Bacterial agent containing paenibacillus and application thereof
By using a mixture of Bacillus-like WY-F4 strain and a specific formula, the problem of insufficient iron carrier high-yield strains was solved, the effect of heavy metal contaminated soil repair and rice yield increased was achieved, and the efficiency of compost calcification was improved.
Patent Information
- Application Number
- CN202510392739.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-18
AI Technical Summary
Among the existing strains of iron carrier production, there are limited strains with high yield of iron carriers and multiple advantages, such as the resistance of a variety of heavy metals and the delayed composting time of the produced iron carrier.
Bacteria containing WY-F4 strain was used to prepare bacterial agents and mix them with decayed agricultural by-products, calcium, magnesium, phosphorus fertilizer, biochar and charcoal, and charcoal in heavy metal-contaminated soil, while promoting rice growth and increase yield.
Significantly reduce the effective cadmium content and rice cadmium content in heavy metal-contaminated soil, promote rice growth and increase yield, and extend the duration of the high-temperature stage of compost.
Smart Images

Figure CN120330084A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, in particular to a bacterial agent containing Paenibacillus and application thereof. Background Art
[0002] Cadmium (Cd) has become a serious soil pollutant, mainly from industrial activities such as mining, industrial wastewater irrigation, atmospheric deposition, and the misuse of fertilizers and pesticides. Long-term intake of Cd can affect the metabolism of calcium and phosphorus, leading to osteoporosis, periodontal disease, etc. Therefore, it is urgent to study and develop remediation strategies for Cd-contaminated paddy soils.
[0003] At present, the methods for controlling soil cadmium pollution mainly include physical remediation, chemical remediation and biological remediation. Physical and chemical remediation can easily destroy the original physical and chemical structure of the soil and are not suitable for long-term treatment of large-scale heavy metal pollution. Phytoremediation is often limited by the long growth cycle and low biomass of plants. In contrast, microbial remediation, as a bioremediation technology, is very popular due to its advantages such as environmental friendliness and large-scale in situ remediation. Siderophores are a class of low molecular weight organic compounds synthesized by microorganisms and some plants under low iron stress conditions that have super strong chelating ability for trivalent iron ions. They can take away Fe from various water-soluble and water-insoluble compounds. 3+ , and can affect the bioavailability of other metals through complexation, thereby reducing their toxicity.
[0004] However, among the reported iron carrier-producing strains, high-iron carrier-producing strains are limited, and strains with multiple advantages (such as resistance to multiple heavy metals and delayed composting time of the produced iron carriers) are rare; therefore, finding and obtaining iron carrier-producing strains with excellent traits has become a hot topic in this research field.
[0005] To this end, those skilled in the art have proposed a bacterial agent comprising Paenibacillus and its application to solve the problems raised by the background art. Summary of the invention
[0006] In order to solve the above technical problems, the present invention provides a bacterial agent containing Bacillus and its application, so as to solve the problems in the prior art that among the iron carrier producing strains, there are limited iron carrier high-producing strains and there are few strains with multiple advantages (such as resistance to multiple heavy metals and delayed composting time of the produced iron carriers).
[0007] A bacterial agent containing Paenibacillus sp., comprising Paenibacillus sp. WY-F4 strain, wherein the strain is deposited in the General Microbiological Center of China Microorganism Culture Collection Administration Committee with a deposit number of CGMCCNO.26649. The bacterial agent is used to reduce the effective cadmium content in heavy metal contaminated soil, reduce the cadmium content in rice, and promote rice growth and increase yield.
[0008] The preparation raw materials of the bacterial agent include decomposed agricultural by-products, calcium magnesium phosphate fertilizer, biochar, rice bran, and a microbial fermentation broth containing the WY-F4 strain. The weight percentages of each component are as follows: decomposed agricultural by-products 10wt% - 18wt%, calcium magnesium phosphate fertilizer 10% - 20wt%, biochar 5% - 15wt%, rice bran 5wt% - 15wt%, and microbial fermentation broth 2.0% - 3.0%.
[0009] The preparation steps of the microbial fermentation broth include: inoculating Paenibacillus sp. WY-F4 on a solid seed culture medium slant for activation culture, then inoculating it into a liquid seed culture medium to prepare a seed solution, and finally inoculating the seed solution into a seed tank and a fermentation tank for fermentation culture. After fermentation, the content of Paenibacillus sp. WY-F4 in the microbial fermentation broth is 1×10 8 ~1×10 9 CFU / ml.
