Acinetobacter variants and application thereof

By screening and applying Acinetobacter mutation L49, the problem of low degradation efficiency of straw lignin is solved, and rapid and efficient straw utilization is achieved, with high economic and ecological value.

CN120330073APending Publication Date: 2025-07-18SUZHOU YIXI BIOTECH CO LTD
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202311771921.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-21
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

The prior art has problems such as long processing time and low decomposition efficiency in the degradation of straw lignin. Physical and chemical methods have problems such as unfriendly and high cost, and biological laws are difficult to achieve efficient degradation.

Method used

Using Acinetobacter mutation L49, efficient degradation of lignin in straws is achieved by rapid growth in cheap medium and fermentation under specific conditions. Its 16S rRNA gene sequence is used to screen and strains with efficient degradation ability are screened in lignin medium.

Benefits of technology

It achieves rapid and stable degradation of lignin, improves straw utilization rate, has high economic and ecological value, high degradation efficiency and short fermentation cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330073A_ABST
    Figure CN120330073A_ABST
Patent Text Reader

Abstract

The invention relates to an Acinetobacter variants L49. The Acinetobacter variants L49 can rapidly and stably grow by utilizing a cheap culture medium, the fermentation period is short, and the lignin degradation efficiency is high. The strain can be used for degrading straws by a biological method, improves the utilization rate of the straws, and has very high economic value and ecological value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to a mutant Acinetobacter and its application. Background Art

[0002] China is a large agricultural country and one of the countries with the richest straw resources. However, so far, the utilization rate of crop straw is relatively low, and a considerable part of it is directly burned. Therefore, the scientific development and utilization of straw resources can not only alleviate the shortage of rural feed, fertilizer, fuel and industrial raw materials, but also be an urgent requirement for protecting the rural ecological environment and promoting the sustainable and coordinated development of agriculture.

[0003] Crop straw is rich in lignin, which is a kind of high molecular polymer with relatively high mechanical strength. It cross-links with hemicellulose and embeds cellulose in it, forming strong ester bonds or ether bonds to form a dense outer matrix, which hinders the degradation of cellulose and hemicellulose by microorganisms and enzymes. Therefore, this special complex of lignin-cellulose-hemicellulose in the straw cell wall limits the degradation and utilization of cellulose, hemicellulose and other components by animal microorganisms, so that the nutrients in the straw cells cannot be released, resulting in low digestibility of straw. The main components of straw are cellulose, hemicellulose and lignin. Although lignin accounts for a small proportion, its protective effect on straw is very strong and it can form chemical bonds with cellulose and hemicellulose. To improve the degradation rate of straw, it is necessary to first remove the protective effect of lignin on cellulose and hemicellulose.

[0004] Currently, the commonly used lignin treatment methods mainly include physical methods, chemical methods, biological methods, or combined treatment of multiple methods. Although these methods have increased the utilization rate of biomass resources to a certain extent, there are still many drawbacks in the operation process. Physical methods include crushing, steam explosion, ultrasonic method, microwave radiation, γ-ray radiation, which mainly generate short-term local high temperature, high pressure and rapid temperature changes inside lignin to break the structural stability of lignin and cause chemical reactions. However, the effect of this method is unstable and the noise is harmful to the environment, making it difficult to be industrially amplified and applied. Chemical methods degrade lignin by destroying some chemical bonds in lignin with some strong acids and alkalis. However, this method is not friendly to the environment. In addition, there are problems such as high cost and difficulty in recycling reagents after use.

[0005] Compared with traditional physical and chemical methods, the biological method for degrading lignin with low energy consumption, high cleanliness and environmental friendliness is becoming a research hotspot. However, the current biological method for decomposing lignin has problems such as long treatment time and low decomposition efficiency.

[0006] Therefore, it is of great significance to develop an effective method for isolating lignin-degrading bacteria and screen lignin-degrading bacteria with high degradation efficiency and short fermentation cycle. Summary of the Invention

[0007] In view of the deficiencies of the prior art, the present invention provides a strain of Acinetobacter variabilis L49 with high efficiency in degrading lignin. Another object of the present invention is to provide the application of the above-mentioned Acinetobacter variabilis L49 in degrading medium lignin.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides a strain of Acinetobacter variabilis L49, which is classified and named as Acinetobacter variabilis. The said Acinetobacter variabilis is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC NO.28700, the deposit date of October 23, 2023, and the deposit address being the Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.

[0010] Deposit description:

[0011] Deposit number: CGMCC NO.28700;

[0012] Deposit unit code: CGMCC - General Microbiological Center of the China Committee for Culture Collection of Microorganisms;

[0013] Deposit date: October 23, 2023;

[0014] Deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences;

[0015] Classification and naming: Acinetobacter variabilis;

[0016] Deposit status: Alive.

[0017] Preferably, the 16S rRNA gene sequence of the said Acinetobacter variabilis is as shown in SEQ ID NO.1.

[0018] In the second aspect, the present invention provides a method for isolating and screening the Acinetobacter variabilis L49 described in the first aspect, including the following steps:

[0019] (1) Sampling and collection;

[0020] (2) Strain isolation;

[0021] (3) Strain screening;

[0022] (4) Strain identification.

[0023] Preferably, in step (2), the separation is carried out using a lignin medium, and the formula of the lignin medium is as follows: each liter of the medium contains 1-4 g of alkaline lignin, 0.2-2 g of potassium dihydrogen phosphate, 0.2-2 g of dipotassium hydrogen phosphate, 0.5-5 g of sodium chloride, 0.1-1 g of magnesium chloride hexahydrate, 0.2-2 g of ammonium chloride, 0.04-0.4 g of calcium chloride, 1 mL of trace elements, 15 g of agar, and 100-500 μL of vitamin B 12 , and the formula of the trace elements is as follows: boric acid 30-210 mg / L, cobalt chloride hexahydrate 20-140 mg / L, manganese chloride tetrahydrate 50-350 mg / L, zinc chloride 40-280 mg / L, nickel chloride hexahydrate 20-140 mg / L, sodium molybdate dihydrate 15-110 mg / L, copper chloride dihydrate 2-14 mg / L, ferrous sulfate heptahydrate 1-15 mg / L, and the concentration of the vitamin B 12 is 100 mg / L;

[0024] In step (3), the screening is carried out using a PDA-aniline blue plate for color development.

[0025] In a third aspect, the present invention provides a bacterial agent, comprising the Acinetobacter variabilis L49 described in the first aspect and / or the fermentation broth of the Acinetobacter variabilis L49.

[0026] In a fourth aspect, the present invention provides an application of the Acinetobacter variabilis L49 described in the first aspect or the bacterial agent described in the third aspect in lignin degradation.

[0027] Preferably, the application is to use the Acinetobacter variabilis L49 or the fermentation broth containing the Acinetobacter variabilis L49 to degrade lignin in straw.

