Corydalis saxicola bunting endophytic fungi and extraction method and application thereof

Abstract

The invention discloses a corydalis saxicola bunting endophytic fungus which comprises rhizopus oryzae R01 and cladosporium microsporum CP1, the preservation number of the rhizopus oryzae R01 is CCTCC (China Center For Type Culture Collection) NO: M 2024891, and the preservation number of the cladosporium microsporum CP1 is CCTCC NO: M 20242141. The invention further discloses an extraction method of the corydalis saxicola bunting endophytic fungi. The invention also discloses application of the corydalis saxicola bunting endophytic fungi in secretion of lignocellulase, promotion of corydalis saxicola bunting growth and bacteriostasis. The Corydalis saxicola bunting endophytic fungi are successfully separated from Corydalis saxicola bunting, and the Corydalis saxicola bunting endophytic fungi can secrete lignocellulase to promote the growth of Corydalis saxicola bunting and

Description

Technical Field

[0001] The present invention relates to the technical field of endophytes, and particularly relates to a Corydalis saxicola endophytic fungus, an extraction method thereof, and an application thereof. Background Art

[0002] Among microbial groups, endophytic fungi are generally present in the internal tissues of plants. There are obvious differences in the dominant endophytic fungal populations in different plants, and their diversity varies with different environments, hosts, parts, etc. A wide variety of endophytic fungi have been isolated from plants, involving types such as Ascomycetes, Zygomycetes, and Basidiomycetes. Many plants contain at least one or thousands of endophytic fungi.

[0003] Endophytic fungi from different plants can produce related active substances, which show great application prospects in aspects such as drug research and development and ecological control. The rich endophytic fungal resources and the secondary metabolites produced are important sources of natural active substances. Therefore, exploring endophytic fungal resources in plants and obtaining natural products with biological activities from them have always been research hotspots.

[0004] Corydalis saxicola Bunting, also known as Saxicolous Corydalis, is a perennial herbaceous plant belonging to the genus Corydalis of the family Papaveraceae, and is mainly distributed in the karst areas of southwestern China. The whole plant of Corydalis saxicola can be used medicinally. The main medicinal components are alkaloids, including dehydrocavidine, palmatine, and berberine, etc. Alkaloids are produced by various organisms such as bacteria, fungi, plants, and animals, and have pharmacological effects of anti-inflammatory, antiviral, and anti-tumor. In traditional Chinese medicine, Corydalis saxicola is used to treat various diseases, including hepatitis, conjunctivitis, oral mucosal erosion, hemorrhoids, acute abdominal pain, and dysentery.

[0005] Since traditional drug development has caused serious damage to vegetation and biodiversity, identifying and evaluating isolated and culturable endophytic fungal groups and exploring their active substances can point the way for finding new drug sources. Currently, there are no reports on Corydalis saxicola endophytic fungi and their secondary metabolites. Summary of the Invention

[0006] Based on the technical problems existing in the background art, the present invention provides a Coptis saxicola endophytic fungus, its extraction method and application. The present invention takes perennial wild and cultivated varieties of Coptis saxicola as the research objects, and separates and identifies the endophytic fungi in their roots, stems, leaves and fruits respectively. As a result, a total of 274 endophytic fungi are traditionally isolated from the cultivated and wild varieties of Coptis saxicola, which are divided into 3 phyla, 4 classes, 7 orders, 11 families and 11 genera. And two Coptis saxicola endophytic fungi, Rhizopus oryzae R01 and Cladosporium perangustum CP1, are successfully isolated, and it is found that they can secrete and generate lignocellulase, promote the growth of Coptis saxicola, increase the yield of Coptis saxicola, and inhibit the growth of Escherichia coli and Bacillus subtilis, which has important economic significance.

[0007] The present invention provides a Coptis saxicola endophytic fungus, including: Rhizopus oryzae R01 and Cladosporium perangustum CP1.

[0008] Among them, Rhizopus oryzae R01 was deposited at the China Center for Type Culture Collection on May 10, 2024, at the address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, and its deposit number is CCTCC NO: M2024891.

[0009] Cladosporium perangustum CP1 was deposited at the China Center for Type Culture Collection on September 30, 2024, at the address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, China, and its deposit number is CCTCC NO: M20242141.

[0010] The present invention also provides an extraction method for the above Coptis saxicola endophytic fungus, including the following steps:

[0011] S1. Place the Coptis saxicola tissue in Medium 1 and culture it, and observe every day whether colonies grow out.

[0012] S2. Whenever a new colony grows out, transfer the new colony to Medium 2 for purification culture until the colony morphology grown in Medium 2 is completely consistent, and a single Coptis saxicola endophytic fungus is obtained.

[0013] Preferably, in S1, Medium 1 is a potato dextrose agar medium containing streptomycin sulfate, a corn meal agar medium containing streptomycin sulfate, and an NGA medium containing streptomycin sulfate.

[0014] Preferably, in the potato dextrose agar medium containing streptomycin sulfate, the corn meal agar medium containing streptomycin sulfate, and the NGA medium containing streptomycin sulfate, the concentration of streptomycin sulfate is 0.01 - 0.07 g of streptomycin sulfate per 200 mL of the medium; preferably 0.03 - 0.05 g of streptomycin sulfate per 200 mL of the medium.

