of the single-domain antibody encoding gene.
[0115] In the present invention, the vector can be a plasmid, cosmid, phage or viral vector.
[0116] In some embodiments of the present invention, the recombinant vector can be a recombinant vector obtained by introducing the nucleic acid molecule (E1) into pET21b(+). Specifically, the structure of the recombinant vector can be such that the fragment between the restriction endonuclease NdeI and XhoI recognition sites of pET21b(+) (the small fragment between the NdeI and XhoI recognition sites) is replaced with a DNA molecule having the nucleotide sequence set forth in SEQ ID NO:2, while the rest of the nucleotide sequence of pET21b(+) remains unchanged.
[0117] In the present invention, the microorganism may be bacteria (such as Escherichia coli), yeast, algae or fungi.
[0118] In the present invention, the bacteria may be Escherichia coli.
[0119] In the above-mentioned biological materials, the cells (E4) can be either prokaryotic cells or eukaryotic cells.
[0120] In the above-mentioned biological materials, the cells may be cells derived from animals, plants or microorganisms.
[0121] In some embodiments of the present invention, the animal-derived cells may be isolated animal cells. In one embodiment of the present invention, the isolated animal cells include, but are not limited to, ExpiCHO-S™ cells, hamster ovary cells (CHO), 293F cells, 293E cells, 293-6E cells, and the like.
[0122] In some embodiments of the present invention, the recombinant cell is a recombinant Escherichia coli cell.
[0123] The present invention also provides a method for preparing the above-mentioned single-domain antibody, which may include the step of expressing the encoding gene of the above-mentioned single-domain antibody in a cell to obtain the single-domain antibody.
[0124] In the above method, the cells may be in vitro cells or non-human animal cells.
[0125] In some embodiments of the present invention, the cell is a recombinant Escherichia coli cell.
[0126] The single-domain antibodies provided by the present invention have high affinity and can be used to detect BCMA expression levels, diagnose BCMA-associated tumors, predict treatment efficacy, and implement targeted therapies. In particular, BCMA-specific molecular imaging probes prepared from these single-domain antibodies significantly enhance affinity, reduce nonspecific uptake in normal tissues, and improve imaging quality, thereby enabling noninvasive, accurate, and efficient detection of human BCMA expression. These probes are suitable for the diagnosis and treatment prediction of BCMA-associated tumors. After conjugation with appropriate radionuclides, these probes can also be used for precision therapy of BCMA-associated tumors.
[0127] Compared with the prior art, the present invention has the following advantages:
[0128] (1) The single-domain antibody of the present invention is the first specific single-domain antibody targeting BCMA. It has high selectivity, a small molecular weight (approximately 15 kDa), high biosafety, low immunogenicity, strong tumor penetration, and excellent pharmacokinetic properties. Single-domain antibodies are easy to design and modify, suitable as multifunctional targeting materials, and have broad application prospects.
[0129] (2) The single-domain antibody of the present invention can be combined with an imaging agent for clinical transformation and used as a molecular probe to detect BCMA expression in tumor cells in real time, monitor the efficacy of immunotherapy, and can be used for the prediction and companion diagnosis of BCMA immunotherapy. In addition, as a homing peptide, it can be combined with anticancer drugs to form a single-domain antibody-drug conjugate, which can be used for targeted and combined treatment of various tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0130] Figure 1 This is the electrophoresis diagram of the first round of PCR amplification of common antibody heavy chain and heavy chain antibody VHH genes.
[0131] Figure 2 This is the SDS-PAGE electrophoresis diagram of the recombinant single-domain antibody PFBC01 purified by magnetic beads.
[0132] Figure 3 This is a binding activity curve of the recombinant single-domain antibody PFBC01 of the present invention.
[0133] Figure 4 Flow cytometry comparison of the affinity of the recombinant single-domain antibody PFBC01 and other control single-domain antibodies for H929 cells; PE represents control cells in which only PE-NHS was added but no antibody was incubated; CK represents control cells in which no antibody was incubated.
[0134] Figure 5 This is the BLI result of the recombinant single-domain antibody PFBC01 of the present invention.
[0135] Figure 6 For probe 68 The stability of Ga-NOTA-PFBC01 in PBS and FBS solutions for 1 to 2 hours; where a is 68 The radiochemical purity of Ga-NOTA-PFBC01 single domain antibody labeled probe in FBS solution for 1 hour, b is 68 The radiochemical purity of Ga-NOTA-PFBC01 single domain antibody labeled probe in FBS solution for 2 hours, c is 68 The radiochemical purity of Ga-NOTA-PFBC01 single domain antibody labeled probe in PBS solution for 1 hour, d is 68 Radiochemical purity of Ga-NOTA-PFBC01 single domain antibody labeled probe in PBS solution for 2 hours.
[0136] Figure 7 H929 tumor-bearing mice were injected with the single domain antibody probe of the present invention. 68 PET / CT maximum intensity projection (MIP) images 1 to 2 hours after Ga-NOTA-PFBC01.
[0137] Figure 8 H929 tumor-bearing mice were injected with the single domain antibody probe of the present invention. 68 ROI uptake values and tumor-to-nontumor ratios 1 to 2 hours after Ga-NOTA-PFBC01; a is the ROI uptake value, and b is the tumor-to-nontumor ratio.
[0138] Figure 9 H929 tumor-bearing mice were injected with the single domain antibody probe of the present invention. 68 PET / CT maximum intensity projection (MIP) images and ROI uptake values of the Ga-NOTA-PFBC01 and blocking groups 1 hour after treatment; a is the PET / CT maximum intensity projection (MIP) image, and b is the ROI uptake value.
[0139] Figure 10 The single domain antibody probe of the present invention was injected into BCMA-positive H929 and BCMA-negative Bx-PC3 tumor-bearing mice. 68PET / CT maximum intensity projection (MIP) image and ROI uptake value of Ga-NOTA-PFBC01 for 1 hour; a is the PET / CT maximum intensity projection (MIP) image, and b is the ROI uptake value.
[0140] Figure 11 H929 tumor-bearing mice and blocking group mice were injected with the single domain antibody probe of the present invention. 68 Biodistribution of radioactive uptake of Ga-NOTA-PFBC0 in tumors and various organs after 11 hours.
[0141] Figure 12 Injecting the single domain antibody probe of the present invention into cynomolgus monkeys 68 Dynamic PET image and ROI dynamic uptake value of Ga-NOTA-PFBC01 for 1 hour; a is the dynamic PET image, and b is the ROI dynamic uptake value.
[0142] Figure 13 Injecting the single domain antibody probe of the present invention into cynomolgus monkeys 68 Static PET / CT images and ROI uptake values of Ga-NOTA-PFBC01 at 1 hour and 2 hours; a is the static PET / CT image, and b is the ROI uptake value.
[0143] Figure 14 The amino acid sequence, encoding gene, corresponding amino acid sequence of the recombinant single-domain antibody PFBC01 and CDR sequence of the single-domain antibody PFBC01 of the present invention are shown. DETAILED DESCRIPTION
[0144] 1. Terms used in the present invention:
[0145] Unless otherwise defined, technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art, unless otherwise defined. Generally speaking, terms related to cell and tissue culture, molecular biology, immunology, microbiology, genetics, transgenic cell production, protein chemistry and nucleic acid chemistry, and hybridization techniques described herein are well known in the art and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional practice.
