A green pricklyash fruit acidic homogeneous polysaccharide, and a preparation method and application thereof

Abstract

The present application relates to a kind of extracted and purified acidic homogeneous polysaccharide (PURP-B1) from Prinsepia uniflora Batal, its preparation method and innovative application in skin care field, and the structure characteristics of the polysaccharide are first clarified through systematic structure characterization.The application of the acidic homogeneous polysaccharide from Prinsepia uniflora Batal in improving skin problems caused by neurogenic inflammation and sensitive skin anti-sensitivity repair efficacy cosmetics is provided, which provides a new solution for the daily care of sensitive skin and the improvement of neurogenic skin problems.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a homogeneous acidic polysaccharide from the fruit of *Rhizophora stylosa*, its preparation method, and its applications. Background Technology

[0002] Sensitive skin is a hyperreactive skin condition. In sensitive skin, the overexpression of capsaicin receptor (TRPV1) and the release of neuropeptide P lead to abnormal activation of sensory nerves, resulting in an overreaction to mild stimuli and causing discomfort such as burning, itching, stinging, and tightness. This causes people with sensitive skin to experience anxiety about their appearance and emotional distress.

[0003] 11β-hydroxysteroid dehydrogenase 2 (HSD2), β-endorphin, and cortisol are closely related in the physiological and pathological processes of sensitive skin, especially having a significant impact on skin health. Cortisol is a major glucocorticoid in the human body, secreted by the adrenal glands and regulated by the hypothalamic-pituitary-adrenal (HPA) axis. Cortisol can inhibit the proliferation and differentiation of keratinocytes, leading to epidermal thinning and impaired barrier function; chronic hypercortisol can disrupt immune balance, exacerbate skin inflammation, and lead to steroid-dependent dermatitis. β-endorphin, as an endogenous opioid peptide, is secreted by the anterior pituitary gland and immune cells, and has analgesic, anti-inflammatory, and stress-regulating effects. β-endorphin can inhibit the HPA axis, suppressing cortisol release and forming negative feedback regulation, thereby alleviating skin stress responses by regulating nerve signals. HSD2 is an enzyme that converts active cortisol into inactive cortisol, thereby regulating local cortisol levels and protecting the skin from damage caused by excessive cortisol.

[0004] Plant polysaccharides are a class of macromolecular compounds composed of monosaccharide molecules linked by glycosidic bonds. They possess advantages such as good biocompatibility and low toxicity, making them suitable for long-term use and attracting increasing attention in the health product field. The structure of polysaccharides is closely related to their biological activity, and the complexity of polysaccharide structures is one of the most critical scientific challenges in developing bioactive plant polysaccharides.

[0005] Prinsepia utilis Royle is a traditional folk medicinal plant, known for its safety and multiple benefits, particularly in cosmetics. Existing technology CN118994430A discloses an acidic polysaccharide from Prinsepia utilis, obtained by enrichment with ion exchange resin. This invention focuses on the crude acidic polysaccharide of Prinsepia utilis without further structural research. CN104510668A discloses a moisturizing composition whose moisturizing active ingredients include at least Prinsepia utilis oil and Prinsepia utilis polysaccharide, wherein the polysaccharide is a crude polysaccharide obtained by water extraction and alcohol precipitation of Prinsepia utilis oil residue. Due to the potential advantages of Prinsepia utilis polysaccharide and its complex and important structure, developing a Prinsepia utilis polysaccharide with a clear structure, excellent efficacy, and well-defined mechanism has extremely high application value in cosmetics and the entire health industry, providing a more reliable material basis and technical support for applications in medicine, cosmetics, and other fields. Summary of the Invention

[0006] To address the aforementioned technical problems, the main objective of this invention is to provide a homogeneous acidic polysaccharide from *Prickly pear* fruit, its preparation method, and its applications. The invention also provides the structure of the homogeneous acidic polysaccharide and its application in the anti-allergic and repairing effects on neurogenic dermatitis and sensitive skin.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a homogeneous acidic polysaccharide from *Prickly pear* fruit, the structure of which is as follows:

[0009] The main chain structure is as follows:

[0010]

[0011] Wherein, R is H or methyl ester;

[0012] The branched structure is as follows:

[0013] R1:

[0014]

[0015] R2:

[0016]

[0017] Preferably, the acidic homogeneous polysaccharide of *Prickly pear* fruit is mainly composed of the following sugar residues linked together, specifically including: →4)-α-D-GalpA-(1→、→4)-α-D-GalpA-6-OMe-(1→、→3)-β-D-Galp-(1→、→6)-β-D-Galp-(1→、→3,6)-β-D-Galp-(1→、β-D-Galp-(1→、→2)-α -L-Rhap-(1→,→2,4)-α-L-Rhap-(1→,α-L-Rhap-(1→,→4)-β-D-GlcpA-(1→,α-L-Araf-(1 →, →5)-α-L-Araf-(1→, →3,5)-α-L-Araf-(1→, →2,5)-α-L-Araf-(1→ and →3)-α-L-Araf-(1→.