[0015] The above-mentioned potato dextrose agar medium, corn meal agar medium, and NGA medium are all commonly used media in the art, and can all be purchased from the market or prepared according to the formula by oneself.

[0016] Preferably, in S1, the Coptis saxicola tissue is Coptis saxicola stem tissue, Coptis saxicola leaf tissue, Coptis saxicola root tissue, or Coptis saxicola fruit tissue.

[0017] Preferably, in S1, the culture temperature is 24 - 28 °C and the culture time is 7 - 15 days.

[0018] Preferably, in S2, the medium 2 is potato dextrose agar medium.

[0019] In the above S1, the Coptis saxicola tissue needs to be surface disinfected and then placed in the medium 1 for culture under sterile conditions.

[0020] The specific steps of the above-mentioned surface disinfection treatment of the tissue are as follows: Take the Coptis saxicola tissue, wash the dust and soil on the surface with distilled water, dry the water on the surface of the Coptis saxicola tissue, then wipe the surface of the tissue with 70 - 80% alcohol, and then cut the Coptis saxicola tissue into tissue blocks under sterile conditions; each tissue block is disinfected with 70 - 80% alcohol for 1.5 - 2.5 min, then disinfected with 1 - 2% sodium hypochlorite aqueous solution for 1.5 - 2.5 min, then disinfected with 0.05 - 0.2% mercuric chloride aqueous solution for 10 s - 5 min, and finally wash each tissue block with sterile water to obtain the disinfected tissue.

[0021] The above-mentioned 70 - 80% alcohol, 1 - 2% sodium hypochlorite aqueous solution, and 0.05 - 0.2% mercuric chloride aqueous solution are all disinfectants; during the above-mentioned surface disinfection treatment of the tissue, each time a different disinfectant is changed, the tissue block is first washed 3 - 4 times with sterile water and the excess water is blotted dry with sterile filter paper before the next disinfection.

[0022] During the above-mentioned surface disinfection treatment of the tissue, in order to determine whether the tissue block is thoroughly disinfected, two groups of controls are set respectively: The first group of control: Pipette 100 μL of the sterile water used to wash the tissue block for the last time onto a fresh sterile PDA plate, and spread it evenly with a sterile spreader, then place it in an incubator and incubate at 24 - 28 °C to observe whether colonies grow; The second group of control: Using the pressing method, place the disinfected tissue block onto a fresh sterile PDA plate, press it slightly, remove the tissue block after 20 minutes, place it in an incubator and incubate at 24 - 28 °C to observe whether colonies grow. Three parallel samples are set for each group of control. When no colonies grow in both groups of control, it indicates that the tissue block has been thoroughly disinfected.

[0023] The purification culture in the above S2 refers to repeated subculture with medium 2 for purification culture until the colony morphologies grown in medium 2 are completely consistent.

[0024] The temperature for each subculture above is 24 - 28 °C. Each time when the colony volume accounts for 77 - 88% of the medium volume during subculture, stop the culture, and then transfer it to a new medium 2 for culture. Preferably, each subculture lasts for 5 - 14 days to make the colony volume account for 77 - 88% of the medium volume.

[0025] When the colony volume accounts for 77 - 88% of the medium volume above, it can also be calculated based on a petri dish with a diameter of 9 cm. When the mycelium grows to a diameter of 7 - 8 cm, stop the culture.

[0026] The above extraction method of Coptis saxicola Bunge endophytic fungi can obtain multiple purified strains; Rhizopus oryzae R01 and Cladosporium perangustum CP1 are screened out from them.

[0027] The present invention also proposes the application of the above-mentioned Coptis saxicola Bunge endophytic fungi in secreting lignocellulase, promoting the growth of Coptis saxicola Bunge, and antibacterial.

[0028] Lignocellulase is a multi-component complex enzyme system that plays a catalytic role in degrading lignocellulose, including both hydrolases related to cellulose and hemicellulose degradation and oxidases related to lignin degradation.

[0029] Preferably, the lignocellulase is at least one of exo-β-glucanase, endo-β-glucanase, β-glucosidase, xylanase, mannanase, and α-glucosidase.

[0030] The above exo-β-glucanase, endo-β-glucanase, and β-glucosidase belong to cellulase; the above xylanase, mannanase, and α-glucosidase belong to hemicellulase.

[0031] Preferably, the endophytic fungi of Corydalis saxicola are cultured in a medium containing sawdust of Corydalis saxicola, and lignocellulase is secreted and obtained.

[0032] Preferably, the antibacterial activity is to inhibit the growth of Escherichia coli and Bacillus subtilis.