[0146] Unless otherwise indicated, methods well known in the art and described in various general and more specific references that are cited and discussed herein.
[0147] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.
[0148] To facilitate understanding of the present disclosure, several terms and abbreviations used herein are defined as follows:
[0149] As used herein, "identity" refers to the identity of an amino acid sequence or nucleotide sequence. Amino acid sequence (or nucleotide sequence) identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, a search can be performed using blastp with the Expect value set to 10, all filters set to OFF, BLOSUM62 as the matrix, and the Gap existence cost, Perresidue gap cost, and Lambda ratio set to 11, 1, and 0.85 (default values), respectively. The identity of a pair of amino acid sequences can then be calculated to obtain the identity value (%).
[0150] Specifically, the consistency of more than 70% may be more than 75% consistency. Specifically, the consistency of more than 75% may be more than 80% consistency. Specifically, the consistency of more than 80% may be more than 85% consistency. Specifically, the consistency of more than 85% may be more than 90% consistency. Specifically, the consistency of more than 90% may be more than 91% consistency, more than 92% consistency, more than 93% consistency, more than 94% consistency, more than 95% consistency, more than 96% consistency, more than 97% consistency, more than 98% consistency, or more than 99% consistency. More specifically, the consistency of more than 70% may be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% consistency.
[0151] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.
[0152] The term "biological material" refers to any material that carries genetic information and is capable of self-replication or can be replicated in a biological system, such as genes, plasmids, microorganisms, animals and plants.
[0153] As used herein, the terms "protein" or "polypeptide" encompass all kinds of naturally occurring proteins and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, including but not limited to glycoproteins and all other types of modified proteins (e.g., proteins resulting from phosphorylation, acetylation, myristoylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, pegylation, biotinylation, etc.).
[0154] Unless otherwise indicated, the terms "nucleic acid," "nucleotide," and "polynucleotide" encompass both DNA and RNA.
[0155] Host cells can be prokaryotic cells, such as bacterial cells, more specifically, Escherichia coli cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.
[0156] The nucleic acid sequences encoding the single domain antibodies disclosed herein can be introduced into cells by "transfection," "transformation," or "transduction." As used herein, "transfection," "transformation," or "transduction" refers to the introduction of one or more exogenous polynucleotides into a host cell using physical or chemical methods.
[0157] The term "transformation" means introducing one or more exogenous polynucleotides into a bacterial cell that has the ability to transform, for example by using dimethyl sulfoxide, divalent cations (such as calcium) or polyethylene glycol. Many transformation techniques are known in the art and include heat shock and electric shock.
[0158] The terms "express" and "expression" mean allowing or causing the information in a gene or DNA sequence to be produced. For example, expression can take the form of producing a protein by activating cellular functions involved in the transcription and translation of the corresponding gene or DNA sequence. A DNA sequence is expressed in or by a cell to form an "expression product," such as a protein. The expression product itself, such as the resulting protein, can also be said to be "expressed" by the cell. An expression product can be characterized as being intracellular, extracellular, or transmembrane.
[0159] Single-domain antibodies can be prepared by recombinant methods. This typically involves cloning the single-domain antibody gene into a vector, transferring it into cells, and then isolating the relevant sequence from the proliferated host cells using conventional methods. The biomolecules (nucleic acids, proteins, etc.) referred to in the present invention include biomolecules in isolated form.
[0160] Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the present invention through chemical synthesis.
[0161] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.
[0162] The single-domain antibodies or polypeptides described herein can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If desired, the recombinant protein can be isolated and purified using various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out), centrifugation, osmotic shock, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques, as well as combinations of these methods.
[0163] The term "single-domain antibody" refers to a heavy chain single-domain antibody VHH (variable domain of heavy chain of heavy-chain antibody), which is a protein composed of the variable region of the antibody heavy chain.
[0164] The terms "single domain antibody," "nanobody," "VHH," or "sdAb" refer to a single antigen-binding polypeptide having three complementarity determining regions (CDRs). A basic single domain antibody has the following structure from N-terminus to C-terminus: FR1 CDR1 FR2 CDR2FR3 CDR3 FR4, wherein FR1 to FR4 refer to framework regions 1 to 4, respectively, and wherein CDR1 to CDR3 refer to complementarity determining regions 1 to 3.
[0165] The "complementarity determining region (CDR)" is the antigen binding site in an antibody. CDRs can be defined using various terms: (i) Complementarity determining regions (CDRs) are based on sequence variability. (ii) "Hypervariable region," "HVR," or "HV" refers to regions of an antibody variable domain whose structure is highly variable, as defined by Chothia and Lesk. The international ImMunoGeneTics (IMGT) database (http: / / www_imgt_org) provides standardized numbering and definitions of antigen binding sites. As used herein, the terms "CDR," "CDR1," "CDR2," and "CDR3" include CDRs defined by any of the methods described above, Kabat, Chothia, or IMGT, unless otherwise specifically stated in the specification. Framework regions (FWs) are adjacent to and located between the CDRs.
[0166] As used herein, the term "fragment" refers to a polypeptide that substantially retains the same biological function or activity as an antibody of the present invention. A polypeptide fragment of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, where such substituted amino acid residues may or may not be encoded by the genetic code; (ii) a polypeptide having a substituent group in one or more amino acid residues; (iii) a polypeptide formed by fusion of a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (iv) a polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence, a secretory sequence, a sequence used to purify the polypeptide, a proprotein sequence, or a fusion protein formed with a 6×His tag).
[0167] The term "antigen-binding fragment" refers to an antigen-binding fragment comprising a single-domain antibody of the present invention, which generally includes at least a portion of the antigen-binding region or variable region (e.g., one or more CDRs) of a parental antibody. Such antigen-binding fragments retain at least some of the binding specificity of the parental antibody. Typically, when activity is expressed on a molar basis, such antigen-binding fragments retain at least 10% of the parental binding activity. Specifically, such antigen-binding fragments retain at least 20%, 50%, 70%, 80%, 90%, 95%, or 100% or more of the parental antibody's binding affinity for the target.
[0168] In the present invention, the BCMA antibody or antigen-binding fragment thereof includes, but is not limited to, a recombinant single-domain antibody, a bivalent single-domain antibody, a multivalent single-domain antibody, a multispecific single-domain antibody, a single heavy-chain antibody, a Fab, a Fab' fragment, a F(ab')2 fragment, a minimum recognition unit (MRU), a Fv antibody, a single-chain antibody, or a heavy-chain antibody.
[0169] The term "bivalent single-domain antibody" or "multivalent single-domain antibody" refers to a fusion polypeptide formed by linking two or more single-domain antibodies. The single-domain antibodies in a "bivalent single-domain antibody" or "multivalent single-domain antibody" are formed by covalent or non-covalent linkage via a linker molecule, or by non-covalent linkage via mixing with a multimer.
[0170] The term "multispecific single-domain antibody" refers to a fusion polypeptide with multispecificity formed by linking the single-domain antibody with antigen-binding fragments specific for other antigens.