[0028] In a fifth aspect, the present invention provides a method for degrading straw lignin, and the method comprises the following steps:

[0029] (1) Inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium for culture to obtain an Acinetobacter variabilis L49 bacterial suspension;

[0030] (2) Inoculate the Acinetobacter variabilis L49 bacterial suspension obtained in step (1) into a fermentation medium containing straw for fermentation culture.

[0031] More preferably, in step (2), the inoculation is carried out with an inoculum size of 3-6% by volume of the Acinetobacter variabilis L49 bacterial suspension.

[0032] More preferably, in step (2), the fermentation culture is carried out under the conditions of 35-40 °C and 100-200 rpm.

[0033] Preferably, in step (2), the formula of the fermentation medium is as follows: each liter of the medium contains 50 - 150 g of straw powder, 0.6 - 6 g of potassium dihydrogen phosphate, 0.6 - 6 g of dipotassium hydrogen phosphate, 1.5 - 15 g of sodium chloride, 0.3 - 3 g of magnesium chloride hexahydrate, 0.6 - 6 g of ammonium chloride, 0.12 - 1.2 g of calcium chloride, 3 mL of trace elements, and 0.3 - 1.5 mL of vitamin B 12 .

[0034] Preferably, step (1) specifically includes the following steps:

[0035] Inoculate the activated Acinetobacter variabilis L49 into the lignin liquid medium, and culture it at 35 - 40 °C and 150 - 300 rpm for 10 - 16 h to obtain a seed solution; then, inoculate the seed solution into the lignin liquid medium according to an inoculation amount of 1 - 3% by volume, and culture it at 35 - 40 °C and 150 - 300 rpm for 24 - 48 h to obtain the Acinetobacter variabilis L49 bacterial suspension.

[0036] Preferably, the formula of the lignin liquid medium is as follows: each liter of the medium contains 1 - 4 g of alkaline lignin, 0.2 - 2 g of potassium dihydrogen phosphate, 0.2 - 2 g of dipotassium hydrogen phosphate, 0.5 - 5 g of sodium chloride, 0.1 - 1 g of magnesium chloride hexahydrate, 0.2 - 2 g of ammonium chloride, 0.04 - 0.4 g of calcium chloride, 1 mL of trace elements, and 100 - 500 μL of vitamin B 12 .

[0037] Further preferably, the formula of the trace elements is boric acid 30 - 210 mg / L, cobalt chloride hexahydrate 20 - 140 mg / L, manganese chloride tetrahydrate 50 - 350 mg / L, zinc chloride 40 - 280 mg / L, nickel chloride hexahydrate 20 - 140 mg / L, sodium molybdate dihydrate 15 - 110 mg / L, copper chloride dihydrate 2 - 14 mg / L, and ferrous sulfate heptahydrate 1 - 15 mg / L.

[0038] Further preferably, the concentration of the vitamin B 12 is 100 mg / L.

[0039] Effects of the Invention

[0040] The Acinetobacter variabilis L49 provided by the present invention can grow rapidly and stably under suitable conditions using an inexpensive medium. When it is applied to degrade lignin, it has the advantages of rapid degradation of lignin in a short time, high lignin degradation rate, and short growth cycle. The Acinetobacter variabilis L49 provided by the present invention can be used for biological pretreatment of straw to improve the utilization rate of straw, and has high economic value and ecological value. Description of the Drawings

[0041] Figure 1This is the colony morphology diagram of the mutant Acinetobacter L49 of the present invention;

[0042] Figure 2 This is the aniline blue plate chromogenic diagram of the mutant Acinetobacter L49 of the present invention;

[0043] Figure 3 This is the 16S rRNA identification electrophoresis diagram of the mutant Acinetobacter L49 of the present invention;

[0044] Figure 4 This is the phylogenetic tree of the mutant Acinetobacter L49 of the present invention;

[0045] Figure 5 This is the broken line diagram of the lignin degradation efficiency of the mutant Acinetobacter L49 of the present invention;

[0046] Figure 6 This is the growth curve of the mutant Acinetobacter L49 of the present invention. Detailed Embodiments

[0047] To make the technical solutions and beneficial effects of the present invention more obvious and understandable, the following will be described in detail by listing specific embodiments. Among them, the drawings are not necessarily drawn to scale, and local features can be enlarged or reduced to more clearly show the details of local features; unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical and scientific fields to which this application belongs.

[0048] The inventor conducted extensive and in-depth research and unexpectedly found that after diluting buffalo rumen fluid by 10 5 times, it was spread on a lignin screening plate and placed in a constant temperature incubator at 39 °C for 24 h. After 24 h, single colonies grew on the plate. Single colonies with different morphologies were picked and streaked on the lignin screening plate, and then cultured for another 24 h. This step was repeated until there was only one type of single colony with the same morphology on the plate. The single colonies were picked for PCR bacterial species identification and sequencing. The samples with normal sequencing were subjected to sequence alignment and retrieval of relevant bacterial species information. The selected bacterial species were cultured in a lignin liquid medium, and the lignin degradation efficiency and lignin enzyme activity were detected. The bacterial species with high lignin degradation efficiency were selected for further research. Based on this, the technical solutions of this application were proposed.

[0049] In the first aspect, the present invention provides a mutant Acinetobacter L49, whose taxonomic name is Acinetobacter variabilis. The mutant Acinetobacter is deposited in the China General Microbiological Culture Collection Center, with the deposit number CGMCC NO. 28700, the deposit date being October 23, 2023, and the deposit address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences.

[0050] In some embodiments, the Acinetobacter variabilis L49 is screened from the gastric juice of buffalo rumen.

[0051] The Acinetobacter variabilis L49 provided in this application has the Latin scientific name Acinetobacter variabilis. The culture temperature is 30 - 45°C, and it grows rapidly on the lignin screening medium. The present invention expands the strain library of lignin-degrading bacteria, which is beneficial to further improving the in-depth application of bacteria in the field of lignin degradation.

[0052] Depositing description:

[0053] Deposit number: CGMCC NO.28700;

[0054] Depositary institution code: CGMCC - China General Microbiological Culture Collection Center;

[0055] Deposit date: October 23, 2023;

[0056] Deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences;

[0057] Taxonomic naming: Acinetobacter variabilis;

[0058] Deposit status: Alive.

[0059] In some embodiments, the 16S rRNA gene sequence of the Acinetobacter variabilis is as shown in SEQ ID NO.1.

[0060] SEQ ID NO.1:

[0061]

[0062] In a second aspect, the present invention provides a method for isolating and screening the mutant Acinetobacter L49 described in the first aspect, comprising the following steps:

[0063] (1) Sampling and collection;

[0064] (2) Strain isolation;

[0065] (3) Strain screening;

[0066] (4) Strain identification.