[0018] Preferably, the molecular weight of the acidic homogeneous polysaccharide from the Chinese prickly pear fruit is 60-80 kDa (e.g., 60 kDa, 65 kDa, 70 kDa, 75 kDa, 80 kDa, etc.).

[0019] In a second aspect, the present invention provides a method for preparing the acidic homogeneous polysaccharide of *Rhizophora stylosa* according to the first aspect, the preparation method comprising the following steps:

[0020] (1) Heat and reflux the oil meal of the prickly pear fruit to extract it. After concentrating the extract, add ethanol for alcohol precipitation to obtain crude polysaccharide of prickly pear fruit.

[0021] (2) The crude polysaccharide of *Cyprinus pubescens* obtained in step (1) was separated and eluted using an anion exchange gel DEAE-52 to obtain acidic polysaccharide of *Cyprinus pubescens*.

[0022] (3) The acidic polysaccharide of *Cyprinus pubescens* obtained in step (2) is separated and eluted using dextran gel G100, and the resulting eluent is dialyzed to obtain the homogeneous acidic polysaccharide of *Cyprinus pubescens*.

[0023] Preferably, the extraction in step (1) includes: mixing the oil meal of the prickly pear fruit and water at a material-to-liquid ratio of 1g:(5-15)mL (for example, 1g:7mL, 1g:9mL, 1g:11mL, 1g:13mL, etc.), and refluxing for extraction 1-3 times (for example, once, twice, or three times), with each extraction lasting 1-3 hours (for example, 1.2 hours, 1.5 hours, 2 hours, 2.5 hours, 2.8 hours, etc.).

[0024] Preferably, in step (1), the volume concentration of ethanol added is 75-85%, for example, it can be 76%, 78%, 80%, 82%, 84%, etc.

[0025] Preferably, step (1) after adding ethanol further includes the operations of cooling precipitation and centrifugation.

[0026] Preferably, the solvent used for elution in step (2) includes a 0.18-0.22M (e.g., 0.18M, ​​0.19M, 0.2M, 0.21M, 0.22M, etc.) aqueous solution of sodium chloride.

[0027] Preferably, the solvent used for elution in step (3) includes water.

[0028] Preferably, the molecular weight cutoff of the dialysis bag used in step (3) is 4500-5500 Da (e.g., 4500 Da, 4800 Da, 5000 Da, 5200 Da, 5500 Da, etc.).

[0029] Preferably, the preparation method of the acidic homogeneous polysaccharide from *Prickly pear* fruit is as follows:

[0030] (1) The oil meal of the prickly pear fruit was extracted by heating and reflux with water, concentrated under reduced pressure, precipitated with ethanol, and the final volume concentration of ethanol was 85%. The mixture was stirred, precipitated overnight, and the precipitate was collected by centrifugation to obtain crude polysaccharide from the prickly pear fruit.

[0031] (2) The crude polysaccharide of *Cyprinus pubescens* obtained in step (1) was reconstituted with distilled water, centrifuged, and the supernatant was collected and loaded onto anion exchange gel DEAE-52 packing. After elution with distilled water to remove neutral polysaccharides, elution was performed with 0.2M NaCl solution. Elution curves were plotted according to the sulfuric acid-phenol method and the eluent corresponding to the elution peaks was collected. The eluent was dialyzed with a 500 Da dialysis bag to remove salts and then freeze-dried to obtain the acidic polysaccharide component of *Cyprinus pubescens*.

[0032] (3) The acidic polysaccharide component of the prickly pear fruit obtained in step (2) was reconstituted with distilled water, and insoluble particles were removed by passing through a 0.22 μm filter membrane. Sephadex G100 was used as the separation packing material, and distilled water was used as the eluent. The elution curve was plotted according to the sulfuric acid-phenol method and the eluent corresponding to the elution peak was collected. Dialysis was performed using a dialysis bag with a molecular weight cutoff of 5000 Da. After freeze drying, the homogeneous acidic polysaccharide of the prickly pear fruit was obtained.

[0033] Thirdly, the present invention provides the application of the acidic homogeneous polysaccharide of *Rhizopus chinensis* as described in the first aspect in the preparation of a β-endorphin expression promoter.

[0034] Fourthly, the present invention provides the application of the acidic homogeneous polysaccharide of *Rhizopus chinensis* as described in the first aspect in the preparation of an expression promoter for 11β-hydroxysteroid dehydrogenase 2 (HSD2).

[0035] Fifthly, the present invention provides the application of the acidic homogeneous polysaccharide of *Prickly pear* fruit as described in the first aspect in the preparation of a cortisol inhibitor, wherein the cortisol inhibitor can inhibit the excessive release of cortisol in the skin by promoting the expression of β-endorphin and 11β-hydroxysteroid dehydrogenase 2 (HSD2), and the cortisol inhibitor can be used to treat skin diseases caused by neurogenic inflammation, including hormone-dependent dermatitis, atopic dermatitis, chronic urticaria, psoriasis, or rosacea.

[0036] In a sixth aspect, the present invention provides the application of the acidic homogeneous polysaccharide of *Prickly pear* fruit as described in the first aspect in cosmetics with anti-allergic and repairing effects.

[0037] The aforementioned anti-allergy cosmetics can relieve discomfort such as burning, itching, and stinging in sensitive skin.

