Fusarium moniliforme (Fusarium moniliforme (mLG-BZ-9) and salt-tolerant application thereof
By using fermented substances from Fusarium roximately Fusarium incarnatum LG-BZ-9, the growth performance of corn seedlings under salt stress was significantly improved, and the problem of insufficient salt tolerance in the prior art was solved, providing an effective microbial resource for the improvement of saline-alkali land.
Patent Information
- Application Number
- CN202510145225.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-10
- Publication Date
- 2025-07-18
AI Technical Summary
The lack of effective salt-tolerant endophyte fungi, especially Fusarium incarnatum, in the prior art, leads to high cost of improving salted soil and prone to secondary pollution, making it difficult to promote on a large scale, and the existing salt-tolerant and probiotic bacteria have not significantly improved plant salt tolerance.
It provides a Fusarium rolivia Fusarium incarnatum LG-BZ-9 and its fermented substance to improve plant salt tolerance through root irrigation. The specific method includes culturing on PDA medium and shaking in PDB liquid medium at a constant temperature, preparing a fermentation broth after centrifugation and filtration, and for irrigation of corn seedlings.
Significantly improve the growth potential of corn seedlings under salt stress, increase plant height, fresh weight and chlorophyll content, regulate K+/Na+ balance, enhance plant salt tolerance, and provide scientific basis and microbial resources for the improvement of saline-alkali land.
Smart Images

Figure CN120330058A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and particularly relates to a Fusarium incarnatum LG-BZ-9 and its application in salt tolerance. Background Art
[0002] The problem of soil salinization is a worldwide difficult problem, and soil salinization still shows an upward trend. The spatial distribution of saline-alkali soil has characteristics such as a huge coverage area, a wide distribution range, rich types, and a deep degree of salinization. Every year, a large amount of cultivated land is abandoned or even left fallow due to soil salinization. It will not only cause soil compaction, low porosity and poor soil fertility, but also directly cause toxic effects on plants. It severely restricts the effective utilization and sustainability of soil resources in China. Therefore, based on the serious harm caused by soil salinization, the treatment of saline soil is of great significance for improving the ecological environment in China and promoting the green and sustainable development of regional agricultural economy, society and ecology.
[0003] Although saline soil can be partially improved by certain physical or chemical means, due to the high cost and low effectiveness, it is extremely easy to cause secondary pollution to the soil and cannot be widely applied on a large scale. At present, the application of microorganisms is considered to be one of the effective ways to greenly and efficiently alleviate the impact of saline soil. Plant endophytic fungi are beneficial strains that can infect plant tissues, affect plant growth, development and reproduction, and help plants resist biotic and abiotic stresses. It is found that salt-tolerant endophytic fungi have great potential in the improvement and utilization of saline-alkali land. The symbiotic relationship between endophytic fungi of halophytes and halophytes is formed in an extreme environment of high salt, and has high stress resistance. It helps the host plant survive and grow in a high-salt environment through various mechanisms, not only can improve the salt tolerance of plants, but also can provide new strategies for the sustainable utilization of saline-alkali land.
[0004] Existing salt-tolerant and growth-promoting bacteria include Bacillus subtilis, Bacillus siamensis, Bacillus licheniformis, Marinococcus sp., Bacillus atrophaeus, Halomonas aquamarina, etc. Fusarium incarnatum has the property of producing unsaturated fatty acids in the prior art. As described above, Fusarium incarnatum is not among the existing salt-tolerant and growth-promoting bacteria, and the prior art has not reported that Fusarium incarnatum has the characteristic of salt tolerance. Therefore, it is unknown whether Fusarium incarnatum is salt-tolerant. Summary of the Invention
[0005] To solve the above problems, the present invention provides a Fusarium incarnatum LG-BZ-9 and its application in salt tolerance.
[0006] An endophyte, which is Fusarium incarnatum LG-BZ-9, is preserved in the China Center for Type Culture Collection, with the preservation date of December 12, 2024, and the preservation number of CCTCC NO: M 20242806.
[0007] A fermented product, which includes the above-mentioned endophyte.
[0008] Preferably, the preparation method of the fermented product is: placing the endophyte on a PDA medium plate to obtain a bacterial disc, putting it into a PDB liquid medium and culturing at 25°C - 30°C for 3d - 4d, removing the PDB liquid medium, and collecting the mycelia to obtain the fermented product.
[0009] Preferably, it is cultured on the PDA medium plate at 25°C - 30°C for 5 days - 8 days.
[0010] Preferably, it is cultured with constant temperature oscillation when cultured in the PDB liquid medium.