[0067] In some embodiments, in step (2), the lignin medium is used for the isolation, and the formula of the lignin medium is as follows: each liter of the medium contains 1 - 4 g of alkaline lignin, 0.2 - 2 g of potassium dihydrogen phosphate, 0.2 - 2 g of dipotassium hydrogen phosphate, 0.5 - 5 g of sodium chloride, 0.1 - 1 g of magnesium chloride hexahydrate, 0.2 - 2 g of ammonium chloride, 0.04 - 0.4 g of calcium chloride, 1 mL of trace elements, 15 g of agar, 100 - 500 μL of vitamin B 12 , and the formula of the trace elements is boric acid 30 - 210 mg / L, cobalt chloride hexahydrate 20 - 140 mg / L, manganese chloride tetrahydrate 50 - 350 mg / L, zinc chloride 40 - 280 mg / L, nickel chloride hexahydrate 20 - 140 mg / L, sodium molybdate dihydrate 15 - 110 mg / L, copper chloride dihydrate 2 - 14 mg / L, ferrous sulfate heptahydrate 1 - 15 mg / L, and the concentration of the vitamin B 12 solution is 100 mg / L.

[0068] In some embodiments, the formula of the lignin medium in step (2) is as follows: each liter of the medium contains 2 g of alkaline lignin, 2 g of potassium dihydrogen phosphate, 2 g of dipotassium hydrogen phosphate, 5 g of sodium chloride, 1 g of magnesium chloride hexahydrate, 2 g of ammonium chloride, 0.4 g of calcium chloride, 1 mL of trace elements, 15 g of agar, 100 μL of vitamin B 12 ; the formula of the trace elements is boric acid 50 mg / L, cobalt chloride hexahydrate 100 mg / L, manganese chloride tetrahydrate 100 mg / L, zinc chloride 200 mg / L, nickel chloride hexahydrate 50 mg / L, sodium molybdate dihydrate 20 mg / L, copper chloride dihydrate 5 mg / L, ferrous sulfate heptahydrate 10 mg / L, and the concentration of the vitamin B 12 solution is 100 mg / L.

[0069] In some embodiments, in step (3), the screening is carried out using a PDA - aniline blue plate for color development.

[0070] In some embodiments, the formulation of the PDA-aniline blue plate is as follows: 200 g of potato, after boiling in water for 30 min, the filtrate is added with 10 g of glucose, 2.5 g of yeast powder, 5 g of peptone, 3 g of potassium dihydrogen phosphate, 1.5 g of magnesium sulfate heptahydrate, 15 g of agar, made up to 1 L, and then 0.3 g / L of aniline blue is added thereto.

[0071] In some embodiments, the above separation and screening method further includes strain preservation.

[0072] In some embodiments, the method for separating and screening the above Acinetobacter variabilis L49 includes the following steps:

[0073] (1) Sampling

[0074] Fresh rumen fluid is taken from the rumen of live buffalo.

[0075] (2) Strain isolation and screening

[0076] Use a lignin screening plate to screen for microorganisms that can grow using alkaline lignin as the sole carbon source, and then use an aniline blue plate to further screen for dominant strains that can produce a clear zone.

[0077] (3) Strain identification

[0078] Use 27F / 1492R as primers for strain identification, then perform agarose gel electrophoresis, and perform sanger sequencing on the PCR products with normal electrophoresis results. Perform BLAST analysis on the sequencing results and generate a phylogenetic tree.

[0079] (4) Strain preservation

[0080] Use a lignin screening liquid medium for shaking culture of bacteria, and preserve the bacteria with 10 - 30% glycerol.

[0081] In a third aspect, the present invention provides a bacterial agent, including the Acinetobacter variabilis L49 described in the first aspect and / or the fermentation broth of the Acinetobacter variabilis L49.

[0082] In a fourth aspect, the present invention provides an application of the Acinetobacter variabilis L49 described in the first aspect or the bacterial agent described in the third aspect in lignin degradation.

[0083] In some embodiments, the application is to use the Acinetobacter variabilis L49 or the fermentation broth containing the Acinetobacter variabilis L49 to degrade lignin in straw.

[0084] The Acinetobacter variabilis L49 provided by the present invention can grow rapidly and stably using a cheap medium, has a short fermentation period, and a high lignin degradation efficiency. This bacterium can be used for biological degradation of straw, improving the utilization rate of straw, and has high economic value and ecological value.

[0085] Fifth aspect, the present invention provides a method for degrading straw lignin, and the method comprises the following steps:

[0086] (1) Inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium for culture to obtain an Acinetobacter variabilis L49 bacterial suspension;

[0087] (2) Inoculate the Acinetobacter variabilis L49 bacterial suspension obtained in step (1) into a fermentation medium containing straw for fermentation culture.

[0088] In some embodiments, in step (2), the inoculation is carried out with the Acinetobacter variabilis L49 bacterial suspension at an inoculation amount of 3-6% by volume.

[0089] In some embodiments, in step (2), the inoculation is carried out with the Acinetobacter variabilis L49 bacterial suspension at an inoculation amount of 5% by volume.

[0090] In some embodiments, in step (2), the fermentation culture is controlled to be carried out at 35-40 °C and 100-200 rpm.

[0091] In some embodiments, in step (2), the fermentation culture is controlled to be carried out at 39 °C and 150 rpm.

[0092] In some embodiments, in step (2), the formula of the fermentation medium is: per liter of the medium, it contains 50-150 g of straw powder, 0.6-6 g of potassium dihydrogen phosphate, 0.6-6 g of dipotassium hydrogen phosphate, 1.5-15 g of sodium chloride, 0.3-3 g of magnesium chloride hexahydrate, 0.6-6 g of ammonium chloride, 0.12-1.2 g of calcium chloride, 3 mL of trace elements, 0.3-1.5 mL of vitamin B 12 .

[0093] In some embodiments, in step (2), the formula of the fermentation medium is: per liter of the medium, it contains 100 g of straw powder, 6 g of potassium dihydrogen phosphate, 6 g of dipotassium hydrogen phosphate, 15 g of sodium chloride, 3 g of magnesium chloride hexahydrate, 6 g of ammonium chloride, 1.2 g of calcium chloride, 3 mL of trace elements, 1.5 mL of vitamin B 12 .

[0094] In some embodiments, in step (2), the straw is added to the fermentation medium in the form of straw powder.

[0095] In some embodiments, in step (2), the preparation steps of the straw powder include: drying the straw at 50-70 °C, passing through 15-30 meshes, and then drying at 50-70 °C to obtain the straw powder.

[0096] In some embodiments, in step (2), the preparation steps of the straw powder include: drying the straw at 65°C, passing it through a 200-mesh sieve, and then drying it at 65°C to obtain the straw powder.

