Bifidobacterium animalis subsp. Lactis Ca360 and application thereof
Through the animal Bifidobacterium milk subspecies Ca360, it promotes mineral absorption and transport, solves the problem of low mineral absorption efficiency, improves osteoporosis and iron deficiency anemia, and enhances intestinal health.
Patent Information
- Application Number
- CN202510791325.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-13
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2045-06-13
AI Technical Summary
In the prior art, health problems such as osteoporosis and iron deficiency anemia caused by low mineral absorption efficiency have not been effectively solved, and common probiotic strains have significantly different effects in promoting mineral absorption.
It provides an animal Bifidobacterium milk subspecies Ca360, which promotes the absorption and transport of calcium, iron and zinc, and improves osteoporosis and iron deficiency anemia by reducing intestinal pH, secreting organic acids and regulating the expression of metal ion transporters.
It significantly improves the absorption rate of minerals, improves the symptoms of osteoporosis and iron deficiency anemia, regulates zinc metabolism, and enhances intestinal health.
Smart Images

Figure CN120330110A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of microorganisms and food, and specifically to Bifidobacterium animalis subsp. lactis Ca360 and its applications. This strain can promote the absorption and transport of minerals, and improve osteoporosis and iron deficiency anemia. Background Art
[0002] Minerals (such as calcium, iron, zinc, etc.) are important nutrients for maintaining normal physiological functions of the human body, and are involved in various life activities such as bone development, nerve conduction, blood formation, and immune regulation. However, low mineral absorption efficiency is a common nutritional problem globally, which is prone to cause mineral deficiency diseases and lead to serious health risks. Minerals cannot be synthesized in the human body by themselves and must be supplemented through diet. The minerals that are relatively easy to be lacking in the diet of Chinese residents mainly include: calcium, iron, zinc, iodine, and selenium. Among them, calcium, iron, and zinc are the most common minerals that are easily lacking.
[0003] Osteoporosis is a bone metabolic disorder disease characterized by damaged microstructure of bone tissue, continuous reduction of the proportion of bone mineral components and bone matrix, thinning of bone mass, reduction of trabecular bone number, increased bone brittleness, and elevated fracture risk. At present, the treatment methods for osteoporosis are limited. Although the drug-based intervention means have certain effects, they cannot completely cure the disease, and long-term medication will also cause many side effects to patients, resulting in the ineffective treatment of this symptom.
[0004] Iron is a component of hemoglobin; it participates in the transportation and exchange of oxygen and carbon dioxide; it is a constituent of enzymes and is also essential for energy production. Inadequate intake will lead to anemia, pale complexion, tongue pain, fatigue, listlessness, loss of appetite, nausea, and sensitivity to cold.
[0005] Zinc is the most emphasized element. Zinc is a component of more than 200 enzymes in the body as well as DNA and RNA, and is an essential substance for growth and development. It is also important for wound healing. It can regulate the secretion of hormones from organs such as the testis and ovary, and is also helpful for effectively relieving stress. It can also promote the health of the nervous system and the brain, especially for the developing fetus. It is helpful for the formation of bones and teeth, hair growth, and energy homeostasis. Symptoms of inadequate intake: dull taste and smell, at least two white spots on the fingernails, easy to be infected, stretch marks on the skin, acne or excessive skin oil secretion, low fertility, pale skin color, depressive tendency, loss of appetite.
[0006] SCFAs, especially acetic acid, propionic acid, and butyric acid, not only indirectly improve bone health by promoting intestinal barrier function and nutrient absorption but also directly promote bone formation and inhibit bone resorption by reducing systemic inflammation and regulating hormones related to bone metabolism. Butyric acid enhances osteoblast function, and propionic acid inhibits osteoclast activity. Studies have shown that probiotics have a positive effect on the composition and metabolism of the gut microbiome with respect to iron, calcium, selenium, and zinc. Moreover, probiotics have an independent role in promoting mineral absorption. In addition, certain specific probiotic strains can increase the absorption rate of minerals by lowering the intestinal pH, secreting organic acids, promoting intestinal mucosal health, or regulating the expression of metal ion transporters. However, there are significant differences in the effects of different strains on promoting mineral absorption. Bifidobacterium lactis has been reported to have effects such as improving osteoporosis or promoting bone health, but there is still little information on Bifidobacterium lactis that can both promote mineral absorption and transport and improve osteoporosis and iron-deficiency anemia. In addition, the currently most well-known commercial probiotic for promoting mineral absorption, improving bone health, and treating anemia is Lactiplantibacillus plantarum Lp299V. Summary of the Invention
[0007] The present invention first provides a Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp. lactis ) Ca360, which was deposited on October 30, 2024, at the China General Microbiological Culture Collection Center (No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with the taxonomic name of Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp. lactis ), strain number BL-M40, and deposit number CGMCC No. 32403. Bifidobacterium animalis subsp. lactis ).