[0038] In a seventh aspect, the present invention provides the application of the acidic homogeneous polysaccharide of *Prickly pear* as described in the first aspect in the preparation of a cosmetic film-forming agent.

[0039] This film-forming agent is suitable for people with sensitive skin and can be widely used in sunscreens, makeup bases, foundations, and other products to meet the multiple needs of sensitive skin for soothing effects, safety, and makeup results.

[0040] Compared with the prior art, the present invention has at least the following beneficial effects:

[0041] (1) This invention provides an acidic homogeneous polysaccharide of *Cyprinus sarcodactylis* and its structure. The polysaccharide is linked by specific glycosidic bonds. This invention realizes the accurate analysis and structural characterization of the polysaccharide components of *Cyprinus sarcodactylis*, laying an important foundation for in-depth development and application.

[0042] (2) The acidic homogeneous polysaccharide of *Cynanchum paniculatum* with a specific structure provided by the present invention can inhibit the excessive release of cortisol in sensitive skin by promoting the expression of β-endorphin and regulating the hypothalamus-pituitary-adrenal (HPA) axis. In addition, it can also prevent the skin from being damaged by cortisol by activating 11β-hydroxysteroid dehydrogenase 2 (HSD2). It can be used to treat skin diseases caused by neurogenic inflammation and relieve symptoms such as itching, redness, and stinging in sensitive skin.

[0043] (3) The preparation method of acidic homogeneous polysaccharide of Prickly pear fruit provided by the present invention adopts multiple separation and purification by ion exchange cellulose, dextran gel and dialysis bag, with zero organic reagents throughout the process, which is more environmentally friendly and safe. The preparation method is simple and has strong universality and good application prospects. Moreover, through the technical means provided by the present invention, acidic homogeneous polysaccharide of Prickly pear fruit with a narrow distribution can be obtained, which is convenient for the structural elucidation of active polysaccharide of Prickly pear fruit. Attached Figure Description

[0044] Figure 1This is a molecular weight distribution diagram of PURP-B1, an acidic homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0045] Figure 2 This is the Fourier transform infrared spectrum of PURP-B1, an acidic homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0046] Figure 3 This is the GC-MS total ion chromatogram of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0047] Figure 4 It is a one-dimensional NMR of the acidic homogeneous polysaccharide PURP-B1 from the fruit of the Chinese prickly pear. 1 H spectrum.

[0048] Figure 5 It is a one-dimensional NMR of the acidic homogeneous polysaccharide PURP-B1 from the fruit of the Chinese prickly pear. 13 C-spectrum.

[0049] Figure 6 This is a two-dimensional COSY NMR spectrum of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0050] Figure 7 This is a two-dimensional NMR HSQC spectrum of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0051] Figure 8 This is a two-dimensional HMBC NMR spectrum of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0052] Figure 9 This is a two-dimensional NOESY NMR spectrum of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Cyprinus sativus*.

[0053] Figure 10 This is a scanning electron microscope image of PURP-B1, an acidic homogeneous polysaccharide from the fruit of the Chinese prickly pear.

[0054] Figure 11 This is a graph showing the effect of the acidic homogeneous polysaccharide PURP-B1 from the fruit of *Cyprinus sativus* on the expression levels of HSD2, β-endorphin, and cortisol in a capsaicin-stimulated skin injury model.

[0055] Figure 12 This is a graph showing the effect of the acidic homogeneous polysaccharide PURP-B1 from the fruit of *Cypripedium spp.* on the expression levels of IL-4, IL-13, β-endorphin, and cortisol in a skin injury model induced by substance P. Detailed Implementation

[0056] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0057] NHEK cells were obtained from Shanghai Crown Biotechnology Co., Ltd.

[0058] The fruit of the Chinese prickly pear originates from Haba Snow Mountain in Yunnan;

[0059] The β-endorphin ELISA kit was sourced from Wuhan Yunclone Technology Co., Ltd.

[0060] The cortisol ELISA kit was developed by Wuhan Huamei Biotechnology Co., Ltd.

[0061] Example 1

[0062] This embodiment provides an acidic homogeneous polysaccharide from *Prickly pear* fruit and its preparation method, the preparation method comprising the following steps:

[0063] (1) Preparation of crude polysaccharide from *Cyprinus pubescens*: The oil meal of *Cyprinus pubescens* was extracted by heating and reflux at a material-to-liquid ratio of 1:10 (g / mL). The extraction solvent was distilled water, and the extraction time was 2 h. The extraction was repeated twice. The two extracts were combined and concentrated under reduced pressure until the concentrated weight was 1 / 5 of the initial weight. The obtained concentrate was slowly added to ethanol until the final ethanol concentration was 85%. The mixture was stirred for 2 h to ensure that the concentrate was fully in contact with the ethanol. The mixture was then allowed to stand overnight at 4 °C. After the precipitate was fully separated, it was centrifuged (3500 r / min) for 10 min, the precipitate was collected, and the mixture was freeze-dried to obtain crude polysaccharide from *Cyprinus pubescens*.