[0171] The term "multispecific" means that the antigen-binding protein (the BCMA single-domain antibody or antigen-binding fragment thereof) has two or more different antigen-binding specificities.
[0172] The term "Fab" stands for antigen-binding fragment (Fab), which is composed of a complete antibody light chain and the VH (heavy chain variable region) and CH1 (heavy chain constant region 1) domains of the heavy chain. It is a heterodimer formed by the antibody's heavy chain Fd and a complete light chain bound by disulfide bonds.
[0173] The term "Fab' fragment" contains an intact antibody light chain and a portion of an antibody heavy chain including the VH domain and the CH1 domain as well as the region between the CH1 and CH2 domains. Thus, an interchain disulfide bond can be formed between the two heavy chains of the two Fab' fragments to form an F(ab')2 molecule.
[0174] The term "F(ab')2 fragment" consists of two Fab' fragments held together by a disulfide bond between the two heavy chains.
[0175] The term "minimum recognition unit (MRU)" refers to a single CDR structure in the variable region, with a molecular mass of only about 1% of the complete antibody, which can bind to the corresponding antigen.
[0176] The term "Fv antibody" refers to a protein consisting only of the heavy chain variable region and the light chain variable region of an antibody, which are linked by a non-covalent bond.
[0177] The term "single-chain antibody" (ScFv) refers to a protein composed of the heavy chain variable region and the light chain variable region of an antibody connected by a short peptide.
[0178] As used herein, the terms "specifically bind," "specifically recognize," or "specific for" refer to a measurable and reproducible interaction, such as binding between a target and a single domain antibody, that determines the presence of the target in the presence of a heterogeneous population of molecules, including biomolecules.
[0179] The term "specificity" refers to the selective recognition of a specific epitope of an antigen by a single domain antibody.
[0180] Specific binding refers to the ability of one molecule to bind to another molecule with a significantly higher affinity than its affinity for any cross-reactive antigens or off-target antigens (collectively referred to as non-target antigens). The affinity is determined using experimental techniques such as surface plasmon resonance (SPR), fluorescence-activated cell sorting (FACS) analysis, kinetic exclusion assay (KinExA), isothermal titration calorimetry (ITC), radioimmunoassay (RIA), and enzyme-linked immunosorbent assay (ELISA).
[0181] The terms "tumor" and "cancer" are used interchangeably herein to include both solid and liquid tumors.
[0182] The terms "cancer" and "cancerous" refer to the physiological condition in mammals characterized by uncontrolled cell growth.
[0183] The term "tumor" refers to the growth and proliferation of all neoplastic cells, whether malignant or benign, and all precancerous and cancerous cells and tissues. When referred to herein, the terms "cancer," "cancerous," and "tumor" are not mutually exclusive.
[0184] As used herein, the term "label" refers to a compound or composition that is conjugated or fused, directly or indirectly, to a reagent (e.g., a single domain antibody) and facilitates detection of the conjugated or fused reagent. The label itself can be detectable (e.g., a radioisotope label or a fluorescent label), or, in the case of an enzymatic label, the label can catalyze a chemical change in a substrate compound or composition that becomes detectable. The term is intended to encompass direct labeling of a probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of a probe or antibody by reaction with another directly labeled reagent. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin so that it can be detected using fluorescently labeled streptavidin.
[0185] The term "treat" or "treatment" refers to a therapeutic treatment wherein the purpose is to slow down or alleviate an undesirable physiological change or disease, or to provide a beneficial or desired clinical outcome during treatment. Beneficial or desired clinical outcomes include alleviation of symptoms, reduction in disease severity, stabilization of the disease state (i.e., cessation of worsening), delay or slowing of disease progression, improvement or alleviation of the disease state, and / or relief (whether partial relief or complete relief, and whether detectable or undetectable) of the disease state. "Treatment" can also mean prolonged survival compared to the expected survival of the subject without treatment. Those subjects in need of treatment include those subjects who have already suffered from an undesirable physiological change or disease and those subjects who are prone to suffering from a physiological change or disease. Treatment can involve a therapeutic agent, also referred to herein as a "medicament," which can be intended to help achieve the beneficial or desired clinical outcome of interest through its action. Therapeutic agents or drugs can be administered to a subject by many routes, including at least intravenous and oral routes. The term "intravenous," as used in connection with the administration of a therapeutic agent or drug, refers to administering the therapeutic agent or drug in one or more intravenous regions. The term "oral," in reference to the administration of a therapeutic agent or drug, refers to the administration of the therapeutic agent or drug via the oral passage, such as the mouth.
[0186] As used herein, a "subject" includes a human being who is being treated for a disease or prevented for a disease. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits. The mammal can be of the order Carnivora, including felines (cats) and canines (dogs). The mammal can be of the order Artiodactyla, including bovines (cows) and porcines (pigs), or of the order Perssodactyla, including equines (horses). The mammal can be of the order Primate, the order Ceboid, or the order Simoid (monkeys), or a humanoid.
[0187] The term "effective," as applied to dosage or amount, refers to an amount of a compound or pharmaceutical composition sufficient to produce the desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, an effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the specific drug or drugs employed, the mode of administration, and the like.
[0188] In the present invention, the "BCMA-positive disease" may be a disease with a significantly increased BCMA expression level, and BCMA can be used as a marker. Existing studies have found that BCMA-positive diseases include B cell tumors, B cell malignancies, plasma cell malignancies, and autoimmune diseases. Exemplary, the BCMA-positive disease may be multiple myeloma (MM), non-Hodgkin's lymphoma (NHL), including Burkitt's lymphoma (BL), B chronic lymphocytic leukemia (B-CLL), systemic lupus erythematosus (SLE), B-type and T-type acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), diffuse large B cell lymphoma, chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and leukemia. L), follicular lymphoma, Waldenstrom's macroglobulinemia, mantle cell lymphoma, Hodgkin lymphoma (HL), plasma cell myeloma, precursor B-cell lymphoblastic leukemia / lymphoma, plasmacytoma, giant cell myeloma, plasma cell myeloma, heavy chain myeloma, light chain or Bence-Jones myeloma, lymphomatoid granulomatosis, post-transplant lymphoproliferative disorder, immunoregulatory disorders, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, antiphospholipid syndrome, Chagas disease, Graves' disease, Wegener's granulomatosis, polyarteritis nodosa, Sjögren's syndrome, pemphigus vulgaris, scleroderma, multiple sclerosis, antiphospholipid syndrome, ANCA-associated vasculitis, Goodpasture's disease, Kawasaki disease, autoimmune hemolytic anemia, and rapidly progressive anemic glomerulonephritis. Primary or immune cell-associated amyloidosis, or monoclonal gammopathy of undetermined significance.
[0189] The phrase "pharmaceutically acceptable," as used in connection with the compositions described herein, refers to the molecular entities and other ingredients of such compositions that are physiologically tolerable and typically do not produce adverse reactions when administered to a mammal (e.g., a human). Preferably, the term "pharmaceutically acceptable" means listed by a recognized pharmacopoeia for use in mammals, and more particularly in humans.