[0008] In one or more embodiments, the nucleic acid sequence of the 16S rRNA gene of the Bifidobacterium animalis subsp. lactis Ca360 described herein is as shown in SEQ ID NO:3.
[0009] The present invention also provides a culture of Bifidobacterium animalis subsp. lactis Ca360 with a deposit number of CGMCC No. 32403.
[0010] In one or more embodiments, the culture further contains a culture medium, such as MRS medium.
[0011] The present invention also provides a pharmaceutical composition comprising (1) a pharmaceutically acceptable excipient and (2) Bifidobacterium animalis subsp. lactis with a deposit number of CGMCC No. 32403, the culture described in any one of the embodiments herein, or the preparation described in any one of the embodiments herein, and In one or more embodiments, the excipients are excipients suitable for Bifidobacterium animalis subsp. lactis.
[0012] The present invention also provides a microbial preparation comprising the Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403 and / or its culture, lysate or extract.
[0013] In one or more embodiments, the preparation is selected from one or more of the following: powder, pill, capsule, granule, tablet, oil drop, liquid preparation or gel.
[0014] In one or more embodiments, the preparation further comprises at least one excipient suitable for the microbial preparation.
[0015] In one or more embodiments, the preparation is a bacterial suspension, comprising Bifidobacterium animalis subsp. lactis and a buffer solution. The buffer solution can be a phosphate buffer solution, preferably PBS.
[0016] In one or more embodiments, the preparation is a bacterial powder, comprising the Bifidobacterium animalis subsp. lactis described herein. The method for preparing the bacterial powder includes: centrifuging the fermentation broth of the Bifidobacterium animalis subsp. lactis, collecting the bacterial cells, adding a freeze-drying protectant to the obtained bacterial cells, and performing vacuum freeze-drying to obtain a freeze-dried powder.
[0017] The present invention also provides a product comprising the Bifidobacterium animalis subsp. lactis Ca360 described in any one of the embodiments herein, the culture described in any one of the embodiments herein, and / or the preparation described in any one of the embodiments herein.
[0018] In one or more embodiments, the product is a food, a health product or a medicine.
[0019] In one or more embodiments, the food further comprises raw and auxiliary materials, and the excipients in the raw and auxiliary materials include but are not limited to additives and / or nutritional fortifiers.
[0020] In one or more embodiments, the additives include but are not limited to flavoring agents, stabilizers, thickeners, preservatives, antioxidants, emulsifiers.
[0021] In one or more embodiments, the nutritional fortifiers include but are not limited to vitamins, minerals, amino acids, fatty acids, dietary fibers.
[0022] In one or more embodiments, the food includes but is not limited to dairy products, soy products, probiotic powder, probiotic oil drops, dietary fiber supplements, nutritional bars, rice flour, fruit puree, fruit and vegetable juice, food solid beverages, fruit juice, ice cream, candies, biscuits, infant milk powder, foods for special medical purposes.
[0023] In one or more embodiments, the dosage forms of the health products include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions or suspensions.
[0024] In one or more embodiments, the dosage forms of the drugs include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions or suspensions.
[0025] In one or more embodiments, the drugs further include pharmaceutically acceptable excipients.