[0010] An application of using the bacterial agent in repairing heavy metal contaminated soil includes applying the bacterial agent to the heavy metal contaminated soil to reduce the available cadmium content in the soil and reduce the cadmium absorption of crops.
[0011] An application of using the bacterial agent in promoting compost maturity includes adding the bacterial agent during the composting process to promote the utilization of iron elements by compost microorganisms, increase the compost temperature, and extend the duration of the high-temperature stage.
[0012] Compared with the prior art, the present invention has the following beneficial effects:
[0013] The Paenibacillus sp. WY-F4 bacterial agent provided by the present invention has the effects of significantly reducing the available cadmium content and the cadmium content in rice grains in heavy metal contaminated soil, and at the same time can promote the growth and increase the yield of rice. The bacterial agent efficiently passivates heavy metal cadmium in the soil by surface adsorption through the cell wall groups of the strain WY-F4 and extracellular complexation and extracellular precipitation of metabolites, reducing the cadmium absorption of plants. In addition, the bacterial agent can also secrete siderophores to promote the utilization of iron elements by compost microorganisms, increase the compost temperature, extend the duration of the high-temperature stage, and accelerate the maturity of municipal sludge. Description of the Drawings
[0014] Figure 1 It is a growth situation diagram of the Bacillus sp. strain WY-F4 of the present invention under different cadmium concentration culture conditions;
[0015] Figure 2 It is a growth situation diagram of WY-F4 of the present invention on an iron carrier-producing plate (CAS);
[0016] Figure 3Growth curve of the Paenibacillus sp. strain WY-F4 of the present invention;
[0017] Figure 4 Temperature trend chart of the water control group and the F4 group of the present invention;
[0018] Figure 5 Temperature trend chart of the water control group and the WY-F4 group of the present invention. Detailed implementation manners
[0019] The following further describes the implementation manners of the present invention in detail with reference to the drawings and embodiments. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.
[0020] Embodiment: The present invention provides the screening, preparation of microbial inoculum and application of a Paenibacillus sp. strain WY-F4. This strain was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on February 21, 2023, with the deposit number CGMCC NO. 26649. The microbial inoculum prepared from this strain can reduce the available cadmium in heavy metal contaminated soil and the cadmium content in rice grains, and can also secrete siderophores to promote plant growth, increase rice yield. The siderophores contained can enable compost microorganisms to better utilize iron elements, promote the temperature rise of compost, and extend the high-temperature stage by 50% compared with the conventional compost control group.
[0021] Screening and molecular identification of the Paenibacillus sp. strain of the present invention:
[0022] Soil samples were collected from heavy metal contaminated arable land and brought back to the laboratory in sterile paper bags for the isolation and screening of strains; the gradient dilution method was used to isolate the strains. Weigh 10 g of soil sample and put it into a triangular flask containing 90 ml of sterile water, and shake it on a shaker for 30 min to obtain a soil suspension with a dilution of 10 –1 ; Take another 6 glass test tubes containing 4.5 ml of sterile water and label them with dilutions of 10 –2 , 10 –3 , 10 –4 , 10 –5 , 10 –6 , 10 –7 ; Pipette 0.5 ml from the soil suspension with a dilution of 10 –1 and add it to the glass test tube (15×150 mm) labeled with a dilution of 10 –2 , and shake it well to obtain a soil dilution with a dilution of 10 –2 ; Gradient dilute it successively by a factor of 10 to obtain soil dilutions with dilutions of 10 –3 , 10 –4 , 10 –5 , 10 –6 , 10 –7Soil diluent. Sequentially and separately pipette 0.1 mL of these soil diluents into a sterile 96-well cell culture plate. Add 0.1 mL of the improved R2A liquid medium to each well and mix thoroughly. Then, sequentially add an appropriate amount of sterile 100 mg / mL CdCl2 solution to prepare mixed bacterial solutions containing Cd 2+ at concentrations of 25 mg / L, 50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, and 250 mg / L. Place the cell culture plate on a microplate constant temperature oscillator and culture at 35°C and 150 revolutions per minute. Take out the cell culture plate every 6 hours and measure the OD of each well with a spectrophotometer 600 . Wait until the current OD 600 / initial OD 600 > 1.2. Use a sterile inoculation needle to pick the mixed bacterial solution and streak it on the NB solid medium to obtain pure cultures. Pick single colonies, and after microscopic examination, transfer them to a slant and store at 4°C. The screening results show that strain WY-F4 grows normally at Cd 2+ concentrations of 25 - 200 mg / L. As shown in Figure 1 , the OD 600 gradually decreases with the increase of Cd 2+ .