[0190] For example, the term "pharmaceutically acceptable carrier" includes, but is not limited to, water-soluble carrier materials (such as polyethylene glycol, polyvinyl pyrrolidone, and organic acids), poorly soluble carrier materials (such as ethyl cellulose and cholesterol stearate), and enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose). These materials can be used to formulate a variety of dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal formulations, buccal tablets, suppositories, and lyophilized powder injections. These formulations can include conventional preparations, sustained-release preparations, controlled-release preparations, and various microparticle delivery systems. To formulate unit dosage forms into tablets, a wide variety of carriers known in the art can be used. Examples of carriers include diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch slurry, dextrin, syrup, honey, glucose solution, acacia slurry, gelatin slurry, sodium carboxymethylcellulose, shellac, methylcellulose, potassium phosphate, polyvinyl pyrrolidone, etc.; disintegrants. , such as dried starch, alginate, agar powder, brown seaweed starch, sodium bicarbonate with citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid esters, sodium lauryl sulfate, methylcellulose, ethylcellulose, etc.; disintegration inhibitors, such as sucrose, tristearin, cocoa butter, hydrogenated oil, etc.; absorption enhancers, such as quaternary ammonium salts, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. Tablets can also be further prepared as coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or bilayer tablets and multilayer tablets. To prepare the unit dosage form into a pill, a wide variety of carriers known in the art can be used. Examples of carriers include diluents and absorbents such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oils, polyvinylpyrrolidone, kaolin, and talc; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste, or flour paste; and disintegrants such as agar powder, dried starch, alginates, sodium lauryl sulfate, methylcellulose, and ethylcellulose. To prepare unit dosage forms as suppositories, a wide variety of carriers known in the art can be used. Examples of carriers include polyethylene glycol, lecithin, cocoa butter, higher alcohols, higher alcohol esters, gelatin, and semi-synthetic glycerides. To prepare unit dosage forms as injectable preparations, such as solutions, emulsions, lyophilized powder injections, and suspensions, all diluents commonly used in the art can be used, including water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene isostearyl alcohol, and polyoxyethylene sorbitan fatty acid esters.In addition, in order to prepare an isotonic injection, an appropriate amount of sodium chloride, glucose or glycerol may be added to the injection preparation. In addition, conventional cosolvents, buffers, pH adjusters, etc. may also be added. In addition, if necessary, colorants, preservatives, fragrances, flavorings, sweeteners or other materials may also be added to the pharmaceutical preparation.
[0191] 2. Example
[0192] This invention uses BCMA protein as the targeting group of radiopharmaceuticals to explore 68 The diagnostic efficacy of the Ga-BCMA probe in multiple myeloma aims to provide new methods and means for the early diagnosis, accurate staging, recurrence judgment, treatment decision-making and prognosis judgment of multiple myeloma, and provide a scientific basis for the precise treatment of related diseases.
[0193] This study constructed a library of anti-BCMA antigen-specific single-domain antibodies based on alpaca immunization, RNA extraction, polymerase chain reaction (PCR), and ligation transformation. A series of anti-BCMA single-domain antibodies were initially obtained through plasmid expression, antibody expression, and purification. Subsequently, high-affinity BCMA single-domain antibodies were screened using an enzyme-linked immunosorbent assay (ELISA).
[0194] After extensive experimental verification and screening, the present invention ultimately obtained the single-domain antibody PFBC01 targeting BCMA. This single-domain antibody has specific affinity for the BCMA protein and selectively binds to tumor cells with high BCMA expression. The present invention also provides products derived from this single-domain antibody that specifically bind to BCMA, as well as the use of the single-domain antibody and its derivatives in tumor treatment, diagnosis, and imaging.
[0195] Purified recombinant single-domain antibody PFBC01 (1 mg / mL) was reacted with a chelating agent (PE-NHS or NOTA-NHS-ester) at a molar ratio of 1:5-1:10 in carbonate buffer at pH 9.2 for 2 hours at 25°C. Free chelating agent was then removed using a PD-10 desalting column, and the PE- or NOTA-labeled recombinant single-domain antibody PFBC01 was collected, aliquoted, and stored at 4°C. In specific embodiments of the present invention, the molar ratio of recombinant single-domain antibody PFBC01 to chelating agent was 1:10.
[0196] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0197] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0198] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.
[0199] The data in the following examples were processed using GraphPad Prism statistical software. The experimental results are expressed as mean ± standard deviation and analyzed using t-test. *, **, ***, and **** indicate p < 0.05 (significant), p < 0.01 (very significant), p < 0.001 (extremely significant), and p < 0.0001 (highly significant), respectively.
[0200] Example 1 Construction of anti-BCMA antigen-specific single domain antibody library
[0201] 1. BCMA antigen immunization of alpacas
[0202] Healthy adult alpacas were injected subcutaneously with 2 mg of BCMA antigen (BCM-HM217; Recombinant Human BCMA Protein (ECD, hFc Tag)) at multiple sites on the back of the neck. An equal volume of Freund's adjuvant was added to the antigen. Five immunizations were performed, with 14-day intervals between immunizations. After the third immunization, serum was collected and the antigen titer was determined by ELISA. When the titer reached 10,000-fold or higher, 50 mL of whole blood was collected, and PBMCs were isolated. Trizol (RNA extraction reagent) was added, mixed thoroughly, and stored at -80°C until further use.
[0203] 2. RNA Extraction
[0204] Take 1 mL of isolated PBMCs, add 0.2 mL of chloroform, and vortex to mix. Add 200 μL of chloroform, vortex for 15 seconds, and let stand at room temperature for 3 minutes. Centrifuge at 12,000 rpm at 4°C for 15 minutes. Carefully remove the centrifuge tube, aspirate the supernatant, transfer it to a new 1.5 mL EP tube, add an equal volume of isopropanol, mix thoroughly by inverting, and let it stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm at 4°C for 10 minutes. Carefully discard the supernatant with a pipette tip. Add 75% ethanol along the tube wall, carefully blowing up the pellet (or gently flicking the bottom of the tube). Centrifuge at 7,500 rpm at 4°C for 5 minutes. Carefully discard the supernatant, spin the tube for another 1 minute, and aspirate the supernatant. Incubate the tube uncovered at room temperature for 10 to 15 minutes until the ethanol evaporates completely. Add 30 μL of RNase-free water to dissolve the RNA. Extracted RNA is easily degraded, so it needs to be reverse transcribed into cDNA promptly.
[0205] 3. Obtain the Anti-BCMA heavy chain antibody variable region - VHH gene fragment (single domain antibody gene)
[0206] Reverse transcribe the extracted RNA into cDNA according to the instructions of the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Cat. No. 6210A, TAKARA). Prepare the following reaction mixture in a centrifuge tube: 1 μL of Random 6-mers (50 μM), 1 μL of dNTP Mixture (10 mM each), template RNA (≤ 5 μg), and RNase-free ddH2O up to 10 μL. Incubate the mixture at 65°C for 5 minutes and then quickly cool on ice. Prepare the following reverse transcription reaction mixture in the same centrifuge tube, totaling 20 μL. Add 10 μL of the denatured reaction mixture, 4 μL of 5× PrimeScript II Buffer, 0.5 μL of RNase Inhibitor (40 U / μL), and 1 μL of PrimeScript II RTase (200 U / μL), and add RNase-free ddH2O to 20 μL. The reverse transcription reaction was performed under the following conditions: 30°C for 10 min, 42°C for 30 to 60 min, 95°C for 5 min, and then cooled on ice.