[0097] In some embodiments, step (1) specifically includes the following steps:

[0098] Inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium, and culture it at 35-40°C and 150-300 rpm for 10-16 h to obtain a seed liquid; then, inoculate the seed liquid into the lignin liquid medium at an inoculation amount of 1-3% by volume, and culture it at 35-40°C and 150-300 rpm for 24-48 h to obtain the Acinetobacter variabilis L49 bacterial suspension.

[0099] In some embodiments, step (1) specifically includes the following steps:

[0100] Inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium, and culture it at 39°C and 150 rpm for 12 h to obtain a seed liquid; then, inoculate the seed liquid into the lignin liquid medium at an inoculation amount of 2% by volume, and culture it at 39°C and 150 rpm for 24-48 h to obtain the Acinetobacter variabilis L49 bacterial suspension.

[0101] In some embodiments, the formulation of the lignin liquid medium is: per liter of the medium, it contains 1-4 g of alkaline lignin, 0.2-2 g of potassium dihydrogen phosphate, 0.2-2 g of dipotassium hydrogen phosphate, 0.5-5 g of sodium chloride, 0.1-1 g of magnesium chloride hexahydrate, 0.2-2 g of ammonium chloride, 0.04-0.4 g of calcium chloride, 1 mL of trace elements, 100-500 μL of vitamin B 12 .

[0102] In some embodiments, the formulation of the lignin liquid medium is: per liter of the medium, it contains 2 g of alkaline lignin, 2 g of potassium dihydrogen phosphate, 2 g of dipotassium hydrogen phosphate, 5 g of sodium chloride, 1 g of magnesium chloride hexahydrate, 2 g of ammonium chloride, 0.4 g of calcium chloride, 1 mL of trace elements, 500 μL of vitamin B 12 .

[0103] In some embodiments, the formulation of the trace elements is: boric acid 30-210 mg / L, cobalt chloride hexahydrate 20-140 mg / L, manganese chloride tetrahydrate 50-350 mg / L, zinc chloride 40-280 mg / L, nickel chloride hexahydrate 20-140 mg / L, sodium molybdate dihydrate 15-110 mg / L, copper chloride dihydrate 2-14 mg / L, ferrous sulfate heptahydrate 1-15 mg / L.

[0104] In certain embodiments, the trace element formulation is: boric acid 30 - 100 mg / L, cobalt chloride hexahydrate 20 - 140 mg / L, manganese chloride tetrahydrate 50 - 150 mg / L, zinc chloride 40 - 250 mg / L, nickel chloride hexahydrate 20 - 100 mg / L, sodium molybdate dihydrate 15 - 50 mg / L, copper chloride dihydrate 2 - 10 mg / L, ferrous sulfate heptahydrate 5 - 15 mg / L.

[0105] In certain embodiments, the trace element formulation is: boric acid 30 - 100 mg / L, cobalt chloride hexahydrate 50 - 140 mg / L, manganese chloride tetrahydrate 50 - 150 mg / L, zinc chloride 40 - 250 mg / L, nickel chloride hexahydrate 20 - 100 mg / L, sodium molybdate dihydrate 15 - 50 mg / L, copper chloride dihydrate 2 - 10 mg / L, ferrous sulfate heptahydrate 5 - 15 mg / L.

[0106] In certain embodiments, the trace element formulation is: boric acid 50 mg / L, cobalt chloride hexahydrate 100 mg / L, manganese chloride tetrahydrate 100 mg / L, zinc chloride 200 mg / L, nickel chloride hexahydrate 50 mg / L, sodium molybdate dihydrate 20 mg / L, copper chloride dihydrate 5 mg / L, ferrous sulfate heptahydrate 10 mg / L.

[0107] In certain embodiments, the concentration of vitamin B 12 is 100 mg / L.

[0108] In certain embodiments, the concentration of the trace elements in the fermentation medium is 3 times their concentration in the lignin liquid medium.

[0109] The present invention will be further described below through specific examples. Unless otherwise specified herein, "%" represents mass percentage. The materials and reagents in the following examples, unless otherwise specified, are commonly used materials or reagents in the art, and can all be obtained commercially or synthesized by known methods. The experimental methods without specified conditions in the following examples are usually carried out according to conventional experimental conditions or the conditions recommended by the manufacturers of relevant reagents (kits).

[0110] The media used in the following examples are as follows:

[0111] In the present invention, the lignin screening medium and the lignin medium can be used interchangeably. The formulation of each liter of lignin screening plate is: 2 g of alkaline lignin, 2 g of potassium dihydrogen phosphate, 2 g of dipotassium hydrogen phosphate, 5 g of sodium chloride, 1 g of magnesium chloride hexahydrate, 2 g of ammonium chloride, 0.4 g of calcium chloride, 1 mL of trace elements, 15 g of agar, sterilized at 121 °C for 30 min, and when cooled to about 60 °C, 500 μL (100 mg / L) of vitamin B 12 is added, and the plates are poured, about 20 mL per plate, for use.

[0112] In the present invention, the lignin screening liquid medium and the lignin liquid medium can be used interchangeably. The formulation of each liter of the medium is as follows: 2 g of alkaline lignin, 2 g of potassium dihydrogen phosphate, 2 g of dipotassium hydrogen phosphate, 5 g of sodium chloride, 1 g of magnesium chloride hexahydrate, 2 g of ammonium chloride, 0.4 g of calcium chloride, 1 mL of trace elements, and 500 μL (100 mg / L) of vitamin B 12 。

[0113] The formulation of each liter of the fermentation medium is as follows: 100 straw powder, 6 g of potassium dihydrogen phosphate, 6 g of dipotassium hydrogen phosphate, 15 g of sodium chloride, 3 g of magnesium chloride hexahydrate, 6 g of ammonium chloride, 1.2 g of calcium chloride, 3 mL of trace elements, and 1.5 mL (100 mg / L) of vitamin B 12 。

[0114] The formulation of the trace elements is as follows: boric acid 50 mg / L, cobalt chloride hexahydrate 100 mg / L, manganese chloride tetrahydrate 100 mg / L, zinc chloride 200 mg / L, nickel chloride hexahydrate 50 mg / L, sodium molybdate dihydrate 20 mg / L, copper chloride dihydrate 5 mg / L, and ferrous sulfate heptahydrate 10 mg / L.

[0115] Example 1

[0116] (1) Sampling

[0117] Take fresh rumen fluid from a buffalo. The sampling process should be strictly carried out under aseptic conditions to avoid contamination. The obtained sample is placed in a sterile glass bottle, stored in an ice box, and brought back to the laboratory for treatment within 6 h.