[0026] The present invention also provides the use of the Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403 or the microbial preparation described in any embodiment herein, and the use is selected from one or more of the following: (a) the use in the preparation of a drug for increasing the content of short-chain fatty acids in the intestine; (b) the use in the preparation of a drug for improving uterine atrophy or its symptoms; (c) the use in the preparation of a drug for promoting the absorption and transport of minerals; (d) the use in the preparation of a drug for improving osteoporosis or its symptoms; (e) the use in the preparation of a drug for improving iron deficiency anemia or its symptoms; (f) the use in the preparation of a microbial preparation resistant to gastric acid, intestinal juice and / or bile salts; (g) the use in the preparation of a drug for improving zinc deficiency or its symptoms. The present invention also provides the use of the Bifidobacterium animalis subsp. lactis Ca360, the culture, preparation, and / or product described in any embodiment herein, and the use includes one or more of the following: (a) the non-therapeutic use for increasing the content of short-chain fatty acids in the intestine; (b) the non-therapeutic use for improving uterine health; (c) the non-therapeutic use for promoting the absorption and transport of minerals; (d) the non-therapeutic use for improving bone health; (e) the non-therapeutic use for improving iron metabolism; or (f) the non-therapeutic use for improving zinc deficiency.
[0027] In one or more embodiments, the short-chain fatty acid is total short-chain fatty acid.
[0028] In one or more embodiments, the short-chain fatty acid includes one or more selected from the following: acetic acid, propionic acid and butyric acid.
[0029] In one or more embodiments, the uterine atrophy or its symptoms are caused by estrogen deficiency.
[0030] In one or more embodiments, the mineral is a divalent metal element, preferably including one or more selected from the following: calcium (Ca), iron (Fe) and zinc (Zn), and preferably, the mineral is calcium element.
[0031] In one or more embodiments, the minerals are present in the product in one or more forms selected from the following: ionic states (such as Ca²⁺, Fe²⁺, Zn²⁺), salts (such as calcium carbonate, ferrous sulfate, zinc gluconate), oxides (such as zinc oxide, iron oxide), and complexes.
[0032] In one or more embodiments, the product is a food, a health product, or a drug.
[0033] In one or more embodiments, the food further includes raw and auxiliary materials, and the auxiliary materials in the raw and auxiliary materials include, but are not limited to, additives and / or nutritional fortifiers.
[0034] In one or more embodiments, the additives include, but are not limited to, flavoring agents, stabilizers, thickeners, preservatives, antioxidants, and emulsifiers.
[0035] In one or more embodiments, the nutritional fortifiers include, but are not limited to, vitamins, minerals, amino acids, fatty acids, and dietary fiber.
[0036] In one or more embodiments, the food includes, but is not limited to, dairy products, soy products, probiotic powders, probiotic oil droplets, dietary fiber supplements, nutrition bars, rice noodles, purees, fruit and vegetable juices, food solid beverages, fruit juices, ice creams, candies, biscuits, infant milk powder, and foods for special medical purposes.
[0037] In one or more embodiments, the dosage forms of the health products include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions, or suspensions.
[0038] In one or more embodiments, the dosage forms of the drugs include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions, or suspensions.
[0039] In one or more embodiments, the drugs further include pharmaceutically acceptable auxiliary materials. Description of the Drawings
[0040] Figure 1 : Gram staining diagram of the strain: Gram-positive;
[0041] Figure 2 : Streak plate of the strain;
[0042] Figure 3 : Growth curve diagram of the strain;
[0043] Figure 4: Hemolytic plate negative; 1. Negative control bacterium: Listeria innocua CICC 10417; 2. Positive control bacterium: Staphylococcusaurecus CICC 10473; 3. Sample: Bifidobacterium animalis subsp. lactis Ca360. Note: Test report number: CICC 25 - 0282 - 00497.04 - 00900.
[0044] Figure 5 : Tolerance of Bifidobacterium animalis subsp. lactis Ca360 to artificial gastric juice, artificial intestinal juice and artificial bile salts;
[0045] Figure 6 : In vitro fermentation model of the simulated intestine: Short-chain fatty acids, pH and extracellular and intracellular phytase;
[0046] Figure 7 : Bifidobacterium animalis subsp. lactis Ca360 can promote the absorption of Ca, Fe and Zn by cells;
[0047] Figure 8 : Osteoporosis mouse model: Body weight and uterine index;
[0048] Figure 9 : Osteoporosis mouse model: Blood indexes;
[0049] Figure 10 : Osteoporosis model: MicroCT bone microstructure;
[0050] Figure 11 : Osteoporosis model: Short-chain fatty acids in mouse feces;
[0051] Figure 12 : Iron-deficiency anemia model: Blood cell analysis.