[0064] (2) Ion exchange chromatography of crude polysaccharide from *Cyprinus pubescens*: The crude polysaccharide from *Cyprinus pubescens* obtained in step (1) was reconstituted with distilled water, centrifuged, and the supernatant was collected and loaded onto anion exchange gel DEAE-52 packing material at a concentration of 1:50 (g / mL). After eluting the neutral polysaccharide with water, the acidic polysaccharide was eluted with 0.2M NaCl as the elution solvent. The acidic polysaccharide was detected by the sulfuric acid-phenol method. The absorbance measured at 490 nm was used to plot the elution curve. The eluents corresponding to the elution peaks were combined and desalted using a dialysis bag with a molecular weight cutoff of 500 Da. The product was then freeze-dried to obtain the acidic polysaccharide component from *Cyprinus pubescens*.

[0065] (3) Gel purification of acidic polysaccharide from *Cyprinus sarmentosus*: The acidic polysaccharide component obtained in step (2) was reconstituted with distilled water, and insoluble particles were removed by passing through a 0.22 μm filter membrane. Sephadex G100 was used as the separation packing material, with a sample concentration of 10 mg / mL and a flow rate of 0.5 mL / min. Distilled water was used as the eluent, and the eluent was detected by the sulfuric acid-phenol method. The absorbance was measured at 490 nm and the elution curve was plotted. The eluents corresponding to the elution peaks were combined and dialyzed using a dialysis bag with a molecular weight cutoff of 5000 Da to completely remove small molecular weight interfering substances. Dialysis was performed for 3 days, with the liquid changed every 4 hours. After dialysis, the mixture was freeze-dried to obtain the homogeneous acidic polysaccharide from *Cyprinus sarmentosus*, named PURP-B1.

[0066] Example 2

[0067] Structural characterization test

[0068] This test case involves the structural characterization of PURP-B1, an acidic homogeneous polysaccharide from the fruit of *Corydalis yanhusuo*, specifically including:

[0069] (1) Monosaccharide composition test

[0070] Test method: Accurately weigh 5 mg of PURP-B1 and dissolve it in 2 mL of 2 M TFA. Hydrolyze at 110 °C for 2 h, repeatedly adding methanol and concentrating under reduced pressure until TFA is completely removed. Dissolve the hydrolyzed PURP-B1 and 2 mg of monosaccharide standard in 0.5 mL of 0.5 M PMP reagent and 0.5 mL of 0.3 M NaOH solution, and derivatize in a 70 °C water bath for 30 min. After derivatization, add 0.5 mL of 0.3 M hydrochloric acid solution and 0.5 mL of ultrapure water, mix well, add an equal volume of chloroform, shake and extract, let stand, and take the supernatant for HPLC-DAD (Agilent 1260 Infinity II) analysis.

[0071] Experimental results show that PURP-B1 is composed of 27.97% galacturonic acid (GalA), 24.65% galactose (Gal), 23.25% arabinose (Ara), 8.42% glucose (Glc), 5.73% rhamnose (Rha), 4.74% xylose (Xyl), 2.78% glucuronic acid (GlcA), 1.30% mannose (Man), and 1.16% fucose (Fuc).

[0072] (2) Determination of molecular weight and distribution coefficient

[0073] Test method: PURP-B1 was dissolved in 0.1M NaCl solution to a final concentration of 1 mg / mL and tested. High-performance liquid chromatography-gel permeation (HPGPC) was used for testing. The HPLC system was an Agilent 1260 Infinity II. Chromatographic conditions were: size-exclusion column PL aquagel-OH 50 (8 μM, 300 × 7.5 mm); column temperature 35℃; injection volume 50 μL; mobile phase 0.1M NaCl solution; flow rate 1 mL / min; isocratic elution; and molecular weight was calculated using GPC software.

[0074] Experimental results are as follows Figure 1 As shown, the acidic homogeneous polysaccharide PURP-B1 from the fruit of *Cynanchum paniculatum* exhibits a uniform and symmetrical single peak, with a molecular weight Mw = 70 kDa and a distribution coefficient PDI = 1.42, indicating that its distribution is narrow and its molecular weight distribution is uniform.

[0075] (3) Fourier transform infrared spectroscopy test

[0076] Weigh 1-2 mg of each dried PURP-B1 into a mortar, add 200 mg of KBr powder, grind evenly, compress into tablets, and perform infrared scanning of the samples using a Fourier transform infrared microscopy system with a wavelength range of 4000-4000 cm⁻¹. -1 Record and analyze the infrared spectra.

[0077] Experimental results are as follows Figure 2 As shown, 3418.82cm -1 A strong and broad absorption peak exists at 2928.54 cm⁻¹, which is the strong absorption peak of the OH stretching vibration of hydrogen bonds between or within polysaccharide molecules; -1 The nearby moderate-intensity spikes are absorption peaks of the CH stretching vibrations of methyl (-CH3) and methine (-CH2) groups; at 1735.88 cm⁻¹ -1 The absorption peak at 1617.44 cm⁻¹ can be attributed to the symmetric stretching vibration of the C=O group of the esterified carboxyl group in galacturonic acid. -1 The peak at 1146.44 cm⁻¹ is a characteristic absorption peak of the asymmetric stretching vibration of the free carboxyl group COO- in galacturonic acid, or it may be the stretching vibration of the sugar ring in carbohydrates. -1 The stretching vibration of pyranose COC; 890.28 cm⁻¹ -1 The region is a characteristic region of β-pyranoside bond, suggesting that the polysaccharide contains β-pyranose.