[0118] (2) Strain isolation

[0119] Dilute the fresh rumen fluid with a salt solution to 10 5 times, then take 200 μL and spread it evenly on the lignin screening plate. Then place the plate in a biochemical incubator at 39 °C for cultivation. After 24 h, monoclonal colonies grow on the plate. Pick monoclonal colonies with different morphologies and streak them on the lignin screening plate. Repeat this step 5 - 6 times until only monoclonal colonies with one morphology grow on the plate and the passage is stable. The colony morphology diagram of the strain Acinetobacter variabilis L49 of the present invention is shown in Figure 1 。

[0120] (3) Strain screening: PDA - aniline blue plate colorimetric screening

[0121] Lignin-degrading bacteria with laccase activity can form a transparent circle on the PDA-aniline blue plate. Inoculate the identified lignin-degrading bacteria into the lignin screening liquid medium and culture at 39°C and 150 rpm for 48 h - 72 h. Inoculate the PDA-aniline blue plate with the lignin-degrading bacteria, conduct three parallel experiments for each lignin-degrading bacterium, with an inoculation amount of 0.5 μL, and place it in an incubator at 28°C for cultivation. Observe the above-mentioned plates after overnight cultivation, and the aniline blue plate of the strain Acinetobacter variabilis L49 of the present invention shows color Figure 2 , measure the diameter of the transparent circle and the diameter of the colony, and calculate the ratio of the two and the degradation activity of the strain.

[0122] The formula of the PDA-aniline blue plate is as follows: 200 g of peeled potatoes, add 10 g of glucose, 2.5 g of yeast powder, 5 g of peptone, 3 g of potassium dihydrogen phosphate, 1.5 g of magnesium sulfate heptahydrate, 15 g of agar after boiling in water for 30 min and filtering the clear liquid, and make up the volume to 1 L. Then add 0.3 g / L of aniline blue to it.

[0123] (4) Strain identification

[0124] Pick the above-mentioned monoclonal and dissolve it in 10 μL of sterile water. Take 2 μL of the bacterial solution as a template, and perform PCR with 27F / 1492R as primers respectively. Add the remaining 8 μL of the bacterial solution to 2 mL of the lignin screening liquid medium for cultivation. Perform agarose gel electrophoresis on the PCR product, and the electrophoresis pattern is shown in Figure 3 , select the sample with a single band and the correct size (27F / 1492R: about 1500 bp) in the electrophoresis result for sequencing. Compare the sequences of the samples with normal sequencing results.

[0125] The primer information is shown in Table 1:

[0126] Table 1

[0127] Primer Name Sequence (5’3’) Function 27F AGAGTTTGATCCTGGCTCAG Full-length amplification of 16S rRNA 1492R TACGGCTACCTTGTTACGACTT Full-length amplification of 16S rRNA

[0128] The PCR reaction system is shown in Table 2:

[0129] Table 2

[0130] Name Volume / μL PCR enzyme mix 25 Forward primer 27F (10 μM) 1.5 Reverse primer 1492R (10 μM) 1.5 Template monoclonal colony 2 Sterilized water 20 Total system 50

[0131] The PCR reaction program is shown in Table 3:

[0132] Table 3

[0133]

[0134]

[0135] Electrophoresis information: 1% agarose gel, 120 V voltage, electrophoresis time 30 min.

[0136] The 16S rRNA gene sequence of the strain Acinetobacter variabilis L49 of the present invention is shown in SEQ ID NO.1. The returned sequence information is analyzed by BLAST using NCBI, and the Fast Minimum Evolution method is selected to construct a phylogenetic tree. The relevant parameter settings are as follows: maximum sequence difference = 0.75, and the sequence label is the classification name. The phylogenetic tree of the strain Acinetobacter variabilis L49 of the present invention is shown in Figure 4 .

[0137] SEQ ID NO.1:

[0138]

[0139] (5) Strain preservation

[0140] The selected strains were cultured by shaking in 50 mL of lignin liquid medium for subsequent determination of lignin degradation efficiency. When the bacteria grew to the logarithmic phase, three aliquots of 750 μL of the bacterial solution were taken and added to three tubes containing 250 μL of 50% glycerol, and then stored in a -80 °C refrigerator.

[0141] Example 2

[0142] (1) Determination of alkaline lignin degradation efficiency

[0143] Lignin has a maximum absorption peak at 320 nm. By measuring the absorbance value at this wavelength, the lignin content can be calculated.

[0144] The glycerol bacteria of the lignin-degrading bacteria with the determined strains were cultured by shaking in lignin and LB liquid media. After culturing at 39 °C and 150 rpm for 48 h, the protein concentration was measured. Acinetobacter variabilis L49 was inoculated into the lignin liquid medium at the final protein concentrations of 10 μg / mL and 50 μg / mL respectively, and the alkaline lignin medium without inoculated bacterial solution was used as a blank control. The experimental group and the control group were cultured at 39 °C and 150 rpm. Every 24 h, 1 mL of the culture was taken, centrifuged at 12,000 g for 5 min, the supernatant was used to measure the lignin absorbance, and the precipitate was used to measure the protein concentration. The spectrophotometer was preheated for more than 30 min, the wavelength was adjusted to 320 nm, and calibrated with distilled water. The absorbance value just after inoculation was measured as the initial value of the lignin content and denoted as A0. The changes in the absorbance values of the cultures were continuously measured, and the data were denoted as A1, A2, A3, A4 respectively. ΔA1 = A1 - A0, ΔA2 = A2 - A0, and so on. The lignin degradation efficiency per day can be calculated.

[0145] Subtracting the degradation efficiency of the control group from the degradation efficiency of the experimental group gives the net degradation efficiency of Acinetobacter variabilis L49 on alkaline lignin. Taking this value as the ordinate and the culture time as the abscissa, the lignin degradation efficiency graph of Acinetobacter variabilis L49 can be obtained, that is Figure 5 .

[0146] (2) Determination of bacterial protein by Bradford method

[0147] Take out the Bradford staining solution and equilibrate it to room temperature. Take out the BSA sample and thaw it at room temperature. Prepare a series of BSA protein standards with concentrations of 0 μg / mL, 100 μg / mL, 200 μg / mL, 300 μg / mL, and 400 μg / mL respectively. Add 1 mL of 1 M NaOH to the cell precipitate of Acinetobacter variabilis L49, heat it in a metal bath at 100 °C for 15 min, and then centrifuge at 12,000 g for 10 min. Take 25 μL of each of the standard solution and the sample to be tested and add them to a 1.5 mL centrifuge tube. Add 1 mL of Bradford working solution to each tube and mix quickly. Take 900 μL of the liquid in the sample tube and measure the absorbance value at A595 with a spectrophotometer. Use the OD values measured for the standard group as the ordinate and the corresponding protein concentrations as the abscissa to plot a standard curve. Substitute the OD value measured for the sample into the standard curve to calculate the protein concentration of the sample.