[0052] Figure 13 : Zinc metabolism mouse model: Blood zinc content and related protein expression.
[0053] Figure 14 : Zinc metabolism mouse model: Results of HE staining of the colon. Detailed implementation manners
[0054] Probiotics have a positive effect on the composition and metabolism of the intestinal microbiome with respect to iron, calcium and zinc. And probiotics have an independent role in promoting mineral absorption. Certain specific probiotic strains can increase the absorption rate and utilization rate of minerals by reducing the intestinal pH value, secreting organic acids, promoting intestinal mucosa health or regulating the expression of metal ion transporters, promoting the absorption of calcium and iron by the body, and thus promoting bone health or improving iron-deficiency anemia. However, there are significant differences in the effects of different strains in promoting mineral absorption.
[0055] The present application provides a Bifidobacterium animalis subsp. lactis Ca360 that can promote mineral absorption, and it also has excellent functions of improving osteoporosis, iron deficiency anemia, and regulating zinc metabolism.
[0056] Bifidobacterium animalis subsp. lactis
[0057] The invention first provides a Bifidobacterium animalis subsp. lactis Ca360, which was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on October 30, 2024. Its taxonomic name is Bifidobacterium animalis subsp. lactis, the strain number is BL-M40, and the deposit number is CGMCC No. 32403. Bifidobacterium animalis subsp. lactis Ca360 belongs to the genus Bifidobacterium and was isolated from the intestines of healthy children in Anyang, Henan. The genus Bifidobacterium is a genus of Gram-positive, non-motile, rod-shaped cells, sometimes bifurcated at one end, and strictly anaerobic bacteria, which are widely present in the digestive tract, vagina, and oral cavity of humans and animals. The nucleic acid sequence of the 16S rRNA gene of the Bifidobacterium animalis subsp. lactis Ca360 described herein is shown in SEQ ID NO:3. The Bifidobacterium animalis subsp. lactis Ca360 described herein does not contain drug resistance genes and virulence genes.
[0058] The present invention also provides a culture of Bifidobacterium animalis subsp. lactis Ca360 with a deposit number of CGMCC No. 32403. The culture described herein also contains a culture medium, and any culture medium suitable for Bifidobacterium is included, such as BS medium, MRS medium, BBL medium, and Bifidobacterium agar medium.
[0059] The present invention also provides a lysate of Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403. Methods for lysing Bifidobacterium animalis subsp. lactis are well known in the art, such as physical lysis methods (ultrasonic lysis, high-pressure homogenization lysis, glass bead grinding method), chemical lysis methods (enzymatic lysis, surfactant lysis), biological lysis methods (phage lysis, autolysis method), and combined lysis methods (enzymolysis + ultrasound, chemical + physical). Those skilled in the art can select the lysis method according to the composition and morphological requirements of the lysate.
[0060] The present invention also provides an extract of Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403 (such as polysaccharides, proteins, nucleic acids, metabolites, etc.). Methods for preparing extracts of Bifidobacterium animalis subsp. lactis are well known in the art, including but not limited to: pretreatment of bacterial cells (centrifugation, washing), lysing the bacterial cells to release components (referring to the lysis methods described above, those skilled in the art can select a suitable lysis method according to the target component), separation and purification of the extract (those skilled in the art can select separation techniques according to the properties of the target component, for example: polysaccharides (water extraction and alcohol precipitation method, column chromatography), proteins (salting-out method, chromatography, electrophoresis), nucleic acids (phenol-chloroform method, column extraction method), metabolites (gas chromatography, high-performance liquid chromatography)), concentration and drying (rotary evaporation, ultrafiltration, freeze-drying, spray drying). Those skilled in the art know the methods for detecting the purity and activity of the extract.
[0061] Therefore, the present invention also provides a preparation containing Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403 and / or its culture, lysate or extract. In some embodiments, the reagent is a microbial preparation. In one or more embodiments, the preparation can be a powder, pill, capsule, granule, tablet, oil drop, liquid preparation or gel.
[0062] It should be understood that although Bifidobacterium animalis subsp. lactis Ca360 provided in the examples of the present invention is isolated from the intestines of healthy children, the same gene sequences derived from animal intestines or fermented foods are also included within the scope of the present invention, as long as those skilled in the art can conveniently isolate and purify the strain from them according to the information provided in this application after reading this application.