[0033] Beneficial effects:

[0034] In the present invention, the endophytic fungi of Corydalis saxicola tissues are isolated and identified. As a result, a total of 274 endophytic fungi are traditionally isolated from the cultivated and wild species of Corydalis saxicola, which are divided into 3 phyla, 4 classes, 7 orders, 11 families, and 11 genera. Moreover, Rhizopus oryzae R01 and Cladosporium perangustum CP1 are successfully isolated, and it is found that they can secrete and generate lignocellulase, can also promote the growth of Corydalis saxicola and increase the yield of Corydalis saxicola; and it is found that Rhizopus oryzae R01 and Cladosporium perangustum CP1 both have good antibacterial properties against Escherichia coli and Bacillus subtilis. Description of the drawings

[0035] Figure 1 Pictures of 1-fold and 20-fold magnifications of Rhizopus oryzae R01 under a microscope.

[0036] Figure 2 Pictures of 1-fold and 20-fold magnifications of Cladosporium perangustum CP1 under a microscope.

[0037] Figure 3 Photos of the roots of Corydalis saxicola cultured in a medium with different streptomycin sulfate concentrations for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0038] Figure 4 Photos of the fruits of Corydalis saxicola cultured in a medium with different streptomycin sulfate concentrations for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0039] Figure 5 Photos of the stems of Corydalis saxicola cultured in a medium with different streptomycin sulfate concentrations for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0040] Figure 6Photographs of Corydalis saxicola Bunting leaves cultured in media with different concentrations of streptomycin sulfate for 10 days. Among them, the concentrations of streptomycin sulfate in a - e are 0g, 0.01g, 0.03g, 0.05g, and 0.07g in sequence.

[0041] Figures 7 - 12 Graphs showing the enzyme activities of exo - β - glucanase, endo - β - glucanase, β - glucosidase, xylanase, mannanase, and α - glucosidase in the crude enzyme solutions of the endophytic fungus Rhizopus oryzae R01 and Cladosporium perangustum CP1 of Corydalis saxicola Bunting in sequence. Among them, CK is the control group, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1.

[0042] Figure 13 Pictures of the antibacterial clear zones when the endophytic fungi Rhizopus oryzae R01 and Cladosporium perangustum CP1 of Corydalis saxicola Bunting confront Escherichia coli for 7 days. Among them, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1.

[0043] Figure 14 Pictures of the antibacterial clear zones when the endophytic fungi Rhizopus oryzae R01 and Cladosporium perangustum CP1 of Corydalis saxicola Bunting confront Bacillus subtilis for 7 days. Among them, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1. Detailed implementation mode

[0044] Next, the technical solutions of the present invention will be described in detail through specific examples.

[0045] Example 1

[0046] Extract a large number of endophytic fungi from Corydalis saxicola Bunting, including the following steps:

[0047] Take the stems, leaves, roots, and fruit tissues of wild Coptis saxicola (obtained from Badong County, Hubei Province) and cultivated Coptis saxicola (obtained from wild Coptis saxicola in Badong County, Hubei Province and then cultivated and domesticated in the experimental greenhouse of Anqing Normal University). Rinse them thoroughly with distilled water to remove the dust and soil on the surface. Then, use absorbent paper to dry the excess water and wipe the surface of each tissue with 75% alcohol. Then, transfer each tissue to a laminar flow hood. Use sterile scissors and scalpels to cut each tissue into tissue blocks with a size of approximately 0.2×0.5 cm, depending on the tissue size. A total of 720 tissue blocks are cut.

[0048] Disinfect each tissue block with 75% alcohol for 2 minutes, then disinfect with 2% sodium hypochlorite aqueous solution for 2 minutes, and then disinfect with 0.2% mercuric chloride aqueous solution for 1 minute (each time a new disinfectant is used, first wash the tissue block 3 times with sterile water and dry the excess water with sterile filter paper before proceeding with the next disinfection). After the disinfection with mercuric chloride aqueous solution is completed, wash the tissue block 4 times with sterile water to obtain disinfected tissue blocks.

[0049] To determine whether the tissue blocks are thoroughly disinfected, set up two groups of controls: The first group of control: Pipette 100 μL of the sterile water used to wash the tissue blocks for the last time onto a fresh sterile PDA plate, and spread it evenly with a sterile spreader. Place it in an incubator and incubate at 24 - 28°C to observe whether colonies grow. The second group of control: Using the pressing method, place the disinfected tissue block on a fresh sterile PDA plate, press it slightly, remove the tissue block after 20 minutes, place it in an incubator, and incubate at 24 - 28°C to observe whether colonies grow. Each group of controls has three parallel samples. When no colonies grow in both groups of controls, it indicates that the tissue blocks have been thoroughly disinfected.

[0050] Under sterile conditions, place the disinfected tissue blocks in potato dextrose agar medium containing streptomycin sulfate, corn meal agar medium containing streptomycin sulfate, and NGA medium containing streptomycin sulfate (the concentration of streptomycin sulfate in each medium is 0.05 g of streptomycin sulfate in 200 mL of medium to inhibit the growth of bacteria). Place one tissue block in each petri dish and incubate at 26 - 28°C for 15 days. Observe whether colonies grow every day. When new colonies grow, transfer them to a new potato dextrose agar medium (i.e., PDA medium) without streptomycin sulfate and repeatedly transfer (generally, it needs to be transferred more than 3 generations) to purify them until the colony morphology of the grown colonies is completely consistent, obtaining purified pure single strains. Inoculate each purified strain into a PDA slant and store it in a 4°C refrigerator for later use.