[0011] Preferably, when removing the PDB liquid medium, centrifuge and filter at 7000rpm - 9000rpm.
[0012] The application of the above-mentioned endophyte in improving the salt tolerance of plants.
[0013] The application of the fermented product in improving the salt tolerance of plants.
[0014] Preferably, by preparing a fermentation broth with the fermented product and irrigating the roots of plants with the fermentation broth, the salt tolerance of plants can be improved.
[0015] Preferably, the plant is corn.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0017] The strain provided by the present invention is isolated and screened from the roots of the halophyte Sesuvium portulacastrum. Through molecular biological identification, it is determined that the strain is Fusarium incarnatum. Through salt tolerance analysis, it is found that the strain has strong salt tolerance and still grows better than the control in a medium containing 0.75M NaCl.
[0018] The strain was made into a strain fermentation broth and used to irrigate the roots of corn seedlings under normal treatment. It was found that after adding the strain, the plant height and fresh weight of the corn seedlings increased significantly. When the roots of corn seedlings were irrigated under 0.25M NaCl stress, it was found that after adding the strain, the plant height, fresh weight per plant and chlorophyll content of the corn seedlings increased significantly, by 40.5%, 20.1% and 27.8% respectively. This indicates that the addition of this strain can significantly improve the salt tolerance and growth promotion ability of corn seedlings under salt stress, providing a safe and effective microbial resource for the effective utilization of saline-alkali land, and providing a scientific basis and technical support for saline-alkali land improvement. Description of the Drawings
[0019] Figure 1 It is a photo of strain purification.
[0020] Figure 2 It is the PCR amplification result of LG-BZ-9. Among them, M: DL2000 DNA Marker; LG-BZ-9: Amplification product of LG-BZ-9.
[0021] Figure 3 It is the NCBI sequence alignment.
[0022] Figure 4 It is the verification of salt-tolerant strains. A: Phenotype on PDA plates with different salt concentrations; B: Colony diameter statistics.
[0023] Figure 5 It is the phenotypic analysis of corn seedlings under different treatments. Among them, A is the phenotype of potted corn, and B is the phenotype of corn plants under different treatments.
[0024] Figure 6 It is the growth change of corn seedlings under different treatments. A: Fresh weight of plants; B: Plant height; C: Chlorophyll content.
[0025] Figure 7 It is that LG-BZ-9 improves the salt tolerance of corn by regulating K + / Na + balance. A: K + content in the underground part; B: Na + content in the underground part; C: K + / Na + ratio in the underground part; D: K + content in the aboveground part; E: Na + content in the aboveground part; F: K + / Na + ratio. Detailed Implementation Modes
[0026] The following is a detailed description of the specific embodiments of the present invention. However, it should be understood that the protection scope of the present invention is not limited by the specific embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.
[0027] Sesuvium portulacastrum is a halophyte growing on coastal tidal flats and has extremely strong salt tolerance. However, there has been no report on the research of its root microorganisms. In the present invention, a salt-tolerant endophytic fungus was isolated from the roots of Sesuvium portulacastrum. Through molecular biological identification, this strain was found to belong to Fusarium incarnatum. After salt tolerance identification, this strain has strong salt tolerance and still grows better than the control in the medium containing 0.75 M NaCl. After co-culturing this strain with corn seedlings, it was found that this strain could improve the growth potential of corn seedlings and at the same time mitigate the damage of corn seedlings under salt stress. This strain can improve the salt tolerance of plants and can be developed and utilized as a potential microbial strain resource for improving the salt tolerance of plants.
[0028] Example 1
[0029] Isolation and purification of the strain
[0030] Collect the roots of the halophyte Sesuvium portulacastrum from the coastal tidal flat of Bozong Village, Lingao County, Hainan Province (109°59'62.38”E, 19°98'35.38”N). Wash the roots of Sesuvium portulacastrum clean, place them on a clean bench, and put them into a sterilized Erlenmeyer flask. Perform surface disinfection according to the following steps: rinse with 75% ethanol for 30 s, wash with sterile water 3 times, rinse with 1% sodium hypochlorite by mass for 5 min, and wash with sterile water 3 times for sufficient washing.
[0031] Use a sterilized scalpel to longitudinally cut the washed roots into small segments with a length of 0.5 cm. Place the cut surface on a PDA plate containing 100 μg / mL streptomycin sulfate and incubate it in an inverted position at 28 °C for 5 d. When new mycelia grow out, use a sterilized inoculation needle to pick the mycelial edge together with a small amount of medium onto a new PDA plate in a timely manner. Pick it 4 times repeatedly until a single strain is obtained. Name and number the strain, and preserve it by the slant preservation method or the liquid paraffin preservation method.