[0023] Bacterial strain screening media:
[0024] (1) Improved R2A medium: 0.1 - 0.5 g of yeast extract, 0.1 - 0.5 g of peptone, 0.3 - 0.6 g of casein hydrolysate, 0.4 - 0.7 g of glucose, 0.2 - 0.6 g of soluble starch, 0.2 - 0.5 g of KH2PO4, 0.03 - 0.05 g of MgSO4, 0.1 - 0.6 g of sodium pyruvate, 1000 mL of water, pH 7.2 ± 0.2 (add 15 g of agar to the R2A solid medium);
[0025] (2) Bacterial medium (NB): 1 - 5 g of beef extract, 4 - 10 g of peptone, 2 - 6 g of NaCl, pH = 7.0 - 7.2;
[0026] (3) Bacterial siderophore detection medium (CAS): 0.5 - 2 mL of 20% glucose solution, 2 - 6 mL of 10% casein amino acid solution, 0.06 - 0.9 mL of 1 mol / L CaCl2, 0.6 - 3 mL of 1 mol / L MgSO4, 5 - 15 mL of phosphate buffer solution (pH 6.8), 10 - 30 mL of staining solution (prepared from chrome azurol and cetyltrimethylammonium bromide), 60 - 70 mL of 1.8% agar;
[0027] (4) Iron carrier quantitative culture medium (MKB): casamino acids 1.0-5.0 g / L, glycerol 10-15 mL / L, potassium dihydrogen phosphate 1.0-2.5 g / L, magnesium sulfate heptahydrate 1.0-2.5 g / L, pH 7.2;
[0028] (5) Fermentation medium: molasses 15-30 g / L, soy peptone 5-10 g / L, potassium dihydrogen phosphate 0.5-1.0 g / L, manganese sulfate monohydrate 0.05-0.1 g / L.
[0029] Screening of strains for the ability to produce siderophores:
[0030] (1) Qualitative screening of bacterial strains’ ability to produce siderophores
[0031] After activating the selected Cd-resistant strains, use a sterile inoculation loop to dip the bacterial solution and inoculate it onto the CAS iron carrier-producing plate and culture it at 35°C for 16-24 hours. In the experiment, if the strain does not produce iron carriers, the CAS solid culture medium will be blue like the control. If the strain produces iron carriers, the CAS solid culture medium will change to yellow, i.e., an obvious yellow hydrolysis circle will appear. The strain WY-F4 was inoculated onto the CAS iron carrier-producing plate and cultured for about 20 hours, i.e., an obvious yellow hydrolysis circle will appear, such as Figure 2 As shown, strain WY-F4 produced obvious hydrolysis circles on the CAS plate, indicating the production of siderophores;
[0032] (2) Quantitative screening of the ability of bacterial strains to produce siderophores
[0033] 1 mL of the bacterial suspension of the strain to be tested was taken and inoculated into the MKB liquid culture medium; cultured at 28°C, 180 r / min for 48 h; the culture medium was centrifuged for 10 min (1200 r / min), 200 μL of the supernatant (the reference value (Mr) was 200 μL of uninoculated MKB liquid culture medium added during the determination) was taken and mixed with the CAS detection solution in a ratio of 1:1; after reacting at room temperature for 1 h, the OD value (M) at a wavelength of 630 nm was measured by an ELISA instrument; in the experiment, if no iron carrier was produced, , the CAS liquid culture medium is blue like the control, if the strain produces siderophore, the CAS liquid culture medium changes to orange; the M / Mr ratio represents the relative content of siderophore in the sample, the smaller the value, the stronger the ability of the strain to produce siderophore, and the (Mr-M) / Mr ratio represents the activity unit of siderophore in the sample, the higher the activity unit, the stronger the ability to produce siderophore; the results show that the WY-F4 strain has the highest activity unit of siderophore production among the screened strains, reaching 58.4%;
[0034] Take the bacterial suspension of the strains obtained by screening and grow to the logarithmic phase, collect the bacteria by centrifugation, and extract genomic DNA using a kit; design and synthesize primers based on the conserved region in bacterial 16S rDNA, which are 27-F and 1492-R,
[0035] 27 - F: GAGAGTTTGATCCTGGCTCAG;
[0036] 1492 - R: AAGGAGGTGATCCARCCGCA;
[0037] Using the pair of primers, amplify with the extracted genomic DNA as a template to obtain a PCR product; after gel electrophoresis detection, sequencing was completed by Shanghai Majorbio Bio - Pharm Technology Co., Ltd.