[0078] (3) Bonding structure analysis

[0079] Test Method: Accurately weigh a small amount of PURP-B1 sample, dissolve it in primary water, then add 0.2M MES and 200 mg / mL carbodiimide, react at room temperature for 2 h, add 2M imidazole and 70 mg / mL NaBD4, react for 3 h, stop the reaction with glacial acetic acid, dialyze, freeze dry, and prepare for methylation treatment. Dissolve the freeze-dried sample in DMSO, incubate with NaOH, add iodomethane solution, and react in the dark. Extract with dichloromethane, aspirate the dichloromethane layer and dry it, add 2MTFA, react at 121℃ for 120 min, dry it, add 1M ammonia, stir and incubate for 2.5 h, stop the reaction with acetic acid, dry it, react with acetic anhydride at 100℃ for 2.5 h, add dichloromethane, vortex to mix, centrifuge, discard the aqueous phase, and take the bottom dichloromethane phase for detection by GC-MS. The GC-MS conditions were as follows: the chromatographic system used was an Agilent gas chromatography system (Agilent 7890A; Agilent Technologies, USA), with an HP-5MS capillary column (30m × 0.25mm × 0.25μm, Agilent J&W Scientific, Folsom, CA, USA); the carrier gas was high-purity helium (purity not less than 99.999%); the flow rate was 1.0 mL / min; and the injection port temperature was 260℃. The injection volume was 1 μL, split injection was used, the split ratio was 10:1, and the solvent delay was 2.2 min.

[0080] The methylation results are shown in Table 1, and the total ion chromatogram of methylation by GC-MS is shown in the figure below. Figure 3 As shown.

[0081] Table 1

[0082]

[0083] (4) Nuclear magnetic resonance analysis

[0084] The lyophilized PURP-B1 was dissolved in 0.5 mL of D2O, and one-dimensional NMR was measured using a 600 MHz Bruker NMR spectrometer. 1 H-NMR ( Figure 4 ), 13 C-NMR ( Figure 5 ) and two-dimensional nuclear magnetic resonance COSY ( Figure 6 ), HSQC ( Figure 7 ), HMBC ( Figure 8 NOESY Figure 9 Calibration: HDO hydrogen δH = δ4.70ppm, TMS carbon δC = δ0.00ppm.

[0085] such as one-dimensional NMR 1 H-NMR and 13As shown in C-NMR, 1 The H-ray spectral signals are concentrated between 3.0 and 5.5 ppm, with the anolyte (H-1) resonance region between 4.3 and 5.5 ppm. The chemical shifts of the anolyte (C-1) signals of polysaccharides are generally between 90 and 110 ppm. Further analysis using HSQC and COSY NMR spectra revealed multiple anolyte signals in the anolyte region. The chemical shifts of these significant anolyte signals are inferred to be: δ4.94 / 99.25 ppm, δ4.85 / 99.25 ppm, δ4.49 / 103.94 ppm, and δ4.29 ppm. / 103.25ppm, δ4.33 / 103.06ppm, δ4.33 / 103.15ppm, δ5.08 / 98.56ppm, δ5.08 / 98.56ppm, δ4.58 / 100.61ppm, δ4.36 / 102.57ppm, δ5.08 / 109.02ppm, δ4.93 / 107.26ppm, δ4.96 / 107.26ppm, δ5.03 / 106.77ppm, δ5.00 / 106.77ppm. Based on the monosaccharide composition, methylation, and anodic signal, the sugar residues of the anodic signal can be deduced to be: →4)-α-D-GalpA-(1→、→4)-α-D-GalpA-6-OMe-(1→、→3)-β-D-Galp-(1→、→6)-β-D-Galp-(1→、→3,6)-β-D-Galp-(1→、β-D-Galp-(1→、→2)-α-L-Rhap-(1→、→2,4) -α-L-Rhap-(1→、α-L-Rhap-(1→、→4)-β-D-GlcpA-(1→、→5)-α-L-Araf-(1→、→3,5)-α-L-Araf-(1→、→2,5)-α-L-Araf-(1→ and→3)-α-L-Araf-(1→, the chemical shifts of each sugar residue were assigned and numbered. The results are shown in Tables 2 and 3.