[0063] Application of Bifidobacterium animalis subsp. lactis
[0064] The present invention also provides the above-mentioned Bifidobacterium animalis subsp. lactis ( Bifidobacterium animalis subsp. lactis) The applications of Ca360 or the microbial agents described herein include one or more selected from the following: (a) the application in the preparation of a drug for increasing the content of short-chain fatty acids in the intestine; (b) the application in the preparation of a drug for improving uterine atrophy or its symptoms; (c) the application in the preparation of a drug for promoting mineral absorption and transport; (d) the application in the preparation of a drug for improving osteoporosis or its symptoms; (e) the application in the preparation of a drug for improving iron-deficiency anemia or its symptoms; (f) the application in the preparation of a drug resistant to gastric acid, intestinal fluid, and / or bile salts; (g) the application in the preparation of a drug for improving zinc deficiency or its symptoms.
[0065] In this article, the short-chain fatty acids refer to total short-chain fatty acids, which include one or more selected from the following: acetic acid, propionic acid, and butyric acid. The term "short-chain fatty acids" refers to organic fatty acids with less than 6 carbon atoms, mainly including acetic acid, propionic acid, and butyric acid. In the intestine, short-chain fatty acids can provide energy for intestinal cells (butyric acid is the main energy source of colonic epithelial cells) and regulate glycolipid metabolism (such as propionic acid can regulate blood sugar and affect lipid synthesis), can maintain the balance of the intestinal flora (provide nutrition for beneficial bacteria, inhibit the growth of harmful bacteria, and regulate the diversity and stability of the flora), can enhance the intestinal barrier function (promote the expression of tight junction proteins and maintain the mucus layer), and can also regulate intestinal immunity (affect the function of immune cells, balance inflammatory mediators, and reduce intestinal inflammation).
[0066] In this article, uterine atrophy refers to the reduction in the volume of the uterus and the decline in its function, which is related to factors such as the decrease in estrogen levels (such as after menopause). The related symptoms of uterine atrophy include, but are not limited to, menstrual changes, frequent urination, urgency of urination, or urinary incontinence, a feeling of fullness or dull pain in the lower abdomen. In some embodiments, improving the symptoms of uterine atrophy includes increasing the uterine index.
[0067] In this article, the symptoms of osteoporosis include, but are not limited to: low back pain, limb pain, height shortening, hunchback, fractures, dyspnea, cough, shortness of breath, muscle weakness, loose teeth, tooth loss, decreased bone mineral density, decreased bone volume fraction, decreased bone surface area to tissue volume ratio, or decreased trabecular bone number caused by osteoporosis, etc. In some embodiments, improving the symptoms of osteoporosis includes: reducing the level of bone resorption, reducing the level of parathyroid hormone, increasing the level of VD3, improving bone destruction activity, promoting calcium and phosphorus metabolism balance, increasing bone mineral density, increasing bone surface area to tissue volume ratio, increasing trabecular bone number, and increasing trabecular spacing.
[0068] In this text, the symptoms of iron-deficiency anemia include, but are not limited to: fatigue, dizziness, loss of appetite, abdominal distension, glossitis, angular cheilitis, palpitations, shortness of breath, increased heart rate, murmurs, dry skin, dry hair, growth retardation, syncope, low ferritin levels, or high serum total iron binding capacity, etc. In some embodiments, improving the symptoms of iron-deficiency anemia includes: increasing hemoglobin levels, increasing hematocrit levels, increasing mean corpuscular volume levels, increasing ferritin levels, decreasing serum total iron binding capacity, increasing iron reserves, improving iron metabolism, and reducing the demand for iron transport.
[0069] In this text, the symptoms of zinc deficiency include, but are not limited to: malnutrition, growth retardation, reproductive system abnormalities, susceptibility to infection, poor appetite, poor skin condition, low serum zinc levels, high inflammation levels, etc. In some embodiments, improving the symptoms of zinc deficiency includes: increasing serum zinc levels, increasing serum SOD enzyme activity, increasing serum GPx enzyme activity, improving antioxidant levels, alleviating inflammation, reducing inflammatory cell infiltration, regulating the intestinal flora, enhancing barrier function, inhibiting pro-inflammatory pathways, improving the intestinal microenvironment, and promoting zinc absorption.