[0051] Example 2 (Identification)

[0052] According to the method of Example 1, a total of 720 tissue blocks were collected from different tissue parts of wild and cultivated Coptis saxicola, and 274 endophytic fungi were isolated. Among them, 157 endophytic fungi obtained from wild Coptis saxicola and 117 endophytic fungi obtained from cultivated Coptis saxicola were respectively subjected to morphological identification and molecular biological identification.

[0053] Finally, it was determined that the endophytic fungal strains of wild and cultivated Coptis saxicola belonged to 3 phyla, 4 classes, 7 orders, 11 families, and 11 genera. The isolated endophytic fungal strains of Coptis saxicola were respectively affiliated with Epicoccum, Alternaria, Cladosporium, Fusarium, Trichoderma, Myrothecium, Chaetomium, Plectosphaerella, Peniophora, Irpex, Rhizopus. They were commonly distributed in 5 genera, including Alternaria, Cladosporium, Fusarium, Myrothecium, Plectosphaerella.

[0054] And Rhizopus oryzae R01 and Cladosporium perangustum CP1 were obtained from the dominant strains, and their morphological identification results Figures 1 - 2 are shown Figure 1 as the pictures of Rhizopus oryzae R01 at 1× and 20× under the microscope. Figure 2 are the pictures of Cladosporium perangustum CP1 at 1× and 20× under the microscope.

[0055] It can be seen from Figure 1 that the colony of Rhizopus oryzae R01 is loose, initially white to yellow, then brown, prostrate, colorless; the rhizoids are well-developed and branched rhizoidally.

[0056] It can be seen from Figure 2 that the colony of Cladosporium perangustum CP1 is woolly, spreading around, and the color gradually turns black; the mycelium is branched and has hyphae; the mycelium is branched and the conidia grow in strings towards the top.

[0057] The ITS deoxyribonucleic acid sequence of Rhizopus oryzae R01 is: TTACCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGTACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTTCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTGATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTTTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGTAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0058] The ITS deoxyribonucleic acid sequence of Cladosporium perangustum CP1 is: CTACCNCCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCGTAAAACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0059] Example 3

[0060] When the inventors extracted the endophytic fungi of Corydalis saxicola, they found that the concentration of streptomycin sulfate in the culture medium had a great influence on the extraction of endophytic fungi.

[0061] Referring to step S1 of Example 1, adjust the concentration of streptomycin sulfate in the potato dextrose agar medium containing streptomycin sulfate (0 g, 0.01 g, 0.03 g, 0.05 g, 0.07 g streptomycin sulfate in 200 mL of culture medium respectively), and culture them at 26 °C for 10 days respectively, and observe the growth of the mixed fungal colonies in the culture medium.

[0062] The results are as Figures 3 - 6 shown, Figure 3 are photos of Corydalis saxicola roots cultured in culture media with different concentrations of streptomycin sulfate for 10 days. Among them, the concentrations of streptomycin sulfate in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0063] It can be seen from Figure 3 that when no streptomycin sulfate is added ( Figure 3a), After 10 days of cultivation, no endophytic fungi grow in the roots of Corydalis saxicola Bunting; when the concentration of streptomycin sulfate is 0.01 g ( Figure 3 b), After 10 days of cultivation, endophytic fungi can grow in the roots of Corydalis saxicola Bunting, but bacteria also grow; when the concentration of streptomycin sulfate is 0.03 g ( Figure 3 c), After 10 days of cultivation, endophytic fungi can grow in the roots of Corydalis saxicola Bunting, with a single strain of fungi, and the single strain can cover the petri dish; when the concentration of streptomycin sulfate is 0.05 g ( Figure 3 d), After 10 days of cultivation, multiple endophytic fungi can grow in the roots of Corydalis saxicola Bunting. After subculturing 3 times repeatedly, the endophytic fungi that grow each time are different; when the concentration of streptomycin sulfate is 0.07 g ( Figure 3 e), After 10 days of cultivation, multiple endophytic fungi can grow in the roots of Corydalis saxicola Bunting. After subculturing 3 times repeatedly, sometimes endophytic fungi grow, and sometimes some endophytic fungi do not grow. Summary: The level of streptomycin sulfate concentration added to the culture medium affects the growth of endophytic fungi in the roots of Corydalis saxicola Bunting.