[0207] Using cDNA as a template, two sets of primers were used to PCR amplify the heavy chain VHH gene fragments. In the first PCR amplification, fragments larger than 750bp were common heavy chain gene fragments, and fragments between 750 and 500bp were single domain antibody gene fragments. The heavy chain antibody VHH gene fragments (single domain antibody genes) were recovered from the gel and used as a template to amplify the VHH target gene (up to 500bp) using VHH-specific primers.
[0208]
[0209] Note: In primer YT1BN, nucleotide symbols and definitions follow the ST.26 standard. S represents C or G, M represents A or C, K represents G or T, and R represents A or G.
[0210] The first round of PCR was performed in two groups: the upstream primer for the common antibody heavy chain gene was YT-1, and the downstream primer was YT1BN; the upstream primer for the VHH gene was YT-2, and the downstream primer was YT1BN. The concentration of each primer was 10 pmol. The PCR amplification reaction system consisted of 5 μL of 10× PCR buffer, 5 μL of dNTPs, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 3.5 μL of template (cDNA), 0.5 μL of Blend Taq enzyme, and 33 μL of ddH2O. PCR conditions were: initial denaturation at 94°C for 2 min; 25 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min; and 4°C for 10 min.
[0211] The second-round PCR amplification system used YTV8 and YTV9 as the upstream and downstream primers, respectively, at a concentration of 10 pmol each. The second-round PCR amplification system consisted of 5 μL of 10× PCR buffer, 5 μL of dNTPs, 1.5 μL of the upstream primer (YTV8), 1.5 μL of the downstream primer (YTV9), 3.5 μL of template (recycled product from the first round), 0.5 μL of Blend Taq enzyme, and 33 μL of ddH2O. PCR conditions were: initial denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min; followed by 15 cycles of 10 min at 4°C.
[0212] The electrophoresis diagram of the first round of PCR amplification of common antibody heavy chain and heavy chain antibody VHH gene is as follows Figure 1 As shown. Markers are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. Lanes 1 and 2 are PCR products obtained using different primer combinations. Lane 1 contains a common antibody heavy chain gene amplification fragment greater than 750bp and a heavy chain antibody gene amplification fragment less than 750bp. Lane 2 contains only a heavy chain antibody VHH gene amplification fragment of approximately 500bp.
[0213] 4. Connection conversion
[0214] Digest the PCR product and pHEN6 vector with the restriction endonuclease SfiI at 37°C overnight. Purify the fragment using a universal recovery kit. Mix the fragment and vector in a 3:1 ratio, add T4 DNA ligase, and briefly centrifuge. Ligate overnight in a 16°C thermostated metal bath. Purify the ligation product using a universal recovery kit. Electrotransform the VHH fragment and pHEN6 vector ligation product into TG1 competent cells, plate, and verify antibody insertion efficiency by colony PCR. Plate the electrotransformed bacterial suspension onto LB / Amp plates and incubate at 37°C for 14 hours. Count the plates the next day and calculate the library size. Scrape the colonies using 2 mL / plate of 2YT medium. Mix all colonies thoroughly and add glycerol to create a 20% glycerol stock. Store 1 mL / tube at -80°C.
[0215] 5. Preparation of Anti-BCMA VHH Phage Library (Single Domain Antibody Library)
[0216] Add 1 mL of the seed bacterial library to 200 mL of 2YT medium (containing a final concentration of 50 μg / mL Amp and 1% glucose) and incubate at 37°C until the OD600 reaches 0.8-1. Then, add M13KO7 helper phage at a ratio of 1:20 for infection. After 1 hour of incubation, replace with fresh 2YT medium (containing a final concentration of 100 μg / mL Amp and 50 μg / mL Kana) and incubate at 37°C with shaking overnight. Collect the bacterial suspension into a sterile centrifuge tube, collect the supernatant by centrifugation, and add 1 / 5 volume of 20% PEG-2.5M NaCl. Mix thoroughly, incubate on ice for 1 hour, and centrifuge at 12,000 rpm for 30 minutes. Discard the supernatant and dissolve the pellet in 3 mL of sterile 15% glycerol-PBS. Store the phage library at -80°C.
[0217] Example 2 Screening, expression and purification of anti-BCMA single domain antibodies
[0218] 1. Screening of BCMA-specific single-domain antibodies
[0219] Coat BCMA protein onto immunotubes with coating solution for the first round of screening. Discard the coating solution and block the entire tube with blocking solution. After 1 hour at room temperature, add the phage solution. Wash the tube 20 times with PBST and then five times with PBS. Elute with 500 μL of elution solution and neutralize with neutralization solution. Titer 2 μL of the eluted phage and use the remaining phage solution for expansion.
[0220] Titer determination facilitates the next round of screening. The screening results are detailed in Table 2. Using the coated BCMA protein as the target, three rounds of screening were performed from the total phage antibody library using solid-phase screening. The titers of eluted phages were measured in each round. As shown in Table 2, with increasing rounds of screening, the coating concentration gradually decreased, but the titers of eluted phages increased, indicating that BCMA-specific phages were enriched.
[0221] 2. Screening of Anti-BCMA Single Domain Antibody Phage Monoclones
[0222] BCMA antigen was coated for ELISA assays. 100 μL of BCMA antigen protein was coated per well at a concentration of 1 μg / mL and incubated overnight at 4°C. After two to three rounds of solid-phase phage selection, single clones were randomly selected and cultured in deep-well plates. Helper phage was added for infection and overnight incubation. The supernatant from the overnight culture was used for ELISA assays using Anti-M13-HRP as a secondary antibody and incubated at 37°C for 1 hour. After washing, TMB was added for color development. The reaction was terminated with 2M H₂SO₄, and the OD of the samples was measured at 450 nm using a microplate reader. Anti-BCMA-positive wells were selected and DNA sequencing was performed to identify the gene sequences of the anti-BCMA single-domain antibody clones. A series of single-domain antibody gene sequences were obtained. By analyzing and typing the amino acid sequences encoded by the sequences, single-domain antibodies of various genotypes were obtained for further expression and screening of highly specific and active single-domain antibodies.
[0223] 3. Construction of Anti-BCMA Single Domain Antibody Expression Plasmid
[0224] Using 5-nano-NdeI and 3-nano-XhoI as primers and the positive monoclonal product from phage screening as a template, the specific Anti-BCMA single-domain antibody gene was amplified by PCR. The PCR product and pET-21b(+) vector (Ubao Bio, VT1198) were treated with restriction endonucleases NdeI and XhoI, respectively. The fragments were ligated with T4 DNA ligase and transformed into BL21(DE3) competent cells to obtain a plasmid that can efficiently express the single-domain antibody in Escherichia coli.
[0225] The sequences of primers 5-nano-NdeI and 3-nano-XhoI (5' to 3') are as follows:
[0226] 5-nano-NdeI:CATATGCAGGTTCAGCTGGTTGA (SEQ ID NO:9):
[0227] 3-nano-XhoI: CTCGAGTGAGGAGACGGTGACCTGGGT (SEQ ID NO: 10).