[0070] The present invention also provides the use of the Bifidobacterium animalis subsp. lactis Ca360, the culture, preparation, and / or product described in any embodiment herein, and the use includes one or more selected from the following: (a) non-therapeutic use of increasing the content of short-chain fatty acids in the intestine; (b) non-therapeutic use of improving uterine health status; (c) non-therapeutic use of promoting mineral absorption and transport; (d) non-therapeutic use of improving bone health status; (e) non-therapeutic use of improving iron metabolism; or (f) non-therapeutic use of improving zinc deficiency.
[0071] In this text, the non-therapeutic use of improving uterine health status (such as the uterine health status caused by decreased estrogen levels) includes: improving menstrual changes, improving urinary frequency, improving urinary urgency, improving urinary incontinence, improving lower abdominal distension or dull pain.
[0072] In this text, the non-therapeutic use of improving bone health status (such as the bone health status caused by decreased estrogen levels) includes: reducing bone resorption levels, reducing parathyroid hormone levels, increasing VD3 levels, improving bone destruction activity, promoting calcium and phosphorus metabolism balance, increasing bone mineral density, increasing bone surface area to tissue volume ratio, increasing trabecular number, and increasing trabecular spacing.
[0073] In this text, the non-therapeutic use of improving iron metabolism includes: increasing hemoglobin levels, increasing hematocrit levels, increasing mean corpuscular volume levels, increasing ferritin levels, decreasing serum total iron binding capacity, increasing iron reserves, and reducing the demand for iron transport.
[0074] In this article, the non-therapeutic applications for improving zinc deficiency include: non-therapeutic applications for increasing serum zinc levels, increasing serum SOD enzyme activity, increasing serum GPx enzyme activity, improving antioxidant levels, regulating gut microbiota, enhancing barrier function, improving the gut microenvironment, or promoting zinc absorption.
[0075] In this article, the mineral comprises one or more selected from the following: elements of calcium (Ca), iron (Fe) and zinc (Zn), and preferably, the mineral is calcium. Among them, the forms of existence of the mineral in the product include one or more selected from the following: ionic state (such as Ca²⁺, Fe²⁺, Zn²⁺), salts (such as calcium carbonate, ferrous sulfate, zinc gluconate), oxides (such as zinc oxide, iron oxide), and complexes.
[0076] As used herein, "improvement" includes any beneficial or desired effect on the symptoms or lesions of a disease or pathological condition, and may include even a small reduction in one or more measurable markers of a disease or disorder (e.g., osteoporosis). Improvement may optionally include a reduction or remission of the symptoms of a disease or disorder, or a delay in the progression of a disease or disorder. "Improvement" does not necessarily mean the complete eradication or cure of a disease or disorder or its related symptoms.
[0077] Product
[0078] The present invention also provides a product or microbial preparation comprising the Bifidobacterium animalis subsp. lactis Ca360 with the preservation number of CGMCC No. 32403, its culture, lysate, and extract. The product described herein can be a food, a health product, or a drug.
[0079] The product may also contain minerals and micronutrients, such as trace elements and vitamins recommended by government agencies such as USRDA. For example, the product may contain one or more of the following micronutrients in a daily dose: calcium, magnesium, phosphorus, iron, zinc, copper, iodine, selenium, vitamin C, vitamin B1, vitamin B6, vitamin B2, niacin, vitamin B12, folic acid, biotin, vitamin D, vitamin E.
[0080] The product may contain at least one other type of other food-grade bacteria. As used herein, food-grade bacteria refer to the bacteria used and are generally considered safe for use in food, such as Lactobacillus and Bifidobacterium, and the food-grade bacteria are preferably probiotics. The probiotics refer to live microorganisms that are beneficial to the health of the host when ingested in sufficient quantities. The product may further contain at least one prebiotic. The prebiotic refers to a food substance that is expected to promote the growth of probiotics.