[0064] Figure 4 Photos of Corydalis saxicola Bunting fruits cultivated in culture media with different concentrations of streptomycin sulfate for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0065] From Figure 4 it can be seen that: when no streptomycin sulfate is added ( Figure 4 a), After 10 days of cultivation, no endophytic fungi grow in the fruit tissues of Corydalis saxicola Bunting; when the concentration of streptomycin sulfate is 0.01 g ( Figure 4 b), When cultivating the fruit tissues of Corydalis saxicola Bunting for 10 days, the growth of its endophytic fungi is slow; when the concentration of streptomycin sulfate is 0.03 g ( Figure 4 c), After 10 days of cultivation, multiple endophytic fungi can grow in the fruit tissues of Corydalis saxicola Bunting; when the concentration of streptomycin sulfate is 0.05 g ( Figure 4 d), After 10 days of cultivation, endophytic fungi can grow in the fruit tissues of Corydalis saxicola Bunting. After subculturing 3 times repeatedly, the endophytic fungi that grow each time are the same; when the concentration of streptomycin sulfate is 0.07 g ( Figure 4 e), After 10 days of cultivation, endophytic fungi can grow in the fruit tissues of Corydalis saxicola Bunting. After subculturing 3 times repeatedly, the growth of endophytic fungi is slow. Summary: The level of streptomycin sulfate concentration added to the culture medium affects the growth of endophytic fungi in the fruit tissues of Corydalis saxicola Bunting, and at the same time, it is also found that there are not many endophytic fungi growing in the fruit tissues.

[0066] Figure 5 Photos of Corydalis saxicola Bunting stems cultivated in culture media with different concentrations of streptomycin sulfate for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0067] FromFigure 5 It can be seen that when streptomycin sulfate is not added ( Figure 5 a), no endophytic fungi grow in the stem tissue of Corydalis saxicola Bunting after 10 days of cultivation; when the concentration of streptomycin sulfate is 0.01 g ( Figure 5 b), endophytic fungi can grow in the stem tissue of Corydalis saxicola Bunting after 10 days of cultivation, but bacteria also grow; when the concentration of streptomycin sulfate is 0.03 g ( Figure 5 c), multiple endophytic fungi can grow in the stem tissue of Corydalis saxicola Bunting after 10 days of cultivation; when the concentration of streptomycin sulfate is 0.05 g ( Figure 5 d), endophytic fungi can grow in the stem tissue of Corydalis saxicola Bunting after 10 days of cultivation, but the endophytic fungi that grow are not abundant, and after repeated subculturing 3 times, the endophytic fungi that grow each time are the same; when the concentration of streptomycin sulfate is 0.07 g ( Figure 5 e), a single endophytic fungus can grow in the stem tissue of Corydalis saxicola Bunting after 10 days of cultivation, and after repeated subculturing 3 times, the endophytic fungi that grow each time are the same. In summary, the level of streptomycin sulfate concentration added to the culture medium affects the growth of endophytic fungi in the stem tissue of Corydalis saxicola Bunting. When the concentration of streptomycin sulfate is 0.03 g, the endophytic fungi that grow are more abundant and diverse. When the concentration of streptomycin sulfate is 0.05 g, it is more stable after subculturing.

[0068] Figure 6 Photographs of Corydalis saxicola Bunting leaves cultivated in culture media with different concentrations of streptomycin sulfate for 10 days. Among them, the streptomycin sulfate concentrations in a - e are 0 g, 0.01 g, 0.03 g, 0.05 g, and 0.07 g in sequence.

[0069] From Figure 6 It can be seen that when streptomycin sulfate is not added ( Figure 6 a), no endophytic fungi grow in the leaf tissue of Corydalis saxicola Bunting after 10 days of cultivation; when the concentration of streptomycin sulfate is 0.01 g ( Figure 6 b), endophytic fungi can grow in the leaf tissue of Corydalis saxicola Bunting after 10 days of cultivation, but bacteria also grow; when the concentration of streptomycin sulfate is 0.03 g ( Figure 6 c), endophytic fungi can grow in the leaf tissue of Corydalis saxicola Bunting after 10 days of cultivation, and the strains are single; when the concentration of streptomycin sulfate is 0.05 g ( Figure 6 d), endophytic fungi can grow in the leaf tissue of Corydalis saxicola Bunting after 10 days of cultivation, and after repeated subculturing 3 times, the endophytic fungi that grow each time are the same; when the concentration of streptomycin sulfate is 0.07 g ( Figure 6 e), multiple endophytic fungi can grow in the leaf tissue of Corydalis saxicola Bunting after 10 days of cultivation, and after repeated subculturing 3 times, sometimes endophytic fungi grow, and sometimes some endophytic fungi do not grow. In summary: The level of streptomycin sulfate concentration added to the culture medium affects the growth of endophytic fungi in the leaf tissue of Corydalis saxicola Bunting; when the concentration of streptomycin sulfate is 0.03 - 0.05 g, it is more stable after subculturing of the leaf tissue of Corydalis saxicola Bunting.

[0070] It can be seen from Figures 3 - 6 that when the concentration of streptomycin sulfate is 0.03 g or 0.05 g, the growth of endophytic fungi in the roots, fruits, stems and leaves of Corydalis saxicola is relatively vigorous; when the concentration is too high or too low, the growth effect of endophytic fungi will be reduced; no endophytic fungi can be obtained without adding streptomycin sulfate.