[0148] Use the protein concentration to represent the growth of the strain. Plot with the number of culture days as the abscissa and the protein concentration as the ordinate to obtain the growth curve of Acinetobacter variabilis L49, that is Figure 6 。

[0149] Example 3

[0150] 1. Determination of straw degradation efficiency

[0151] (1) Activate the strain

[0152] Inoculate a loopful of the slant culture of Acinetobacter variabilis L49 onto the lignin screening solid medium and culture it at 39 °C for 24 - 48 h to obtain the activated strain.

[0153] (2) Prepare the cell suspension

[0154] Use an inoculation loop to inoculate the activated strain into 4 mL of lignin screening liquid medium. The medium formula is: 2 g of alkaline lignin, 2 g of potassium dihydrogen phosphate, 2 g of dipotassium hydrogen phosphate, 5 g of sodium chloride, 1 g of magnesium chloride hexahydrate, 2 g of ammonium chloride, 0.4 g of calcium chloride, 1 mL of trace elements, made up to 1 L with ddH2O, sterilized at 121 °C for 15 minutes, and 500 μL of vitamin B 12 is added after cooling. Culture it on a shaker at 39 °C and 150 rpm for 12 h to obtain the overnight culture; Take 2 mL of the overnight culture and inoculate it into 100 mL of lignin screening liquid medium, and culture it on a shaker at 39 °C and 150 rpm for 1 - 2 days to obtain the cell suspension.

[0155] (3) Treat the straw

[0156] Dry the straw at 65 °C, crush it; Sieve it through a 20 - mesh sieve and dry it again at 65 °C to obtain the straw powder.

[0157] (4) Degradation

[0158] Take 200 g of straw powder and add it to 2 L of 3× salt solution, stir evenly, sterilize, cool to room temperature, and then add 6 mL of trace elements and 3 mL of vitamin B 12 , thus obtaining the fermentation medium;

[0159] Each liter of 3× salt solution contains 6 g of potassium dihydrogen phosphate, 6 g of dipotassium hydrogen phosphate, 15 g of sodium chloride, 3 g of magnesium chloride hexahydrate, 6 g of ammonium chloride, and 1.2 g of calcium chloride; the concentration of trace elements is: boric acid 50 mg / L, cobalt chloride hexahydrate 100 mg / L, manganese chloride tetrahydrate 100 mg / L, zinc chloride 200 mg / L, nickel chloride hexahydrate 50 mg / L, sodium molybdate dihydrate 20 mg / L, copper chloride dihydrate 5 mg / L, ferrous sulfate heptahydrate 10 mg / L; the concentration of vitamin B 12 solution is 100 mg / L.

[0160] Take the bacterial suspension from step (2) and inoculate it into the fermentation medium at an inoculation ratio of 5% by volume. Incubate at a temperature of 39 °C and a rotation speed of 150 rpm. Terminate the reaction at a predetermined time point, recover the degraded straw, and dry it to a constant weight at 65 °C. Use the weight loss method to detect the degradation product. In the first week, the weight loss rate of the straw reaches 23.65%, and in the second week, the weight loss rate of the straw reaches 25.45%.

[0161] 2. Determination of lignin, cellulose, and hemicellulose contents in straw

[0162] Experimental operation steps, methods, and result evaluation:

[0163] (1) Sample preparation (performed according to the provisions of NY / T 3492)

[0164] Cut short: Simply cut the crop straw short to facilitate subsequent drying and grinding.

[0165] Drying: Place a clean weighing pan in an electric blast drying oven at (45 ± 3) °C, take it out after drying for 3 hours, and cool it to room temperature in a room environment (20 - 30 °C, relative humidity less than 50%, can be cooled in a desiccator). Place the cut short straw in the dried weighing pan, place it in an electric blast drying oven at (45 ± 3) °C, take it out after drying for 36 hours, cool it to room temperature and then place it in an electric blast drying oven at (45 ± 3) °C, take it out after drying for 1 hour, cool it to room temperature, and weigh the mass of the weighing device (accurate to 0.1 g). Repeat this operation until the mass difference between consecutive weighings does not exceed 1% of the sample mass. For easy drying, the thickness of the sample spread should not exceed 10 mm.

[0166] Crushing and sieving: The dried sample is crushed using a cutting-type crushing equipment and sieved using an experimental sieve with a size of 850 μm. If there is oversize material, repeat the crushing and sieving until all the material passes through the 850-μm test sieve. Combine all the undersize material and mix well. During the crushing process, avoid overheating the sample. The crushing equipment should operate at the lowest possible speed to reduce dust loss.

[0167] Quartering: Quarter the crushed and sieved sample using the coning and quartering method, and repeat the quartering process until the required sample amount for analysis (not less than 50 g) is obtained.

[0168] Storage and identification: The sample should be stored in a sealed container and labeled with information such as the type of sample with a unique identifier.

[0169] (2) Extraction

[0170] Water extraction: Weigh 2 - 10 g of the test sample (accurate to 0.1 mg) into a pre-weighed filter paper tube. Place the filter paper tube into the extraction thimble of a Soxhlet extractor, connect it to a receiving flask that has been dried to a constant weight. Add 190 mL of water from the upper end of the condenser of the extractor, heat it on an electric heating mantle to cause the water to reflux continuously for extraction (4 - 5 times per hour). Generally, extract for 6 - 8 hours. After the extraction is completed, turn off the heating mantle and cool the Soxhlet extractor to room temperature.

[0171] Ethanol extraction: Connect the extraction thimble after water extraction to a receiving flask that has been dried to a constant weight. Add 190 mL of ethanol from the upper end of the condenser of the extractor, heat it on an electric heating mantle to cause the ethanol to reflux continuously for extraction (6 - 10 times per hour). Generally, extract for 16 - 24 hours. After the extraction is completed, turn off the heating mantle and cool the Soxhlet extractor to room temperature. Dry the biomass test sample after two-step extraction (i.e., the sample without extractives) in an oven at (45 ± 3)°C to a constant weight, and weigh the sample mass accurate to 0.1 mg.

[0172] (3) Two-step acid hydrolysis

[0173] Crucible constant weight: Place the fritted glass crucible (G4) in a muffle furnace and calcine it to a constant weight at 575 ± 25°C. After taking the crucible out of the muffle furnace, place it in a desiccator to cool, and weigh its mass accurate to 0.1 mg.

[0174] Strong acid hydrolysis: Weigh 300.0 mg (accurate to 0.1 mg) of the sample without extractives into a pressure-resistant tube, and perform more than 2 parallel experiments for each sample. Immediately add 3.00 mL of 72% sulfuric acid solution to the pressure-resistant tube and mix well. Place the pressure-resistant tube in a water bath at 30 ± 3°C, stir it once every 5 - 10 minutes, take it out after maintaining a constant temperature for 60 minutes, add 84.00 mL of water to the pressure-resistant tube, and tighten the lid and mix well.