[0038] Using the pair of primers, amplify with the extracted genomic DNA as a template to obtain a PCR product; after gel electrophoresis detection, sequencing was completed by Shanghai Majorbio Bio - Pharm Technology Co., Ltd.
[0039] The obtained assembled sequence was aligned with the existing 16S rDNA sequences in the GenBank database through the Blast program, showing 97% high homology with Paenibacillus sp., and the strain WY - F4 was preliminarily identified as Paenibacillus sp.
[0040] For the Paenibacillus sp. WY - F4 described in the present invention, the growth curve of this bacterium was studied, as Figure 3 shown, and different degrees of tolerance (or resistance) to 6 kinds of tested metal ions (Cd 2+ 、Cu 2+ 、Hg 2+ 、Pb 2+ 、Zn 2+ 、Fe 3+ ) were presented; in view of the co - existence of multiple heavy metal pollutions in heavy - metal - contaminated soils in China, the remediation effect is less affected by heavy - metal inhibition during the implementation of enhanced remediation.
[0041] The Paenibacillus sp. WY - F4 described in the present invention relies on groups including hydroxyl, carbonyl, amide, and phosphate groups on the cell wall to adsorb heavy metals on the surface.
[0042] The secondary object of the present invention is to provide a specific bacterial agent containing Paenibacillus sp. WY - F4; the specific formula is as follows:
[0043] The weight percentages of each component are: 10wt% - 18wt% of decomposed agricultural by - products, 10% - 20wt% of calcium magnesium phosphate fertilizer, 5% - 15wt% of biochar, 5wt% - 15wt% of rice bran, 2.0% - 3.0% of microbial fermentation broth, and the microorganism in the microbial fermentation broth is Paenibacillus sp. WY - F4 with the preservation number of CGMCC NO.26649.
[0044] The preparation of the above - mentioned microbial fermentation broth is as follows:
[0045] a. Activation of bacterial strain:
[0046] Inoculate Paenibacillus sp. WY-F4 on the slant of solid seed medium, and activate and culture it at 25 - 35°C for 24 - 48 h;
[0047] Solid NB seed medium: peptone 10 g / L, beef extract 5 g / L, sodium chloride 10 g / L, water 1 L, agar 2%, pH natural;
[0048] b. Preparation of seed liquid:
[0049] Inoculate Paenibacillus sp. WY-F4 from the slant of solid seed medium into liquid seed medium, and shake and culture it at 25 - 35°C for 24 - 48 h to prepare seed liquid;
[0050] Liquid seed medium (NB): peptone 5 - 10 g / L, beef extract 5 - 10 g / L, sodium chloride 5 - 10 g / L, water 1 L, pH natural;
[0051] c. Fermentation in seed tank:
[0052] Inoculate the seed liquid obtained in step b into the seed tank at an inoculum size of 5% - 8% (volume percentage of the medium to be inoculated), and use NB medium for the seed liquid; introduce sterile air and stir, culture at 25 - 35°C for 24 - 36 h, aeration rate 1 - 2 Vols / vol·min, stirring speed 150 - 250 rpm. After fermentation, the content of Paenibacillus sp. WY-F4 in the microbial fermentation broth is: 1×10 6 ~1×10 8 CFU / ml;
[0053] d. Culture in production fermenter:
[0054] Inoculate the fermentation broth of the seed tank into the fermenter at an inoculum size of 5% - 8% (volume percentage of the medium), introduce sterile air and stir, culture at 28 - 35°C for 24 - 36 h, aeration rate 1 - 2 Vols / vol·min, stirring speed 180 - 250 rpm. After fermentation, the content of Paenibacillus sp. WY-F4 in the microbial fermentation broth is: 1×10 8 ~1×10 9 CFU / ml;
[0055] Fermenter medium formula: Liquid fermentation medium: molasses 10 - 20 g / L, soy peptone 2 - 7 g / L, KH2PO4 0.1 - 1.5 g / L, K2HPO4 0.1 - 2.2 g / L, MnSO4﹒H2O 0.01 - 0.2 g / L, H2O 1 L, pH 6.5 - 8.0.