[0071] Example 4

[0072] The performance of Rhizopus oryzae R01 and Cladosporium perangustum CP1 was investigated, and it was found that they have the function of secreting and generating lignocellulase. The specific experimental steps are as follows:

[0073] S1. Take Rhizopus oryzae R01 and Cladosporium perangustum CP1, and inoculate them into the seed medium (the seed medium is 20 g of peptone, 10 g of sodium carboxymethylcellulose, 5 g of NaCl, 1 g of KH2PO4, made up to 1000 mL with sterile water, and sealed in 300 mL Erlenmeyer flasks according to the aliquot of 130 mL, sealed, autoclaved at 121 °C for 30 min, and reserved) respectively. Cultivate at 28 °C and 150 rpm until the mycelia grow mature. Then take the strains in the seed medium and inoculate them into the enzyme-producing medium (the enzyme-producing medium is 10 g of peptone, 15 g of yeast extract, 10 g of sodium carboxymethylcellulose, 2 g of Corydalis saxicola sawdust, 5 g of NaCl, 1 g of KH2PO4, pH = 7, made up to 1000 mL with sterile water, and sealed in 300 mL Erlenmeyer flasks according to the aliquot of 130 mL, sealed, autoclaved at 121 °C for 30 min, and reserved) respectively. Cultivate at 28 °C for 2 - 12 d, remove the thalli, and obtain the crude enzyme solutions of the strains respectively;

[0074] S2. Do not add Corydalis saxicola sawdust to the enzyme-producing medium, and then inoculate Rhizopus oryzae R01 and Cladosporium perangustum CP1 respectively according to the steps of S1 to prepare the crude enzyme solutions of the strains as the control group;

[0075] S3. Prepare glucose standard solutions with concentrations of 0.25 - 3.0 mg / mL and D-xylose standard solutions with concentrations of 0.4 - 2.5 mg / mL. Use a microplate reader (Multiskan GO full-wavelength microplate reader, preheat the microplate reader for more than 30 min, and zero with distilled water) to measure the absorbance values of each standard solution at 540 nm. Take the optical density value as the ordinate y and the glucose concentration or D-xylose concentration as the abscissa x to obtain the linear regression equation. The glucose regression equation is: y = 1.3050x - 0.0655, and the correlation coefficient R 2= 0.9958, and the regression equation for D-xylose is: y = 1.1195x - 0.0932, with the correlation coefficient R 2 = 0.998;

[0076] S4. Determination of cellulase activity

[0077] The method for detecting the activity of exo-β-glucanase is as follows: Take 25 μL of the crude enzyme solution of the strains in S1 and S2, and mix them with 50 μL of the substrate solution (2% microcrystalline cellulose solution) respectively. Place them in a 50°C constant temperature water bath for a water bath reaction for 2 h, add 75 μL of DNS color-developing solution and mix well, then place them in a boiling water bath for 5 min. After cooling, measure the absorbance value at a wavelength of 540 nm, and calculate the enzyme activity according to the regression equations of glucose and D-xylose; Detect the enzyme activity of the crude enzyme solution at the 2nd, 4th, 6th, 8th, 10th, and 12th days of culture respectively, and set 3 parallel samples for each detection; The enzyme activity unit is defined as the amount of enzyme required to release 1 μmol of reducing sugar by decomposing a specific substrate per minute;

[0078] The method for detecting the activity of endo-β-glucanase is as follows: Take 50 μL of the crude enzyme solution of the strains in S1 and S2, and mix them with 25 μL of the substrate solution (1% sodium carboxymethylcellulose solution) respectively. Place them in a 50°C constant temperature water bath for a water bath reaction for 30 min, and the others are the same as the method for detecting the activity of exo-β-glucanase;

[0079] The method for detecting the activity of β-glucosidase is as follows: Take 50 μL of the crude enzyme solution of the strains in S1 and S2, and mix them with 25 μL of the substrate solution (1% salicin solution) respectively. Place them in a 50°C constant temperature water bath for a water bath reaction for 30 min, and the others are the same as the method for detecting the activity of exo-β-glucanase;

[0080] S5. Determination of hemicellulase activity

[0081] The method for detecting xylanase activity is as follows: Take 67 μL of the crude enzyme solution of the strains in S1 and S2, and mix them with 33 μL of the substrate solution (0.8% xylan solution) respectively. Place them in a 50°C constant temperature water bath for a water bath reaction for 30 min, add 100 μL of DNS color-developing solution to mix well and terminate the reaction, and the others are the same as the method for detecting the activity of exo-β-glucanase.

[0082] The method for detecting mannanase activity is as follows: Take 67 μL of the crude enzyme solution of the strains in S1 and S2, and mix them with 33 μL of the substrate solution (0.8% mannan) respectively. The others are the same as the method for detecting xylanase activity.

[0083] The method for detecting α-glucosidase activity is as follows: Take 6.7 μL of the crude enzyme solution of the strains in S1 and S2, mix them with 60 μL of the substrate solution (0.4% pNPG solution, with the solvent being 50 mmol glycine-NaOH buffer, pH = 9.0) respectively, then add 66.7 μL of glycine-NaOH buffer (pH 9.0) and mix well. Place them in a 50 °C constant temperature water bath for a reaction of 60 min. Then add 66.7 μL of 1 M Na2CO3 solution and mix well to terminate the reaction. Then measure the absorbance value at a wavelength of 410 nm, and calculate the enzyme activity according to the regression equations of glucose and D-xylose; the others are the same as the method for detecting exo-β-glucanase activity.