[0175] Sugar recovery rate: Prepare a sugar standard solution for calculating the recovery rate, including D(+)-glucose, D(+)-xylose, D(+)-galactose, L(+)-arabinose, and L(+)-mannose. The concentration of the sugar recovery standard solution should be close to the sugar concentration of the test sample. Weigh the mass of each sugar accurately to 0.1 mg, add 10.0 mL of water, then add 348 μL of 72% sulfuric acid solution, tighten the lid and mix well. Filter with a microporous filter, dispense into sample bottles, store frozen, and thaw and shake well before use.

[0176] Dilute acid hydrolysis: Place the pressure-resistant test tubes containing the test sample and the sugar recovery standard solution into an autoclave and hydrolyze at 121 °C for 1 hour. Wait for the hydrolysis product to cool to room temperature, filter through a fritted glass crucible (G4), collect the filtrate in a conical flask about 50 mL, transfer to a stoppered container, and store at 0 - 4 °C. Determine the acid-soluble lignin within 6 hours.

[0177] (4) Determination

[0178] Acid-soluble lignin: Use the above-mentioned filtered acid hydrolysis solution, measure the absorbance value of the liquid test sample at 320 nm with a UV-visible spectrophotometer, use distilled water as the blank control for the UV-visible spectrophotometer, dilute with water until the absorbance is 0.7 - 1.0, record the dilution factor, and record the absorbance value accurately to 0.001.

[0179] Acid-insoluble lignin: Rinse the acid-insoluble residue remaining in a 100 mL stoppered pressure-resistant test tube with more than 50 mL of hot water, so that all the residue remains in the fritted glass crucible (G4), and dry it with a vacuum filter. Dry the fritted glass crucible (G4) and the acid-insoluble residue at (105 ± 3) °C to a constant weight, record the mass of the fritted glass crucible and the acid-insoluble residue accurately to 0.1 mg. Place the fritted glass crucible (G4) and the acid-insoluble residue in a muffle furnace and incinerate at (575 ± 25) °C for at least 3 hours until all the organic matter is ashed. Control the heating rate at 10 °C / min to prevent the test sample from burning and mechanical loss of the test sample caused by strong air flow. After ashing, cool to 105 °C, take out and place in a desiccator to cool, and weigh the crucible and the ash accurately to 0.1 mg.

[0180] Carbohydrates: The chromatographic conditions are shown in Table 4:

[0181] Table 4

[0182] Item Condition High performance liquid chromatograph Shimadzu high performance liquid chromatograph: equipped with a differential refractive index detector Chromatographic column Rezex ROA-Organic Acid H+ (8%) chromatographic column 300×7.8 mm Mobile phase 5 mM sulfuric acid Flow rate 0.6 mL / min Column temperature 50℃ Injection volume 10 μL Detector Differential refractive index detector, detector temperature 50 °C

[0183] Drawing of the standard curve: Prepare a mixed standard solution of D-cellobiose, D(+)-glucose, and D(+)-xylose according to the concentration range recommended in Table 5. Use the five-point calibration method to separately pipette 10 μL of the standard solution into a high-performance liquid chromatograph and measure the response value (peak area) of the standard solution under the above conditions. Plot the standard curve with the concentration as the abscissa and the peak area as the ordinate.

[0184] The recommended mass concentration range of the sugar standard solution is shown in Table 5 as follows:

[0185] Table 5

[0186] Component Mass concentration range (mg / mL) D-cellobiose 0.1~4.0 D(+)-glucose 0.1~4.0 D(+)-xylose 0.1~4.0

[0187] Determination of the sample solution: Take 10 mL of the above-mentioned filtered dilute acid hydrolysis solution into a 50 mL centrifuge tube, slowly add 1 g of calcium carbonate to neutralize the hydrolysis solution to a pH of 5 - 6, centrifuge the mixture at 5000 g for 10 min, filter the supernatant through a 0.22 μm microporous filter, and then perform high-performance liquid chromatography analysis to calculate the content of various sugars. If the cellobiose content in the sample is higher than 3 mg / mL, it indicates that the hydrolysis is incomplete. The presence of a peak before cellobiose indicates that the sugars in the sample have undergone excessive hydrolysis.

[0188] (5) Result calculation

[0189] ① Acid-soluble lignin content

[0190] The acid-soluble lignin content ASL in the sample, expressed as a mass percentage (%), is calculated according to the following formula.

[0191]

[0192] In the formula: ASL---Acid-soluble lignin content in the sample, unit is mass percentage (%);

[0193] A---Average value of the ultraviolet-visible absorbance of the filtrate at 320 nm;

[0194] V---Volume of the filtrate, with a value of 87 mL;

[0195] N---Dilution factor of the filtrate;

[0196] L---Thickness of the cuvette, unit is centimeter (cm);

[0197] ε---Absorptivity of acid-soluble lignin at 320 nm, take 30 L / (g·cm) for corn stover and 25 L / (g·cm) for other raw materials; w0---Mass of the sample before extraction, unit is gram (g);

[0198] w1----Mass of the sample after extraction, unit is gram (g);

[0199] w ef ----Mass of the sample without extractives taken, unit is gram (g).

[0200] ② Acid-insoluble lignin content

[0201] The acid-insoluble lignin content AIL in the sample, expressed as a mass percentage (%), is calculated according to the following formula.

[0202]

[0203] In the formula: AIL---the acid-insoluble lignin content in the sample, unit is mass percentage (%);

[0204] m1---the mass of the glass sand core crucible, unit is g;

[0205] m2----the mass of the glass sand core crucible and the acid-insoluble residue, unit is g;

[0206] m3---the mass of the glass sand core crucible and the ash, unit is g.

[0207] ③ Lignin content

[0208] The total lignin content Lig in the sample, expressed as a mass percentage (%), is calculated according to the following formula

[0209] Lig = ASL + AIL

[0210] In the formula: Lig---the total lignin content in the sample, unit is mass percentage (%);

[0211] ASL---the acid-soluble lignin content in the sample, unit is mass percentage (%);

[0212] AIL---the acid-insoluble lignin content in the sample, unit is mass percentage (%).

[0213] ④ Cellulose content and hemicellulose content

[0214] Calculate the sugar recovery rate according to the following formula:

[0215]

[0216] where C i1 is the mass concentration measured by HPLC for the i-th sugar recovery solution prepared, C i0 is the mass concentration of the i-th sugar solution prepared.