[0056] When preparing the bacterial agent of the present invention, each component can be mixed in turn.
[0057] The above-mentioned components of the decomposed agricultural by-products (crop straws, tea seed cakes, pig manure) are a kind of high-quality organic fertilizer, with an organic matter content of 20wt%-50wt%. The active groups it has (such as carboxyl groups, amino groups, and hydroxyl groups, etc.) can easily act as ligands to complex or chelate with heavy metal elements such as Cd, and passivate or adsorb heavy metals in the soil.
[0058] The main components of the above-mentioned calcium magnesium phosphate fertilizer include Ca3(PO4)2, CaSiO3, and MgSiO3. Its main chemical composition is: MgO≥15%, SiO2≥22%, CaO≥30%. It can increase the content of available calcium, magnesium, and silicon in the soil, increase the soil pH value, reduce the content of available cadmium in the soil, and thus prevent rice from absorbing too much heavy metal.
[0059] The above-mentioned biochar is mainly a kind of insoluble, stable, highly aromatic, carbon-rich solid substance produced by the slow pyrolysis of residues such as agricultural and forestry waste and organic waste under anaerobic conditions. Biochar has a porous structure, a huge specific surface area, a large number of negative charges and a high charge density on the surface, and is rich in a series of oxygen-containing, nitrogen-containing, and sulfur-containing functional groups, with a large cation exchange capacity, and is a good adsorption material.
[0060] The above-mentioned rice bran is mainly made from the processing of pericarp, seed coat, outer endosperm, aleurone layer and embryo. The average protein content in conventional rice bran is 15%, the fat content is 16%-22%, the sugar content is 3%-8%, the moisture content is 10%, and the calorific value is about 125.1 KJ / g; most of the main fatty acids in the fat are unsaturated fatty acids such as oleic acid and linoleic acid, and it contains high amounts of vitamins, phytol, dietary fiber, amino acids and minerals, etc., which are beneficial to the growth and colonization of microorganisms.
[0061] Field experiment design:
[0062] In 2022, a field experiment was carried out in a certain town in Heshan District, Yiyang City (low to medium cadmium pollution in the soil).
[0063] (1) Experiment design:
[0064] The experimental field was divided into 3 treatments in total. A control group (CK) without applying any materials was set; 10L of inactivated strain WY-F4 fermentation broth was applied to the plot (L1); 10L of strain WY-F4 fermentation broth was applied to the plot (L2); 100kg of organic passivator was applied per mu according to the weight parts of 15 parts of decomposed agricultural by-products, 15 parts of calcium magnesium phosphate fertilizer, 12 parts of biochar, 5 parts of rice bran, and 10L of the developed microbial bacterial agent were mixed (L3). Each treatment was repeated 3 times, with a total of 12 plots. The plot area for planting rice was 30.0m 2(5m×6m), separated by wrapping the ridge with 0.2m wide thick plastic film (buried 0.4m deep); Field management, topdressing and pest control: carried out in the conventional way of local farmers;
[0065] (2) Select the late rice variety Taiyou Yuezhan;
[0066] (3) Application method:
[0067] Reasonably adjust the application rate according to the soil nutrient conditions and pollution status, and evenly spread it across the whole field before land preparation (it can also be evenly spread after mixing with the base fertilizer), and it can be planted after tillage and harrowing;
[0068] (4) Detection items:
[0069] Available cadmium content in soil, cadmium content in polished rice, rice yield;
[0070] (5) Main results:
[0071] The results show that (as shown in Table 1), after applying this microbial inoculant until the rice matures, the available cadmium in the soil of heavy metal contaminated paddy fields can be reduced by 55.42%, the cadmium content in rice can be reduced by 63.79%, and the rice yield can be increased by 5.22%.
[0072] Table 1 Cadmium reduction and yield increase effects of the inoculant on rice in cadmium contaminated farmland and comparative tests
[0073]
[0074] *CK - Control group without treatment, L1 - Inactivated WY - F4 bacteria, L2 - WY - F4, L3 - Mixed inoculant containing WY - F4 fermentation broth.