[0081] For the purposes of the present invention, a product is considered to contain Bifidobacterium animalis subsp. lactis Ca360 if it contains viable or non-replicating Bifidobacterium animalis subsp. lactis Ca360 cells, any cell debris of Bifidobacterium animalis subsp. lactis Ca360, any fraction containing a culture of Bifidobacterium animalis subsp. lactis Ca360, and / or a culture medium used for culturing Bifidobacterium animalis subsp. lactis Ca360 or a part thereof. The fraction refers to different parts obtained by separating, classifying or grading the culture by a certain method, which may contain at least one of Bifidobacterium animalis subsp. lactis Ca360 cells, cell debris, metabolites, cultures, lysates and extracts of the culture at different concentrations.
[0082] The foods described herein include, but are not limited to: plant-based foods, animal-based foods, microbial fermented foods, processed foods, food additives. Further, the foods include, but are not limited to, dairy products, soy products, probiotic oil droplets, dietary fiber supplements, nutrition bars, rice flour, fruit puree, fruit and vegetable juices, food solid beverages, fruit juices, ice cream, candies, biscuits, infant milk powder, foods for special medical purposes. The foods may also include raw and auxiliary materials, and the auxiliary materials in the raw and auxiliary materials include, but are not limited to, additives and / or nutritional fortifiers. The additives described herein include, but are not limited to, flavors, stabilizers, thickeners, preservatives, minerals, vitamins, maltodextrin.
[0083] "Foods for special medical purposes (FSMP)" are foods specially processed and formulated to meet the special needs of nutrients or diets for people with limited intake, impaired digestion and absorption, metabolic disorders or specific disease states. They include: total nutrient formula foods (such as liquid diets for people with dysphagia), specific total nutrient formula foods (such as special formulas for diabetes, special formulas for liver diseases), non-total nutrient formula foods (such as electrolyte formulas, amino acid component formulas).
[0084] For example, the bacterial suspension suitable for gavage administration can be obtained by culturing, centrifuging and resuspending with PBS, or can be prepared into a bacterial suspension by bacterial powder + PBS. The preparation method of the bacterial powder is known in the art. For example, the fermentation broth of Bifidobacterium animalis subsp. lactis Ca360 with the preservation number CGMCC No. 32403 is centrifuged, the bacterial cells are collected, a freeze-drying protectant is added to the obtained bacterial cells, and vacuum freeze-drying is carried out to obtain a freeze-dried powder. The present invention also provides the bacterial powder prepared by the above method.
[0085] In one or more embodiments, the product is a solid beverage, probiotic oil droplets, chewable tablets, dairy products, formulated milk powder, or infant milk powder. Among them, the solid beverage refers to a solid preparation with no more than 5 grams of moisture per 100 grams of the finished product, such as instant coffee, Tang drink mix, milk tea powder, etc., which is characterized by being easy to store and carry; probiotic oil droplets are a product for ingesting probiotics through oral administration, and the components of the oil drops can well protect the beneficial bacteria and allow them to survive and exert their effects in the digestive system; chewable tablets refer to solid candies mainly made of sugar or syrup (powder), etc., and are made through related processes such as mixing, granulation, and tableting; dairy products refer to various foods processed mainly from fresh cow (sheep) milk and its products; formulated milk powder is a product that adds various nutritional fortifiers (such as vitamins, minerals, probiotics, DHA, ARA, etc.) on the basis of milk powder, such as pregnant women's milk powder, middle-aged and elderly milk powder, and children's growth milk powder; infant milk powder is milk powder specially designed for infants to meet the nutritional needs of infant growth and development, and contains various nutritional components such as protein, fat, carbohydrates, vitamins, and minerals.
[0086] The dosage forms of the health products described herein include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions, or suspensions.
[0087] The dosage forms of the drugs described herein include, but are not limited to, powders, tablets, granules, capsules, solutions, emulsions, or suspensions. The drugs described herein also include pharmaceutically acceptable excipients.
[0088] The term "pharmaceutically acceptable excipients" refers to carriers and / or excipients that are pharmacologically and / or physiologically compatible with the subject and the active ingredient, which are well-known in the art (see, for example, Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and include, but are not limited to: pH regulators, surfactants, adjuvants, and ionic strength enhancers. For example, pH regulators include, but are not limited to, phosphate buffer solutions; surfactants include, but are not limited to, cationic, anionic, or non-ionic surfactants, such as Tween-80; ionic strength enhancers include, but are not limited to, sodium chloride.