[0217] Determine the mass Zi of glucose and xylose, expressed as a mass fraction (%):

[0218]

[0219] where C i : represents the mass concentration of the i-th monosaccharide measured by HPLC, unit is mg / mL;

[0220] F: The dehydration correction factor, 0.88 for xylose and arabinose, and 0.9 for glucose, galactose and mannose;

[0221] V: The volume after dilute acid digestion, 87 mL;

[0222] W1: The mass of the sample after extraction, in g;

[0223] R i : The sugar recovery rate calculated above;

[0224] W ef : The mass of the sample without extractives weighed;

[0225] W0: The mass of the sample before extraction, in g;

[0226] Content of cellulose: Cel = Z glucose

[0227] Z glucose: The content of glucose in the sample, in mass percentage (%);

[0228] Content of hemicellulose: Hem = Z xylose

[0229] Z xylose: The content of xylose in the sample, in mass percentage (%).

[0230] The present invention provides the degradation efficiency of Acinetobacter variabilis L49 on straw lignin as shown in Table 6:

[0231] Table 6

[0232] Sample name Control Sample of the first week Sample of the second week Lignin content (g) 2.2253 1.9565 1.8341 Cellulose content (g) 3.8617 3.7238 3.6384 Hemicellulose content (g) 1.6892 1.5884 1.5103 Lignin degradation rate / 12.08% 17.58% Cellulose degradation rate / 3.57% 5.78% Hemicellulose degradation rate / 5.97% 10.59% Bacterial cell proliferation multiple / 5.43 7.62

[0233] The strain Acinetobacter variabilis L49 of the present invention can efficiently degrade lignin in straw in a short time, while the degradation rates of cellulose and hemicellulose are low, with high efficiency and high specificity.

[0234] It should be understood that the above embodiments are all exemplary and do not cover all possible implementation manners included in the claims. Without departing from the scope of the present disclosure, various deformations and changes can also be made on the basis of the above embodiments. Similarly, the technical features of the above embodiments can also be combined arbitrarily to form other embodiments of the present invention that may not be clearly described. Therefore, the above embodiments only represent several implementation manners of the present invention and do not limit the protection scope of the present invention patent.

Claims

1. A mutant Acinetobacter L49, classified and named as Acinetobacter variabilis, characterized in that, The Acinetobacter variabilis is deposited in the China General Microbiological Culture Collection Center, with the deposit number of CGMCC NO. 28700, the deposit date of October 23, 2023, and the deposit address of Institute of Microbiology, Chinese Academy of Sciences, Beijing, China.

2. The Acinetobacter variabilis L49 according to claim 1, wherein The 16S rRNA gene sequence of the Acinetobacter variabilis is as shown in SEQ ID NO.

1.

3. The method for isolation and screening of the mutant Acinetobacter L49 according to claim 1 or 2, characterized in that, It includes the following steps: (1) Sampling and collection; (2) Strain isolation; (3) Strain screening; (4) Strain identification.

4. The separation and screening method according to claim 3, wherein Step (2) uses a lignin medium for the said separation. The formulation of the lignin medium is as follows: per liter of the medium, it contains 1 - 4 g of alkaline lignin, 0.2 - 2 g of potassium dihydrogen phosphate, 0.2 - 2 g of dipotassium hydrogen phosphate, 0.5 - 5 g of sodium chloride, 0.1 - 1 g of magnesium chloride hexahydrate, 0.2 - 2 g of ammonium chloride, 0.04 - 0.4 g of calcium chloride, 1 mL of trace elements, 15 g of agar, and 100 - 500 μL of vitamin B 12 , the formulation of the trace elements is as follows: boric acid 30 - 210 mg / L, cobalt chloride hexahydrate 20 - 140 mg / L, manganese chloride tetrahydrate 50 - 350 mg / L, zinc chloride 40 - 280 mg / L, nickel chloride hexahydrate 20 - 140 mg / L, sodium molybdate dihydrate 15 - 110 mg / L, copper chloride dihydrate 2 - 14 mg / L, ferrous sulfate heptahydrate 1 - 15 mg / L, and the concentration of the vitamin B 12 is 100 mg / L; In step (3), the screening is carried out using PDA-aniline blue plate color development.

5. A bacterial agent, characterized in that, It includes the Acinetobacter variabilis L49 described in claim 1 or 2 and / or the fermentation broth of the Acinetobacter variabilis L49.

6. An application of the Acinetobacter variabilis L49 described in claim 1 or 2 or the bacterial agent described in claim 5 in lignin degradation.

7. The application according to claim 6, wherein The application is to use the Acinetobacter variabilis L49 or the fermentation broth containing the Acinetobacter variabilis L49 to degrade lignin in straw.

8. A method for degrading straw lignin, characterized in that, The method includes the following steps: (1) Inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium for culture to obtain an Acinetobacter variabilis L49 bacterial suspension; (2) Inoculate the Acinetobacter variabilis L49 bacterial suspension obtained in step (1) into a fermentation medium containing straw for fermentation culture.

9. The method according to claim 8, wherein In step (2), the inoculation is carried out by inoculating the Acinetobacter variabilis L49 bacterial suspension at an inoculation amount of 3-6% by volume; Preferably, in step (2), the fermentation culture is carried out under the conditions of 35-40 °C and 100-200 rpm; Preferably, in step (2), the formula of the fermentation medium is as follows: per liter of the medium, it contains 50 - 150 g of straw powder, 0.6 - 6 g of potassium dihydrogen phosphate, 0.6 - 6 g of dipotassium hydrogen phosphate, 1.5 - 15 g of sodium chloride, 0.3 - 3 g of magnesium chloride hexahydrate, 0.6 - 6 g of ammonium chloride, 0.12 - 1.2 g of calcium chloride, 3 mL of trace elements, and 0.3 - 1.5 mL of vitamin B 12 ; Preferably, the trace element formulation is: boric acid 30 - 210 mg / L, cobalt chloride hexahydrate 20 - 140 mg / L, manganese chloride tetrahydrate 50 - 350 mg / L, zinc chloride 40 - 280 mg / L, nickel chloride hexahydrate 20 - 140 mg / L, sodium molybdate dihydrate 15 - 110 mg / L, copper chloride dihydrate 2 - 14 mg / L, ferrous sulfate heptahydrate 1 - 15 mg / L and / or, the vitamin B 12 The concentration of the solution is 100 mg / L.

10. The method according to claim 8 or 9, characterized in that, Preferably, step (1) specifically includes the following steps: inoculate the activated Acinetobacter variabilis L49 into a lignin liquid medium, culture at 35-40 °C and 150-300 rpm for 10-16 h to obtain a seed liquid; then, inoculate the seed liquid into a lignin liquid medium at an inoculation amount of 1-3% by volume, and culture at 35-40 °C and 150-300 rpm for 24-48 h to obtain the Acinetobacter variabilis L49 bacterial suspension.

Citation Information

Cited By

  • Acinetobacter baumannii for degrading lignin and application of acinetobacter baumannii

    CN120290404A