[0075] The above - mentioned microbial fermentation broth components refer to the fermentation broth of Paenibacillus sp. WY - F4. On the one hand, this microorganism can rely on groups such as hydroxyl (-OH), carbonyl (-CO-), amide (-CO - NH-), phosphate (-PO4 3- ) on the cell wall for surface adsorption, and complex and fix heavy metal cadmium in the soil through its metabolites for extracellular complexation and extracellular precipitation.
[0076] The Paenibacillus sp. WY-F4 of the present invention is derived from the cadmium-polluted paddy soil in Nijiangkou Town, Heshan District, Yiyang City. It is Gram-positive, aerobic, rod-shaped, and spore-forming. It is preliminarily identified as Paenibacillus sp. through 16S rDNA molecular identification and phylogenetic analysis. In the soil, this strain has strong colonization ability, can efficiently passivate heavy metals in the soil, and reduce the absorption by plants. The Paenibacillus sp. WY-F4 (Bacillus bataviensis) was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on February 21, 2023, with the deposit number CGMCC NO. 26649. This strain has a remarkable effect in reducing the available cadmium in the soil and the cadmium in rice grains, and also secretes siderophores to promote plant growth and increase rice yield.
[0077] Investigate the effect of applying siderophore-producing inoculum into municipal sludge on composting:
[0078] Referring to the moisture content of each material, according to the material ratios of each group (as shown in Table 2 and Table 3), after counting, add the bacterial solution to ensure that the order of magnitude of the added colony numbers is the same.
[0079] Table 2 Moisture content, carbon, nitrogen content and carbon-nitrogen ratio of materials
[0080]
[0081] Table 3 Material ratio table of each group
[0082]
[0083]
[0084] * The moisture content of the 3 mixed material groups is 55.04% - 57.44%; control group - only add the same amount of water; F4 group - add inactivated WY-F4 inoculum; WY-F4 group - add WY-F4 inoculum.
[0085] During the experiment, continuous ventilation is carried out, and the ventilation volume plan is as follows in Table 4;
[0086] Table 4 Experimental ventilation volume
[0087]
[0088] During the experiment, when the temperature of the water control compost pile reaches above 70°C, take about 20 g of samples from the high-temperature area near the temperature sensor in the pile body, and send the samples to the Hunan Institute of Microbiology on the same day for isolation and screening of strains (this experiment depends on the situation).
[0089] Experimental conclusion:
[0090] During the experiment, the temperature change trends of the F4 and WY-F4 compost piles are as Figure 4 and Figure 5。
[0091] As Figure 4 、 Figure 5 and shown in Table 5, from the perspective of the temperature rise of the pile body in the first 15 h in the figure and the time taken for the pile body temperature to reach the high-temperature period (above 55 °C), the F4 group is 4 h faster than the control group, and the WY-F4 group is 4.5 h faster than the control group respectively, indicating that the temperature rise rate in the early stage of the bacteria-added group is faster than that of the water control group.
[0092] Table 5 Record Table of Pile Temperature Conditions
[0093]
[0094]
[0095] From the perspective of the duration of maintaining the high-temperature period (above 55 °C), the maintaining duration of the WY-F4 group is 10.5 h longer than that of the water control group. The microorganisms in the pile body benefit from the siderophore protein produced by WY-F4, which promotes the absorption of iron ions and strengthens the microbial respiration, making the high-temperature period of the pile body last longer. It can be seen from the pile temperature conditions in Table 5 that the WY-F4 group is superior to the control group in terms of the time taken to reach the high-temperature period, the duration of the high-temperature period and the duration of maintaining above 70 °C, as well as the highest temperature.
[0096] During the experiment, the change trends of the physical and chemical indexes of the materials are as follows:
[0097] Table 6 Change Trend of Moisture Content (%) (Sampling and Detection after Turning the Pile)
[0098]
[0099] Table 7 Change Trend of Organic Matter Content (%) (Sampling and Detection after Turning the Pile)
[0100]
[0101]
[0102] It can be seen from the results of Table 6 and Table 7 that the moisture content of the pile body in the WY-F4 group is lower than that of other groups, and the organic matter degradation rate is significantly higher than that of other groups, indicating that the addition of the siderophore protein-producing bacterium WY-F4 promotes the improvement of microbial metabolic activities, and further decomposes more organic matter, extending the high-temperature time of the pile body.