[0086] Table 2

[0087]

[0088] Table 3

[0089]

[0090] By analyzing the coupling signals between anomeric hydrogens and carbons on various sugar residues in the HMBC long-range correlation spectrum, or the coupling signals between anomeric carbons and hydrogens on various sugar residues, and the strong NOE signal generated by the spatial proximity of two protons at the connection sites of adjacent sugar residues, the interconnection order between various sugar residues was further inferred by combining the HMBC long-range correlation spectrum and the NOESY spectrum. The specific analysis is as follows: The presence of cross peaks (GA1,4H-1 / GA1,4H-4) in the NOESY spectrum indicates the presence of... The connection at →4)-α-D-GalpA-(1→4)-α-D-GalpA-(1→) indicates the existence of a link at →4)-α-D-GalpA-(1→4)-α-D-GalpA-6-OMe-(1→); (G1,3,6H-1 / G1,3,6H-3) indicates the existence of a link at →3,6)-β-D-Galp-(1→3,6)-β-D-Galp-(1→); (Gt H-1 / G1,3,6H-3) indicates the presence of β-D-Galp-(1→3,6)-β-D-Galp-(1→connection; (G1,3,6H-1 / G1,6H-6) indicates the presence of →3,6)-β-D-Galp-(1→6)-β-D-Galp-(1→connection; (G1,3H-1 / G1,3H-3) indicates the presence of →3)-β-D-Galp-(1→3)-β-D-Galp-(1→connection; (Gt H-1 / G1,3H-3) indicates the presence of β-D-Galp-(1→3)-β-D-Galp-(1→connection; (G1,3H-1 / G1,3,6H-3) indicates the presence of →3)-β-D-Galp-(1→3,6)-β-D-Galp-(1→connection; (At H-1 / G1,3,6H-3) indicates the presence of α-L-Araf-(1→3,6)-β-D-Galp-(1→connection); (G1,6H-1 / Rha1,2,4H-4) indicates the presence of →6)-β-D-Galp-(1→2,4)-α-L-Rhap-(1→connection); (A1,2,5H-1 / A1,5H-5) indicates the presence of →2,5)-α-L-Araf-(1→5)-α-L-Araf-(1→connection); (A1,5H-1 / Rha1,2,4H-4) indicates the presence of →5)-α-L-Araf-(1→2,4)-α-L-Rhap-(1→connection); (At H-1 / A1,2,5H-2) indicates the presence of α-L-Araf-(1→2,5)-α-L-Araf-(1→connection).The presence of cross-peaks (GA1,4H-1 / Rha1,2C-2) and (Rha1,2H-1 / GA1,4C-4) in the HMBC spectrum indicates the presence of →4)-α-D-GalpA-(1→2)-α-L-Rhap-(1→ cross-connection; (Rhat) H-1 / GlcA1,4C-4) indicates the presence of α-L-Rhap-(1→4)-β-D-GlcpA-(1→connection); (GlcA1,4H-1 / G1,3,6C-6) indicates the presence of →4)-β-D-GlcpA-(1→3,6)-β-D-Galp-(1→connection); (G1,3,6H-1 / G1,3,6C-6) indicates the presence of →3,6)-β-D-Galp-(1→3,6)-β-D-Galp-(1→connection); (G1,6H-1 / G1,6C-6) indicates the presence of →6)-β-D-Galp-(1→6)-β-D-Galp-(1→connection); (At H-1 / G1,3,6C-3) indicates the presence of α-L-Araf-(1→3,6)-β-D-Galp-(1→connection); (A1,2,5H-1 / A1,2,5C-5) indicates the presence of →2,5)-α-L-Araf-(1→2,5)-α-L-Araf-(1→connection; (A1,3,5H-1 / A1,5C-5) indicates the presence of →3,5)-α-L-Araf-(1→5)-α-L-Araf-(1→connection; (At (H-1 / A1,3C-3) indicates the presence of α-L-Araf-(1→3)-α-L-Araf-(1→connection); (A1,3H-1 / A1,3C-3) indicates the presence of →3)-α-L-Araf-(1→3)-α-L-Araf-(1→connection); (A1,3H-1 / A1,3,5C-3) indicates the presence of →3)-α-L-Araf-(1→3,5)-α-L-Araf-(1→connection); (A1,5H-1 / A1,5C-5) indicates the presence of →5)-α-L-Araf-(1→5)-α-L-Araf-(1→connection).

[0091] Based on the above analysis, the acidic homogeneous polysaccharide PURP-B1 from *Cypripedium spp.* is largely composed of pectin-linked HG domains and RG-I domains with side chains. The side chains of the RG-I domain are composed of →3,6)-β-D-Galp-(1→, →5)-α-L-Araf-(1→), as shown in the following structure:

[0092] The main chain structure is as follows:

[0093]

[0094] Wherein, R is H or methyl ester;

[0095] The branched structure is as follows:

[0096] R1:

[0097]

[0098] R2:

[0099]

[0100] (4) Electron microscopy

[0101] Apply an appropriate amount of PURP-B1 onto conductive carbon tape, perform gold sputtering, and then observe and photograph it in a scanning electron microscope. Set the working voltage to 10.0 kV and observe the solid morphology of the sample at different magnifications. Adjust the clarity accordingly until the ideal field of view is obtained, and then select an appropriate field of view to take pictures and record them.

[0102] like Figure 10 As shown in the figure, under a high-power electron microscope, the surface morphology of the polysaccharide PURP-B1 after gold sputtering is smooth and densely packed. This indicates that the polysaccharide molecules are highly cross-linked and have strong interactions with each other, making them easy to form films and showing great potential for use as film-forming agents in cosmetics.