[0228] 4. Expression and purification of anti-BCMA single domain antibodies
[0229] Streak the strain containing the target gene onto a culture plate containing ampicillin sodium and incubate at 37°C overnight. Select a single clone and inoculate it into 3 mL of 2YT medium containing ampicillin sodium and incubate overnight. Transfer the clone into 100 mL of 2YT medium containing ampicillin sodium and incubate at 37°C in a shaker at 220 rpm until the OD 600nm When the value reaches 0.6 to 1.0, add 0.5 to 1 M IPTG, culture in a shaker at 20 degrees Celsius and 200 rpm overnight. Centrifuge at 6500 rpm for 20 minutes to collect the bacteria. Add 0.05 M Tris buffer to wash the bacteria twice, add 20 mL 0.05 M Tris buffer, place in an ultrasonic disruptor, ultrasonicate in an ice bath for 15 minutes, and collect the supernatant by centrifugation. Single-domain antibody protein with a purity of more than 90% was obtained by separation using Ni+ ion affinity chromatography magnetic beads (BeaverBeadsTM His-tagProtein Purification, Suzhou Beaver Biomedical Engineering Co., Ltd.), and the protein was collected and dialyzed to replace the buffer. The results are shown in SDS-PAGE electrophoresis. Figure 2 , the markers in the figure are 180kDa, 135kDa, 100kDa, 75kDa, 63kDa, 48kDa, 35kDa, 25kDa, 17kDa and 11kDa.
[0230] Finally, the single domain antibody numbered PFBC01, its amino acid sequence, the recombinant single domain antibody with His tag corresponding to the encoding gene, and the CDR sequence were screened. Figure 14 shown.
[0231] Given a known sequence, the preparation and screening of single-domain antibodies is routine in the art. Using the PFBC01 single-domain antibody as an example, the following illustrative example illustrates the following: The DNA molecule represented by SEQ ID NO:2 was used to replace the fragment between the NdeI and XhoI restriction endonuclease recognition sites (the small fragment between the NdeI and XhoI recognition sites) of pET-21b(+), while maintaining the remaining nucleotide sequences of pET-21b(+). This yielded the recombinant vector pET21b-PFBC01, which expresses the recombinant single-domain antibody PFBC01. pET21b-PFBC01 was then transformed into competent E. coli BL21(DE3) cells to obtain recombinant E. coli cells that efficiently expressed the recombinant single-domain antibody PFBC01. The amino acid sequence of the recombinant single-domain antibody PFBC01 expressed by the recombinant Escherichia coli is SEQ ID NO: 3, wherein position 1 of SEQ ID NO: 3 is the amino acid M encoded by the sequence ATG in pET-21b (+), positions 2 to 124 are the amino acid sequence of the single-domain antibody PFBC01, and positions 125 to 130 are a 6×His tag.
[0232] The amino acid sequence shown at positions 2 to 124 of SEQ ID NO:3 is identical to that of SEQ ID NO:1.
[0233]
[0234] Example 3 Detection of the affinity of recombinant single-domain antibody PFBC01 to human BCMA protein by enzyme-linked immunosorbent assay (ELISA)
[0235] BCMA-His antigen (Sino Biological, 10620-H08H) was diluted to 1 µg / mL in 0.05M NaHCO₃ (pH 9.6) coating buffer, at a concentration of 100 µL / well, and coated overnight at 4°C. The 96-well plate was blocked with PBST containing 4% nonfat dry milk and incubated at 37°C for 1 hour. Diluted recombinant single-domain antibody PFBC01 was added at a starting concentration of 50 µg / mL and diluted 5-fold over a series of seven dilutions, incubating at 37°C for 1 hour. The plate was washed three times with 0.05% PBST. Anti-VHH-antibody-HRP secondary antibody was added at a 1:10,000 dilution at a concentration of 100 µL / well, and incubated at 37°C for 1 hour. The plate was washed three times with 0.05% PBST. TMB (100 µL) was added and the plate was allowed to develop color for 15 minutes at room temperature, protected from light. The reaction was terminated by adding 50 µL of 2M H₂SO₄. The OD value of the sample at a wavelength of 450 nm was measured using an enzyme-labeled instrument. The results are shown in Table 3 and Figure 3 The results showed that the recombinant single-domain antibody PFBC01 has good specificity with BCMA protein.
[0236]
[0237] Example 4 Flow cytometry identification of the affinity of PFBC01 single domain antibody to BCMA protein
[0238] In this experiment, human myeloma H929 cells (ATCC, CRL-3580) were selected as positive cells and cultured in RPMI 1640 medium supplemented with 10% FBS. Purified recombinant single-domain antibody PFBC01 (1 mg / mL) was reacted with PE-NHS (AATBioquest, 2613) at a molar ratio of 1:10 in carbonate buffer (pH 9.2) for 2 hours (25°C) in the dark. Free dye was then removed using a PD-10 desalting column, and the PE-labeled recombinant single-domain antibody PFBC01 was collected, aliquoted, and stored at 4°C in the dark. H929 cells were incubated with 20 µg / mL of PE-labeled recombinant single-domain antibody PFBC01 on ice for 20 minutes, washed three times with PBS, and resuspended in 500 μL of PBS. Fluorescence intensity was analyzed using a FACS Calibur analyzer (BD Biosciences) and FlowJo software (Tree Star). 3G1-2 and 3G1-1 were used as positive controls. The detection method of the positive controls was similar to that of the PE-labeled recombinant single-domain antibody PFBC01. The only difference was that the recombinant single-domain antibody PFBC01 was replaced with 3G1-2 or 3G1-1.
[0239] The results are as follows Figure 4 The recombinant single-domain antibody PFBC01 produced significant displacement with H929 cells, while the displacement degrees of other alternative single-domain antibodies were lower than that of the recombinant single-domain antibody PFBC01, indicating that the recombinant single-domain antibody PFBC01 had good binding ability and specificity with H929 cells.
[0240] Example 5: Analysis of the affinity of PFBC01 single-domain antibody to BCMA protein using biofilm interferometry (BLI)
[0241] The affinity of the recombinant single-domain antibody PFBC01 for BCMA protein was determined using an Octet RED96 (Sartorius) biofilm interferometer. The HIS1K biosensor was immersed in PBS for 10 minutes. After capturing the single-domain antibody, the sensor was immersed in wells containing 100, 50, 25, 12.5, 6.25, 3.125, and 1.563 nM BCMA protein for 2 minutes. Dissociation was performed in PBS. The data were then analyzed using Octet Analysis Studio 13.0 software. The results are shown in Figure 2. Figure 5 The recombinant single-domain antibody PFBC01 has a high affinity for BCMA protein, with a KD value of less than 1.0E-12.
[0242] Example 6 Radioactive Probe Labeling and Stability Determination of PFBC01 Single Domain Antibody
[0243] All animal experiments were conducted according to protocols approved by the Institutional Animal Care and Use Committee of Peking University First Hospital. A subcutaneous multiple myeloma tumor model was established using 4-6 week-old female NCG immunodeficient mice (Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.). Tumor-bearing mice were prepared using conventional techniques in the art. An exemplary preparation method is provided as follows: Positive H929 cells (ATCC, CRL-3580) were plated at 1×10 7 A suspension of 100 μL of Matrigel was subcutaneously injected into the right axilla of mice. Tumor volume was monitored regularly, and in vivo imaging and biodistribution experiments were performed when tumors reached 1 cm³. Negative control Bx-PC3 mice were prepared using the same method as the multiple myeloma subcutaneous tumor model, except that Bx-PC3 cells (ATCC, CRL-1687) were used instead of H929 cells.