[0103] As can be seen from the above, the Paenibacillus sp. WY-F4 strain of the present invention is derived from cadmium-polluted paddy soil in a certain place in Heshan District, Yiyang City. It is Gram-positive, aerobic, rod-shaped, spore-forming, and is preliminarily identified as Paenibacillus sp. by 16S rDNA molecular identification and phylogenetic analysis.
[0104] The specific formula for preparing the microbial inoculant based on this strain is as follows:
[0105] The weight percentages of the respective components are as follows: 10 wt% to 18 wt% of decomposed agricultural by-products, 10% to 20 wt% of calcium magnesium phosphate fertilizer, 5% to 15 wt% of biochar, 5 wt% to 15 wt% of rice bran, and 2.0% to 3.0% of microbial fermentation broth. The microorganism in the microbial fermentation broth is Bacillus sphaericus WY-F4 with the preservation number CGMCC NO. 26649.
[0106] Bacillus sphaericus WY-F4 fermentation broth. On the one hand, this microorganism can rely on groups such as hydroxyl (-OH), carbonyl (-CO-), amide (-CO-NH-), and phosphate (-PO4 3- ) on the cell wall for surface adsorption, and through its metabolites, it can carry out extracellular complexation, extracellular precipitation, etc. to complex and fix heavy metal cadmium in the soil;
[0107] In the soil, this strain has strong colonization ability, can efficiently passivate heavy metals in the soil, and reduce the absorption by plants. The Bacillus sphaericus WY-F4 (Bacillus bataviensis) was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on February 21, 2023, with the deposit number CGMCC NO. 26649. The microbial agent prepared based on Bacillus sphaericus WY-F4 can reduce the available cadmium in the soil of heavy metal-polluted paddy fields by 55.42% respectively, reduce the cadmium content in rice by 63.79%, and increase the rice yield by 5.22%. At the same time, the siderophores contained can enable compost microorganisms to better utilize iron elements, promote the temperature rise of compost, and compared with compost only added with water, it can greatly extend the high-temperature stage time of municipal sludge compost, having great popularization and application value.
[0108] The embodiments of the present invention are given for the purposes of illustration and description. Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.
Claims
1. A bacterial agent containing Paenibacillus, characterized in that: It contains the strain Paenibacillus sp. WY-F4, which is deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms with the deposit number of CGMCC NO. 26649.
2. The bacterial agent containing Paenibacillus as described in claim 1, characterized in that: The preparation raw materials of the microbial agent include decomposed agricultural by-products, calcium magnesium phosphate fertilizer, biochar, rice bran, and a microbial fermentation broth containing the WY-F4 strain, and the weight percentages of each component are as follows: decomposed agricultural by-products 10wt% - 18wt%, calcium magnesium phosphate fertilizer 10% - 20wt%, biochar 5% - 15wt%, rice bran 5wt% - 15wt%, and microbial fermentation broth 2.0% - 3.0%.
3. The bacterial agent containing Paenibacillus as described in claim 1, characterized in that: The preparation steps of the microbial fermentation broth include: inoculating Paenibacillus sp. WY-F4 on a solid seed medium slant for activation culture, then inoculating it into a liquid seed medium to prepare a seed solution, and finally inoculating the seed solution into a seed tank and a fermentation tank for fermentation culture. After fermentation, the content of Paenibacillus sp. WY-F4 in the microbial fermentation broth is 1×10 8 ~1×10 9 CFU / ml.
4. A method for repairing heavy metal contaminated soil using the microbial agent according to any one of claims 1 to 3, characterized in that, It includes applying the microbial agent to heavy metal-polluted soil to reduce the available cadmium content in the soil and reduce the cadmium absorption of crops.
5. A method for promoting compost maturity by using the bacterial agent described in any one of claims 1 to 3, characterized in that, It includes adding the microbial agent during the composting process to promote the utilization of iron elements by composting microorganisms, increase the composting temperature, and extend the duration of the high-temperature stage.
Citation Information
Patent Citations
Composite soil passivator for reducing contents of cadmium and lead as well as preparation method and application method of composite soil passivator
CN104193546A
Strain and microbial agent capable of reducing content of cadmium as well as preparation and application methods of strain and microbial agent
CN104195070A
Cadmium-resistant growth-promoting paenibacillus strain and application thereof
CN113699059A
Sludge aerobic composting complex microbial inoculant as well as preparation method and application thereof
CN114350579A
Application of paenibacillus kribbensis space mutant strain in repairing Cd pollution
CN115739977A