[0032] After culturing for 4 d, mycelia gradually grew on the PDA petri dish. Pick the mycelial edge to a new petri dish and transfer it multiple times for purification culture. As Figure 1 shown, a pure culture was obtained and numbered LG-BZ-9.
[0033] Example 2
[0034] Strain identification
[0035] The isolated endophytic fungus LG-BZ-9 of Sesuvium portulacastrum was inoculated into a centrifuge tube containing PDB liquid medium and cultured in a constant temperature oscillator at 28°C and 200 rpm for 2 - 3 days. After an appropriate amount of mycelia were produced, it was centrifuged at 12,000 rpm, the liquid medium was discarded, and 70 mg of mycelia were collected for extracting the total DNA of the endophytic fungus strain. The extraction of the endophytic fungus was referred to the Fungal Genomic DNA Extraction Kit of Beijing Solarbio Science & Technology Co., Ltd., product number: D2300. Using the extracted endophytic fungus DNA as a template, universal fungal primers were selected for amplification:
[0036] ITS1: 5’-TCCGTAGGTGAACCTGCGC-3’, denoted as SEQ ID NO.1;
[0037] ITS4: 5’-TCCTCCGCTTATTGATATGC-3’, denoted as SEQ ID NO.2.
[0038] The PCR amplification was carried out using a 50 μL reaction system as shown in Table 1.
[0039] Table 1 PCR reaction system
[0040] Component Volume (μL) 2×Taq Plus Master MixⅡ (DyePlus) 25 ITS1 (10μM) 2 ITS4 (10μM) 2 Template 2 <![CDATA[ddH2O]]> 19 Total volume 50
[0041] The PCR amplification program was: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 40 s, annealing at 55°C for 40 s, extension at 72°C for 50 s, with a total of 30 cycles. Finally, extension at 72°C for 10 min and preservation at 4°C.
[0042] The amplification results are as Figure 2 shown.
[0043] Take 5 μL of the PCR product obtained by amplifying the endophytic fungus, detect it by 1.2% agarose gel electrophoresis, and send the product with correct bands to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0044] The sequenced sequence of this strain is: GGGGATTTCGGAGCTCAACTCCAACCCCTGTGAACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGACCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATCATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA, denoted as SEQ ID NO.3.
[0045] All the effective sequences after sequencing were subjected to multiple sequence alignment by Clustal X, then the sequences were base-trimmed by BioEdit, and finally Mothur was used for the division of microbial operational taxonomic units (OTUs). Sequences with a sequencing sequence identity of ≥99% were assigned to the same OTU. The representative sequences of each OTU were searched and aligned with similar sequences in the NCBI database through the BLAST program to determine their taxonomic status. The comparison results are as Figure 3 shown.
[0046] It was found that LG-BZ-9 belongs to Ascomycota, Sordariomycetes, Hypocreales, Nectriaceae, Fusarium, and Fusarium incarnatum.
[0047] Example 3
[0048] 1. Verification of the salt tolerance of the LG-BZ-9 strain
[0049] Activate the identified endophytic fungi, and use a sterile borer to cut 4 discs with a diameter of 5 mm at the edge of the colony, and place them on PDA medium without salt (CK) and PDA medium containing 0.25 M, 0.5 M and 0.75 M NaCl respectively. Incubate them in an inverted position in a constant temperature incubator at 28 °C, observe the growth of the strains, and count the colony diameter every day.
[0050] The results are as Figure 4 shown. Through the screening of salt-tolerant plates, it was found that the colony diameter of LG-BZ-9 was higher than that of the control under the treatments of 0.25 M, 0.5 M and 0.75 M NaCl, indicating that this strain has strong salt tolerance.
[0051] 2. Root irrigation treatment of corn seedlings with LG-BZ-9 strain
[0052] Preparation of fermentation broth of salt-tolerant strain: Use a sterile pipette tip to place the mycelial blocks of LG-BZ-9 endophytic fungi on the PDA medium (Beijing Coolaber Technology Co., Ltd., PM0520) plate and culture them at 28 °C for one week. Use a borer to cut 4 discs of 5 mm and put them into a triangular flask containing 500 mL of PDB liquid medium (Beijing Coolaber Technology Co., Ltd., PM0510), and culture them in a constant temperature shaker at 28 °C and 200 rpm for 3 d. Centrifuge and filter the cultured endophytic fungi at 8000 rpm to remove the PDB liquid medium, collect the mycelia, break the mycelia, adjust the concentration to 1 g / L with water, and store it in a refrigerator at 4 °C for later use.