[0244] Purified recombinant single-domain antibody PFBC01 (1 mg / mL) was reacted with NOTA-NHS-ester (Macrocyclics, B-601) at a molar ratio of 1:10 in carbonate buffer (pH 9.2) for 2 hours at 25°C. The free chelator was then removed using a PD-10 desalting column, and the NOTA-labeled recombinant single-domain antibody PFBC01 was collected and stored in aliquots at 4°C.
[0245] Elute with 0.05M high-purity hydrochloric acid 68 Ge- 68 GaGe generator (ITM Isotope Technologies, Germany) was used to obtain 4 mL 68 GaCl3 eluent, take 1 mL of the one with the highest specific activity 68 GaCl3 solution, and add 80 μL of 2 M sodium acetate to make the solution pH reach 4-4.5, then add the recombinant single domain antibody PFBC01 coupled with NOTA (a chelating agent), and place the mixed solution on an oscillator at 37°C for 15 minutes, then filter the solution through a PD10 column to obtain 68 Ga-NOTA-PFBC01 single domain antibody labeled probe.
[0246] The radiochemical purity of the labeled product and its in vitro stability in PBS (Gibco, 10010023) and FBS (Gibco, 10270106) solutions were determined by thin layer chromatography (TLC) technology. First, draw a line on the chromatography paper 1 cm from the end with a pencil, and gently place the sample (probe incubated in PBS / FBS) on the line. Develop the chromatography paper in a developing agent (EDTA: sodium citrate = 9:1), and after drying, place it in a MINI-SCAN thin layer chromatograph (Eckert & Ziegler). Align the marked point with the 0 scale line of the chromatograph, and start FLOW-COUNT (Eckert & Ziegler) to detect the radioactivity distribution (scanning time 1 min, energy range 450-750 keV). It can be measured 68 The radiochemical purity of Ga-NOTA-PFBC01 single domain antibody labeled probe was >95% after 2 hours in PBS and FBS solution (see Figure 6 ).
[0247] Example 7 PET Imaging and Biodistribution Analysis of PFBC01 Single Domain Antibody Probe in Tumor-Bearing Mouse Model
[0248] When the tumor volume reached the experimental requirement, 11.1 MBq of 68 Ga-NOTA-PFBC01 was then anesthetized under isoflurane atmosphere (2% isoflurane-30% oxygen / air) at 1 h and 2 h, respectively, and imaged using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The imaging images are shown in Figure 2. Figure 7 The results showed that in the BCMA-positive H929 model, 68 The tumor showed high radioactivity concentration 1 hour after Ga-NOTA-PFBC01 injection, and maintained a high uptake rate at 2 hours; the probe was significantly taken up in the kidney, proving that the probe was mainly excreted through the kidney.
[0249] The software was used to draw regions of interest (ROIs) and quantitatively analyze the radioactive uptake in tumors and major organs at each time point. The results were as follows: Figure 8 As shown in Figure a, the radioactivity uptake is expressed as %ID / ccMax. The tumor uptake of H929 at 1 hour was 3.21%ID / ccMax, and at 2 hours it was 3.12%ID / ccMax. The ratios of tumor to muscle and blood were calculated based on the ROI uptake values. The results are shown in Figure 3. Figure 8As shown in Figure b, the tumor-to-muscle ratio was 9.13 at 1 hour and reached a higher value of 15.93 at 2 hours. The tumor-to-blood ratio was 3.83 at 1 hour and also reached a higher value of 5.10 at 2 hours. These results confirm that the probe exhibits excellent tumor targeting 1-2 hours after injection, with high tumor uptake and an ideal target-to-blood ratio, indicating that the probe has excellent in vivo metabolic kinetics.
[0250] Blocking experiment: 11.1 MBq of 68 The mice were co-injected with 1 mg of recombinant single-domain antibody PFBC01 at the same time as Ga-NOTA-PFBC01. After 1 h, the mice were anesthetized under an isoflurane atmosphere (2% isoflurane-30% oxygen / air) and imaged using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The images are shown in Figure 2. Figure 9 As shown in a. The results showed that in the BCMA-positive H929 model ( Figure 9 In H929), 68 One hour after the injection of Ga-NOTA-PFBC01, the tumor showed a higher radioactivity concentration, while the blocking group ( Figure 9 The H929-block in the middle maintained a low uptake rate. The region of interest (ROI) was drawn by software and the radioactive uptake in the tumor and major organs at each time point was quantitatively analyzed. The results are as follows Figure 9 As shown in middle b. The tumor uptake of H929 in the non-blocking group was 3.21%ID / ccMax at 1 hour, while the uptake of H929 in the blocking group was only 1.60%ID / ccMax ( P <0.05), demonstrating that the probe can specifically bind to BCMA.
[0251] Negative control Bx-PC3 tumor-bearing mice were injected with 11.1 MBq of 68 Ga-NOTA-PFBC01 was then anesthetized under an isoflurane atmosphere (2% isoflurane-30% oxygen / air) for 1 h and imaged using micro-PET / CT (Beijing Yongxin Medical Equipment Co., Ltd.). The imaging images are shown in Figure 2. Figure 10 As shown in a. It can be observed that 68 The uptake of Ga-NOTA-PFBC01 in H929 tumors was significantly higher than that in Bx-PC3. The region of interest (ROI) was drawn by software and the radioactive uptake in tumors and major organs at each time point was quantitatively analyzed. The results are as follows Figure 10 As shown in middle b. The tumor uptake of H929 was 3.21%ID / ccMax at 1 hour, while the uptake of the control group Bx-PC3 was only 0.51%ID / ccMax ( P<0.05), further confirming the specific targeting ability of this probe to BCMA.
[0252] H929 tumor-bearing mice were euthanized 1 hour after probe injection for biodistribution analysis. Organs including blood, heart, lungs, liver, kidneys, spleen, bladder, stomach, bones, muscles, small intestine, brain, and tumors were collected and weighed, and counted using a gamma counter (Hidex). Radioactivity uptake results are expressed as percentage per gram of tissue (%ID / g, mean ± SD). Figure 11 As shown, it is consistent with the PET imaging results, showing 68 The uptake of Ga-NOTA-PFBC01 in H929 tumor was significantly higher than that in the blocking group ( P <0.05). These results indicate that the PFBC01 single-domain antibody probe of the present invention has the ability to rapidly target BCMA and achieve high-sensitivity imaging of tiny tumors.