[0084] The results of the secretion of lignocellulase by Rhizopus oryzae R01 and Cladosporium perangustum CP1 are as Figures 7 - 12 shown.

[0085] Figures 7 - 12 They are the enzyme activity result graphs of exo-β-glucanase, endo-β-glucanase, β-glucosidase, xylanase, mannanase, and α-glucosidase in the crude enzyme solution of the endophytic fungus Rhizopus oryzae R01 of Corydalis saxicola and the crude enzyme solution of Cladosporium perangustum CP1 in sequence. Among them, CK is the control group, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1.

[0086] It can be seen from Figure 7 that when there is no Corydalis saxicola sawdust in the medium, the control group CK does not produce enzyme activity. When there is Corydalis saxicola sawdust as the substrate in the medium, for Rhizopus oryzae R01 and Cladosporium perangustum CP1, the enzyme activity secretion of exo-β-glucanase is the largest on the 4th day, which are 53.6 and 44.28 U·mL -1 respectively, and the enzyme activity decreases on the 6th day, and the overall volatility of the enzyme activity of the two groups is relatively small.

[0087] It can be seen from Figure 8 that when there is no Corydalis saxicola sawdust in the medium, the control group CK does not produce enzyme activity. When there is Corydalis saxicola sawdust as the substrate in the medium, for Rhizopus oryzae R01 and Cladosporium perangustum CP1, the enzyme activity secretion of endo-β-glucanase is the largest on the 12th day, which are 104.28 and 94.83 U·mL -1, The enzyme activities of both groups of strains started to increase gradually from the 2nd day and reached the maximum on the 12th day.

[0088] It can be seen from Figure 9 that when there was no Coptis saxicola sawdust in the medium, the control group CK did not produce enzyme activity. When there was Coptis saxicola sawdust as a substrate in the medium, the enzyme activity of β-glucosidase secreted by Rhizopus oryzae R01 reached the maximum on the 6th day, which was 94.31 U·mL -1 . The enzyme activity of Rhizopus oryzae R01 strain started to increase gradually from the 2nd day and reached the maximum on the 6th day, and then gradually decreased after the 8th day;

[0089] The enzyme activity of β-glucosidase secreted by Cladosporium perangustum CP1 reached the maximum on the 10th day, which was 100.83 U·mL -1 , showing fluctuations at first, then gradually increasing, reaching the peak on the 10th day and then decreasing.

[0090] It can be seen from Figure 10 that when there was no Coptis saxicola sawdust in the medium, the control group CK did not produce enzyme activity. When there was Coptis saxicola sawdust as a substrate in the medium, the enzyme activity of xylanase secreted by Rhizopus oryzae R01 reached the maximum on the 2nd day, which was 185.78 U·mL -1 . The enzyme activity of Rhizopus oryzae R01 strain reached the peak on the 2nd day and then gradually decreased;

[0091] The enzyme activity of xylanase secreted by Cladosporium perangustum CP1 reached the maximum on the 10th day, which was 162.78 U·mL -1 , and there was a small peak of secretion before the 10th day, and after fluctuations, it reached the maximum on the 10th day.

[0092] It can be seen from Figure 11 that when there was no Coptis saxicola sawdust in the medium, the control group CK did not produce enzyme activity. When there was Coptis saxicola sawdust as a substrate in the medium, the enzyme activity of mannanase secreted by Rhizopus oryzae R01 reached the maximum on the 4th day, which was 117.16 U·mL -1 . The enzyme activity of Rhizopus oryzae R01 strain reached the peak on the 4th day and then showed fluctuating decreases in enzyme activity;

[0093] The enzyme activity secretion of Cladosporium perangustum CP1 for xylanase was the highest on the 12th day, reaching 123.26 U·mL -1 , showing a gradually increasing trend with fluctuations starting from the 2nd day and reaching the maximum peak on the 12th day.

[0094] It can be seen from Figure 12 that when there is no Coptis saxicola sawdust in the culture medium, the control group CK does not produce enzyme activity. When Coptis saxicola sawdust is used as a substrate in the culture medium, the enzyme activity secretion of Rhizopus oryzae R01 for α-glucosidase is the highest on the 12th day, reaching 47.7 U·mL -1 , and the enzyme activity of the Rhizopus oryzae R01 strain gradually increases and reaches the peak on the 12th day;

[0095] The enzyme activity secretion of Cladosporium perangustum CP1 for α-glucosidase is the highest on the 6th day, reaching 50.98 U·mL -1 , the enzyme activity of the strain gradually increases, reaches the secretion peak on the 6th day, and then shows a fluctuating decrease.

[0096] The overall results show that the endophytic fungi of Coptis saxicola, Rhizopus oryzae R01 and Cladosporium perangustum CP1, have good lignocellulose degradation effects on Coptis saxicola sawdust and can secrete lignocellulase.