[0053] Preparation of corn seedlings: Select corn seeds of the same size and plump grains to grow seedlings in small black pots containing matrix. Plant 9 corn plants in each pot. When the average height of the corn seedlings is 4 - 5 cm, conduct the treatment. Among them, the matrix is composed of vermiculite and nutrient soil with a mass ratio of 2:1, and the specification of the small black pot is 7*7*8.
[0054] Co-culture of corn seedlings and endophytic fungi: Use 0.25 M NaCl to conduct salt stress treatment on corn seedlings. A total of four groups of treatments are set, namely: control: watering the roots with water, control inoculation: inoculating the bacteria and watering the roots with water, stress: watering the roots with salt water, stress inoculation: watering the roots with salt water and inoculating the bacteria. There are 6 pots for each treatment. All treatments are placed in a plant growth chamber and cultured under the conditions of 25±1 °C, 22±1 °C, and a 16 h / 8 h light-dark cycle. After the treatment, take pictures every day to record the growth status, and sample on the 10th day to measure relevant indicators.
[0055] LG-BZ-9 strain improves the salt tolerance of corn. As Figure 5 seen from the phenotype, different treatments have great effects on the growth of corn, and the phenotypic differences between the control and control inoculation groups and the stress and stress inoculation groups are extremely significant.
[0056] Under salt stress, the salt-tolerant strain LG-BZ-9 promotes the growth of maize, as Figure 6 shown. Comparing the control group with the control inoculated group, it was found that LG-BZ-9 could significantly increase the plant height and fresh weight per plant of maize, with increases of 18.4% and 20% respectively compared to the control. Comparing the stress group with the stress inoculated group, after inoculating the strain LG-BZ-9, it was found that LG-BZ-9 could significantly enhance the salt tolerance of maize, increasing the plant height, fresh weight per plant and chlorophyll content by 40.5%, 20.1% and 27.8% respectively.
[0057] Under salt stress, the salt-tolerant strain LG-BZ-9 improves the salt tolerance of maize by regulating the K + / Na + balance, as Figure 7 shown. Comparing the control group with the control inoculated group, it was found that after adding the bacterial liquid, the K + content in the above-ground and underground parts of maize was higher than that of the control, and the Na + content was lower than that of the control, but the difference was not significant (P>0.05). Under salt stress, the K + content in plant tissues decreased significantly, and the Na + content increased significantly, resulting in a significant decrease in the K + / Na + ratio in plant tissues compared to the control. However, after adding endophytic fungi under salt stress, the K + content in the above-ground and underground parts was higher than that under salt stress alone, and the Na + content was lower than that under salt stress alone, resulting in a significant increase in the K + / Na + ratio compared to salt stress alone (P<0.05).
[0058] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0059] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments and all changes and modifications falling within the scope of the present invention.
[0060] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and variations.
Claims
1. An endophyte, characterized in that, The endophyte is Fusarium incarnatum LG-BZ-9, which is preserved in the China Center for Type Culture Collection. The preservation date is December 12, 2024, and the preservation number is CCTCC NO: M20242806.
2. A ferment, characterized in that, The fermented product includes the endophyte described in claim 1.
3. The ferment according to claim 2, wherein The preparation method of the fermented product is as follows: The endophyte is cultured on a PDA medium plate to obtain a fungal disc, which is then placed in a PDB liquid medium and cultured at 25°C to 30°C for 3 days to 4 days. The PDB liquid medium is removed, and the mycelium is collected to obtain the fermented product.
4. The ferment according to claim 3, characterized in that, Cultivate on the PDA medium plate at 25°C to 30°C for 5 days to 8 days.
5. The fermented product according to claim 3, characterized in that, During the cultivation in the PDB liquid medium, perform constant temperature shaking culture.
6. The fermented product according to claim 3, characterized in that, When removing the PDB liquid medium, centrifuge and filter at 7000 rpm to 9000 rpm.
7. The application of the endophyte described in claim 1 in improving the salt tolerance of plants.
8. The application of the fermented product described in claim 2 in improving the salt tolerance of plants.
9. The application according to claim 8, wherein By formulating the fermented product into a fermentation liquid, the fermentation liquid is used for root irrigation of plants, thereby improving the salt tolerance of plants.
10. The application according to claim 7 or claim 8, characterized in that, The plant is corn.