[0103] Example 3

[0104] Efficacy test

[0105] (1) Capsaicin-induced skin injury model: Human primary keratinocytes (NHEK) were cultured in DMEM high-glucose medium (Gibco) containing 10% fetal bovine serum (Gibco). NHEK cells in the logarithmic growth phase were harvested and cultured at 1.2 × 10⁻⁶ cells / cells. 6 Cells were seeded at a density of [number] cells / well in 6-well plates and cultured. 20 μM capsaicin (purchased from MCE) was added to the drug-treated groups, and 20 μM capsaicin and PURP-B1 (60 μg / mL, 120 μg / mL, 240 μg / mL) were added for co-culturing for 24 h. The positive control group was treated with 20 μM capsaicin and 10 μM capsaicin (purchased from MCE). After modeling and drug administration, the cell supernatant was aspirated and centrifuged at 1000g, 4℃ for 10 minutes. β-endorphin and cortisol levels were measured according to the β-endorphin and cortisol detection kit instructions. The cell pellet was washed once with PBS, and RNA was extracted according to the cell RNA extraction kit (purchased from Abclonal). This RNA was then reverse transcribed into cDNA using a reverse transcription kit (purchased from Abclonal). Finally, HSD2 gene expression was detected by real-time quantitative PCR. The primer information for HSD2 was: upstream, GGCCACCGTATTGGAGTTGA; downstream, GCGGCTAATGTCTCCTGGTT.

[0106] The experimental results were plotted using Prism plots and expressed as Mean ± SD. One-way ANOVA was used to compare the groups. "###" indicates p < 0.001 compared with the normal control group; "**" and "***" indicate p < 0.01 and p < 0.001 compared with the model group, respectively.

[0107] Experimental results are as follows Figure 11 As shown, PURP-B1 (60, 120, and 240 μg / mL) significantly promoted the expression of the HSD2 gene in human keratinocytes (NHEK) under capsaicin stimulation and upregulated the expression level of β-endorphin. More importantly, PURP-B1 significantly inhibited the excessive production of cortisol in damaged cells in a dose-dependent manner. Experimental data indicate that PURP-B1 significantly reduces the damaging effects of cortisol on skin cells by synergistically regulating the HSD2 / β-endorphin system, and can alleviate skin problems caused by stress.

[0108] (2) Substance P-induced skin injury model: Human primary keratinocytes (NHEK) were cultured in DMEM high-glucose medium (Gibco) containing 10% fetal bovine serum (PBS). NHEK cells in the logarithmic growth phase were harvested and cultured at 1.2 × 10⁻⁶ cells / mL. 6 Cells were seeded at a density of [number] cells / well in 6-well plates and cultured in a cell culture incubator for 24 h. After complete cell adhesion, except for the normal group which was cultured in complete medium, the model group was added with 1 μM P substance (purchased from MCE), the drug treatment group was added with 1 μM P substance and PURP-B1 acidic homogeneous polysaccharide from *Cynanchum paniculatum* (60 μg / mL, 120 μg / mL, 240 μg / mL) and co-cultured for 24 h, and the positive control group was added with 1 μM P substance and 1 μM aprepitant (purchased from MCE). After modeling and drug administration, the cell supernatant was aspirated and centrifuged at 1000g, 4℃ for 10 min. The contents of β-endorphin and cortisol were detected according to the instructions of the β-endorphin and cortisol detection kit. The cell pellet was washed once with PBS, and RNA was extracted according to the instructions of the cell RNA extraction kit (purchased from Abclonal). The RNA was then reverse transcribed into cDNA using a reverse transcription kit (purchased from Abclonal). Finally, the expression of IL-4 and IL-13 genes was detected by real-time quantitative PCR. Primer information: IL-4 (upstream: CAGCCACCATGAGAAGGACA, downstream: GTTCCTGTCGAGCCGTTTCA); IL-13 (upstream: AGGAGGGTTAGGGAGGGGTA, downstream: GGGCACCCACTGTAATGCTA).

[0109] The experimental results were plotted using Prism plots and expressed as Mean ± SD. One-way ANOVA was used to compare the groups. "###" indicates p < 0.001 compared with the normal control group; "**" and "***" indicate p < 0.01 and p < 0.001 compared with the model group, respectively.

[0110] Experimental results are as follows Figure 12 As shown, PURP-B1 significantly improved the expression of inflammatory factors IL-4 and IL-13 in human keratinocytes (NHEK) stimulated by substance P, indicating that PURP-B1 has the potential to alleviate the vicious cycle of skin itching and inflammation. Furthermore, PURP-B1 exhibited neuroendocrine regulatory functions, dose-dependently upregulating β-endorphin expression while significantly inhibiting cortisol production, suggesting that PURP-B1 may effectively protect skin cells from barrier damage and inflammatory responses caused by excessive cortisol accumulation under stress through the regulation of the "β-endorphin-cortisol axis".

[0111] In summary, this invention, through two interconnected cell models, systematically reveals the multiple protective effects of the homogeneous acidic polysaccharide PURP-B1 from *Prickly Pear* on the regulation of the cutaneous neuro-immune-endocrine network. These findings not only provide important insights into the regulatory mechanisms of neurogenic inflammation in the skin but also offer potential targets for developing innovative therapies for complex skin diseases such as atopic dermatitis and steroid-dependent dermatitis. In particular, the multi-target synergistic regulatory properties exhibited by PURP-B1 give it a unique advantage in developing innovative formulations that combine anti-inflammatory, anti-allergic, antipruritic, and barrier-repairing functions.