[0253] Example 8 68 Pharmacokinetics of Ga-NOTA-PFBC01 in healthy cynomolgus monkeys
[0254] Healthy male adult cynomolgus monkeys weighing 3 kg were used. All animals were screened for health before the experiment to ensure that they had no underlying diseases that could affect pharmacokinetics. Before the experiment, all experimental animals fasted for 6 hours before PET / CT scanning to reduce the impact of basal metabolism. Each cynomolgus monkey was injected intravenously 68Ga-NOTA-PFBC01 was administered at a dose of 3.7 MBq / kg. PET / CT scans (uMI780; United Imaging Health Care) were performed immediately after infusion, covering the head and abdomen. Scanning was continuous for 60 minutes. During imaging, low-dose CT (tube voltage 120 kV, tube current 100 mA, matrix size 512 × 512) was used for attenuation correction and anatomical reference. PET scans were performed using four bed positions, each with a matrix size of 192 × 192, at a scan rate of 1.5 minutes per bed. All PET data were reconstructed using the ordered subset expectation maximization (OSEM) algorithm with reconstruction parameters of 2 iterations and 20 subsets. Reconstructed images were coregistered with the anatomical reference image to ensure analytical accuracy. Image post-processing was performed on a dedicated workstation (uXceed, version R001; United Imaging Health Care) to ensure standardized and consistent data processing. Images were acquired at time points including 1, 2, 5, 10, 20, 30, 40, 50, and 60 minutes. Changes in the standardized uptake value (SUV) were recorded in multiple tissues (heart, lung, liver, spleen, kidney, muscle, bone, and aorta). Time-dependent curves of the standardized uptake value (SUVmax) were calculated to compare the uptake and clearance characteristics of different tissues.
[0255] like Figure 12 As shown, within 2 minutes, 68 Ga-NOTA-PFBC01 rapidly distributed to the heart, kidneys, and major blood vessels. Over time, the radioactive signal in the heart and blood vessels gradually decreased, while the kidneys maintained a high level and continued to increase, suggesting that the kidneys are the primary clearance pathway. The SUV values of the liver and spleen remained stable after 10 minutes. The SUV of bones and muscles remained relatively stable, with overall low uptake (SUVmax < 2). The SUV of the heart and aorta peaked early and then declined rapidly, indicating that the probe has rapid blood clearance and is rapidly distributed from the circulation to target tissues.
[0256] Static scanning further verifies this trend. Figure 13 As shown in center a, whole-body static PET / CT imaging results at 1 and 2 hours showed that the kidneys remained the primary site of radioactivity accumulation, a trend consistent with that observed in dynamic scans. The radioactivity signal in the heart and major vessels was significantly reduced in static scans, suggesting that the single-domain antibody had been largely cleared from the circulation at this time point. Figure 13 Figure b shows that SUV values in the liver, spleen, lung, muscle, and bone remained low (<1.0), indicating low overall uptake in systemic tissues. These results demonstrate rapid clearance of the radiotracer from normal organs, consistent with the distribution and metabolism of single-domain antibodies.
[0257] In summary, the BCMA-specific single-domain antibody PFBC01 of the present invention not only exhibits excellent BCMA targeting ability in vivo, but also has good tumor penetrance, and is suitable for combination with anticancer drugs or imaging agents to support targeted tumor therapy and imaging applications.
[0258] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, the present invention is intended to include any variation, use or improvement of the present invention, including changes that depart from the disclosed scope of the present invention and are made using conventional techniques known in the art.
Claims
1. A single domain antibody, characterized in that: The single-domain antibody comprises three complementary determining regions, namely CDR1, CDR2 and CDR3; the amino acid sequences of CDR1, CDR2 and CDR3 are positions 28 to 35, positions 49 to 60 and positions 97 to 112 of SEQ ID NO: 1, respectively.
2. The single domain antibody according to claim 1, characterized in that: The single domain antibody further comprises four framework regions named FR1, FR2, FR3 and FR4, The amino acid sequence of FR1 is positions 1 to 27 of SEQ ID NO: 1; The amino acid sequence of FR2 is positions 36 to 48 of SEQ ID NO: 1; The amino acid sequence of FR3 is positions 61 to 96 of SEQ ID NO: 1; The amino acid sequence of FR4 is positions 113 to 123 of SEQ ID NO:
1.
3. The single domain antibody according to claim 1 or 2, characterized in that: The amino acid sequence of the single-domain antibody is SEQ ID NO:
1.
4. An immunoconjugate, characterized in that: The immunoconjugate includes (I) and (II): (I) an antibody, which is a single domain antibody according to any one of claims 1 to 3; (II) Coupling moiety: The coupling moiety is a detection label.
5. A probe molecule, characterized in that: The probe molecule comprises the single domain antibody according to any one of claims 1 to 3.
6. The probe molecule according to claim 5, characterized in that: The probe molecule is a radioactive probe.
7. The probe molecule according to claim 6, characterized in that: The radioactive probe comprises the single domain antibody and a radionuclide coupled to the single domain antibody.
8. A reagent or a kit, characterized in that: It comprises the single domain antibody according to any one of claims 1 to 3, the immunoconjugate according to claim 4 or / and the probe molecule according to any one of claims 5 to 7.
9. A detection reagent, characterized in that: The detection reagent comprises the single domain antibody according to any one of claims 1 to 3, the immunoconjugate according to claim 4 or / and the probe molecule according to any one of claims 5 to 7.
10. Use of the single domain antibody according to any one of claims 1 to 3, the immunoconjugate according to claim 4, or / and the probe molecule according to any one of claims 5 to 7 in at least one of the following (C1) to (C6): (C1) Preparing a detection reagent, a detection kit, a detection plate or a developer for identifying or assisting in identifying BCMA protein; (C2) preparing a detection reagent, a detection kit, a detection plate or a developer that binds or assists in binding to BCMA protein; (C3) Preparing detection reagents, detection kits, detection plates or developing agents for detecting or assisting in detecting the expression level of BCMA in cells; (C4) Preparation of detection reagents, test kits, test plates or developing agents for diagnosing or assisting in the diagnosis of BCMA-positive diseases; (C5) Preparation of detection reagents, test kits, test plates or imaging agents for diagnosis or auxiliary diagnosis of BCMA-positive disease staging; (C6) Preparation of detection reagents, detection kits, detection plates or developers for monitoring or assisting in monitoring the therapeutic effects of BCMA-positive diseases.
11. Biomaterial, characterized in that: The biological material is any one of the following: (E1) a nucleic acid molecule encoding the single domain antibody according to any one of claims 1 to 3, (E2) an expression cassette containing the nucleic acid molecule described in (E1), (E3) a recombinant vector containing the nucleic acid molecule described in (E1) and / or the expression cassette described in (E2), (E4) A recombinant cell containing the nucleic acid molecule described in (E1), the expression cassette described in (E2) and / or the recombinant vector described in (E3).
12. The biomaterial according to claim 11, characterized in that: (E1) The nucleic acid molecule is a DNA molecule whose coding strand nucleotide sequence is shown in SEQ ID NO: 2, or an RNA molecule transcribed from the DNA molecule.
13. The biomaterial according to claim 11 or 12, characterized in that: The cells described in (E4) are cells derived from animals or microorganisms.
14. A method for preparing a single domain antibody, characterized in that: The single-domain antibody is the single-domain antibody according to any one of claims 1 to 3, and the method comprises the step of expressing the encoding gene of the single-domain antibody in a cell to obtain the single-domain antibody.
Citation Information
Patent Citations
Single domain antibody for resisting BCMA and application thereof
CN109942708A
Chimeric antigen acceptor of target BCMA (B cell maturation antigen) and application of chimeric antigen acceptor
CN110041433A