[0097] The above-mentioned endophytic fungi of Coptis saxicola, Rhizopus oryzae R01 and Cladosporium perangustum CP1 can be used to improve the activity and yield of lignocellulase in Coptis saxicola; and can promote the growth of Coptis saxicola and improve its quality.

[0098] Example 5

[0099] Using the same method, the sizes of the antibacterial transparent circles of Rhizopus oryzae R01 and Cladosporium perangustum CP1 against Escherichia coli and Bacillus subtilis were investigated for 1 - 7 days respectively, and the results are shown in Table 1 and Figures 13 - 14 as follows.

[0100] Figure 13The photos show the antibacterial transparent zones when the endophytic fungi of Corydalis saxicola Bunge, Rhizopus oryzae R01 and Cladosporium perangustum CP1 confronted Escherichia coli for 7 days. Among them, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1.

[0101] Figure 14 The photos show the antibacterial transparent zones when the endophytic fungi of Corydalis saxicola Bunge, Rhizopus oryzae R01 and Cladosporium perangustum CP1 confronted Bacillus subtilis for 7 days. Among them, CS4 is Rhizopus oryzae R01, and CS8 is Cladosporium perangustum CP1.

[0102] Table 1 Growth of transparent zones when Rhizopus oryzae R01 and Cladosporium perangustum CP1 confronted Escherichia coli and Bacillus subtilis

[0103]

[0104] From Table 1 and Figures 13 - 14 it can be seen that the larger the diameter of the antibacterial transparent zone, the stronger the antibacterial activity of the endophytic fungi of Corydalis saxicola Bunge against Escherichia coli. The antibacterial zone is clear, regular in shape, and has a clear edge, which also indicates that the antibacterial activity of the endophytic fungi of Corydalis saxicola Bunge is good.

[0105] The endophytic fungi of Corydalis saxicola Bunge, Rhizopus oryzae R01 and Cladosporium perangustum CP1 show strong antibacterial effects against Escherichia coli, can effectively inhibit the growth of Escherichia coli, and have obvious inhibitory effects on Bacillus subtilis, indicating that the endophytic fungi of Corydalis saxicola Bunge, Rhizopus oryzae R01 and Cladosporium perangustum CP1 have broad-spectrum antibacterial properties. This characteristic provides broad prospects for their application in the fields of antibacterial agents, pesticides, environmental biological control agents, etc.

[0106] As mentioned above, the above is only the preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered by the protection scope of the present invention.

Claims

1. A corydalis saxicola endophytic fungus, characterized in that, Comprising: Rhizopus oryzae R01 and Cladosporium perangustum CP1, wherein the preservation number of Rhizopus oryzae R01 is CCTCC NO: M 2024891, and the preservation number of Cladosporium perangustum CP1 is CCTCC NO: M20242141.

2. A method for extracting the endophytic fungus of Corydalis saxicola Bunting as described in claim 1, characterized in that, Comprising the following steps: S1. Place the Coptis saxicola tissue in Medium 1 and culture it, observing daily whether colonies grow. S2. Whenever a new colony grows, transfer the new colony to Medium 2 for purification culture until the colony morphologies grown in Medium 2 are completely consistent, obtaining single-strain endophytic fungi of Coptis saxicola.

3. The extraction method of the endophytic fungus of Corydalis saxicola Bunting according to claim 2, wherein In S1, Medium 1 is a potato dextrose agar medium containing streptomycin sulfate, a cornmeal agar medium containing streptomycin sulfate, and an NGA medium containing streptomycin sulfate.

4. The extraction method of the endophytic fungi of Corydalis saxicola Bunting according to claim 3, wherein, In the potato dextrose agar medium containing streptomycin sulfate, the cornmeal agar medium containing streptomycin sulfate, and the NGA medium containing streptomycin sulfate, the concentration of streptomycin sulfate is 0.01 - 0.07 g of streptomycin sulfate per 200 mL of the medium.

5. The extraction method of the endophytic fungus of Corydalis saxicola Bunting according to any one of claims 2-4, characterized in that, In S1, the Coptis saxicola tissue is Coptis saxicola stem tissue, Coptis saxicola leaf tissue, Coptis saxicola root tissue, or Coptis saxicola fruit tissue.

6. The extraction method of the endophytic fungus of Corydalis saxicola Bunting according to any one of claims 2-5, characterized in that, In S1, the culture temperature is 24 - 28 °C, and the culture time is 7 - 15 days.

7. The extraction method of the endophytic fungus of Corydalis saxicola Bunting according to any one of claims 2-6, characterized in that, In S2, Medium 2 is a potato dextrose agar medium.

8. Use of the endophytic fungi of Coptis saxicola as described in claim 1 in secreting lignocellulase, promoting the growth of Coptis saxicola, and antibacterial.

9. The application according to claim 8, wherein The lignocellulase is at least one of exoglucanase, endoglucanase, β-glucosidase, xylanase, mannanase, and α-glucosidase; preferably, the endophytic fungi of Coptis saxicola are cultured in a medium containing Coptis saxicola sawdust to secrete and obtain lignocellulase.

10. The application according to claim 8, wherein The antibacterial is to inhibit the growth of Escherichia coli and Bacillus subtilis.

Images