[0112] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A homogeneous acidic polysaccharide from the fruit of *Prickly pear*, characterized in that, The structure of the acidic homogeneous polysaccharide from the prickly pear fruit is as follows: The main chain structure is as follows: ； Wherein, R is H or methyl ester; The branched structure is as follows: R1： ； R2： ； The molecular weight of the acidic homogeneous polysaccharide from the prickly pear fruit is 60-80 kDa.

2. The homogeneous acidic polysaccharide from *Prickly pear* fruit according to claim 1, characterized in that, The homogeneous acidic polysaccharide from *Prickly pear* fruit is composed of linked sugar residues, including: →4)-α-D-GalpA-(1→、→4)-α-D-GalpA-6-OMe-(1→、→3)-β-D-Galp-(1→、→6)-β-D-Galp-(1→、→3,6)-β-D-Galp-(1→、β-D-Galp-(1→、→2)-α-L- Rhap-(1→, →2,4)-α-L-Rhap-(1→, α-L-Rhap-(1→, →4)-β-D-GlcpA-(1→, α-L-Araf-(1→, →5)-α-L-Araf-(1→, →3,5)-α-L-Araf-(1→, →2,5)-α-L-Araf-(1→ and →3)-α-L-Araf-(1→.

3. A method for preparing the acidic homogeneous polysaccharide from *Rhizophora stylosa* according to claim 1 or 2, characterized in that, The preparation method includes the following steps: (1) Heat and reflux the oil meal of the prickly pear fruit to extract it. Concentrate the extract and add ethanol for alcohol precipitation to obtain crude polysaccharide of prickly pear fruit. (2) The crude polysaccharide of *Cyprinus pubescens* obtained in step (1) was separated and eluted using an anion exchange gel DEAE-52 to obtain acidic polysaccharide of *Cyprinus pubescens*. (3) The acidic polysaccharide of *Cyprinus pubescens* obtained in step (2) is separated and eluted using dextran gel G100, and the resulting eluent is dialyzed to obtain the homogeneous acidic polysaccharide of *Cyprinus pubescens*.

4. A method for preparing the acidic homogeneous polysaccharide from *Rhizophora stylosa* according to claim 3, characterized in that, The preparation method includes the following steps: (1) The oil meal of the prickly pear fruit was extracted by heating and reflux with water, concentrated under reduced pressure, precipitated with ethanol, and the final volume concentration of ethanol was 85%. The mixture was stirred, precipitated overnight, and the precipitate was collected by centrifugation to obtain crude polysaccharide of prickly pear fruit. (2) The crude polysaccharide of *Cyprinus pubescens* obtained in step (1) was reconstituted with water, centrifuged, and the supernatant was collected and loaded onto anion exchange gel DEAE-52 packing. After elution with water to remove neutral polysaccharides, elution was performed with 0.2 M NaCl solution. The elution curve was plotted according to the sulfuric acid-phenol method and the eluent corresponding to the elution peak was collected. The eluent was dialyzed with a 500 Da dialysis bag to remove salts and then freeze-dried to obtain the acidic polysaccharide component of *Cyprinus pubescens*. (3) The acidic polysaccharide component of the prickly pear fruit obtained in step (2) was re-dissolved in water, and insoluble particles were removed by passing through a 0.22 μm filter membrane. Sephadex G100 was used as the separation packing material, and water was used as the eluent. The eluent corresponding to the elution peak was collected according to the elution curve drawn by the sulfuric acid-phenol method. Dialysis was performed using a dialysis bag with a molecular weight cutoff of 5000 Da. After freeze drying, the acidic homogeneous polysaccharide of the prickly pear fruit was obtained.

5. The application of the acidic homogeneous polysaccharide of *Cyprinus sativus* according to claim 1 or 2 in the preparation of a β-endorphin expression promoter.

6. The application of the acidic homogeneous polysaccharide of *Cyprinus sativus* according to claim 1 or 2 in the preparation of an expression promoter for 11β-hydroxysteroid dehydrogenase 2.

7. The application of the acidic homogeneous polysaccharide from *Prickly pear* fruit according to claim 1 or 2 in the preparation of cortisol inhibitors, characterized in that... The cortisol inhibitor inhibits the excessive release of cortisol in the skin by promoting the expression of β-endorphin and 11β-hydroxysteroid dehydrogenase 2. The cortisol inhibitor is used to treat skin diseases caused by neurogenic inflammation, including hormone-dependent dermatitis, atopic dermatitis, chronic urticaria, psoriasis, or rosacea.

8. The application of the acidic homogeneous polysaccharide of *Cynanchum paniculatum* according to claim 1 or 2 in the preparation of cosmetics with anti-allergic and repairing effects.

9. The application of the acidic homogeneous polysaccharide of *Cynanchum paniculatum* according to claim 1 or 2 in the preparation of cosmetic film-forming agents.

Images