[0089] Preferably, the excipients described herein do not affect the viability of the bacterial cells. For example: diluents / carriers (lactose, microcrystalline cellulose (MCC), starches and derivatives, mannitol, maltodextrin), protectants (lyoprotectants such as trehalose, sucrose, glucose, polyvinylpyrrolidone (PVP), dextran, sodium glutamate, glycine, antioxidants such as vitamin C, glutathione), binders and disintegrants (hydroxypropyl methylcellulose (HPMC), polyvinyl alcohol (PVA), crospovidone (PVPP), sodium carboxymethyl starch (CMS-Na)), coating materials (acrylic resins, hydroxypropyl methylcellulose phthalate, ethylcellulose), lubricants and glidants (magnesium stearate, colloidal silicon dioxide, talc), other functional excipients (pH regulators such as citric acid-sodium citrate buffer pair, osmotic pressure regulators such as sodium chloride, flavoring agents and fragrances such as steviol glycoside, sucralose, fruit essence). An exemplary excipient combination for freeze-dried probiotic powder is trehalose, maltodextrin and mannitol, which forms a high viable cell count preparation after lyophilization. Exemplary excipients for enteric-coated tablets include microcrystalline cellulose, crospovidone, and enteric coating materials.
[0090] Other aspects of the present invention will be apparent to those skilled in the art from the present disclosure. The present invention will be further illustrated below with reference to specific examples. It should be understood that these examples are merely illustrative and not intended to limit the scope of the present invention. The methods and reagents used in the examples are conventional methods and reagents in the art unless otherwise specified.
[0091] Examples
[0092] The examples will be described in detail below, and the examples are shown in the drawings. When the following description refers to the drawings, unless otherwise indicated, the same numbers in different drawings represent the same or similar elements. The implementation methods described in the following examples do not represent all implementation methods consistent with the present application. They are merely examples of systems and methods consistent with some aspects of the present application detailed in the claims.
[0093] In each of the examples of the present invention, the experimental data are expressed as Mean ± S.E.M, and the data are statistically analyzed using PRISM version 10.0 (GraphPad, San Diego, CA, USA). The differences between groups are statistically analyzed using the method of One-way ANOVA followed by Tukery’s multiple comparison test. A significant statistical difference is present when p < 0.05.
[0094] Example 1: Cultivation, identification and preservation of Bifidobacterium animalis subsp. lactis Ca360
[0095] The Bifidobacterium animalis subsp. lactis Ca360 of the present invention was isolated from the intestine of healthy children in Anyang, Henan Province.
[0096] 1.1. Strain isolation and culture
[0097] Collect feces from healthy children, dilute them by gradient dilution method to obtain a dilution solution. Take 100 μL of the dilution solution and spread it on an MRS medium plate containing 0.5% cysteine. After anaerobic culture at 37°C for 48h - 72h, according to the shape, size, color, etc. of the colonies, pick the colonies with different shapes onto a new MRS medium plate respectively for streak isolation and purification ( Figure 2 ), and obtain the isolated strain Ca360.
[0098] Among them, the medium used is ordinary MRS medium. Perform Gram staining and catalase test on the isolated strain, and then select potential strains according to the characteristics of Gram-positive staining ( Figure 1 ). Extract the DNA of the strain, use the universal primers 27F / 1492R for the 16s rRNA fragment of lactic acid bacteria, perform PCR amplification and then sequencing, and then perform homologous comparison with the gene sequence in the NCBI gene bank to obtain the Bifidobacterium animalis subsp. lactis Ca360. The 16S rRNA gene sequencing result is shown in SEQ ID NO:3.
[0099] 1.2 Strain preservation and activation
[0100] Prepare a bacterial solution of Bifidobacterium animalis subsp. lactis Ca360, add glycerol with a final concentration of 20% to the bacterial solution, mix well and place it in a -80°C refrigerator for storage. Melt it under ice bath conditions, and use a sterile inoculation loop to inoculate the bacterial solution into a pre-prepared MRS culture dish, and place it in an anaerobic incubator to grow for about 48 h until complete colonies grow on the culture dish ( Figure 2 ), then subculture can be carried out, and the strain growth curve is as Figure 3 shown.
[0101] 1.3 Strain preservation
[0102] The Bifidobacterium animalis subsp. lactis Ca360 was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on October 30, 2024. The taxonomic name is Bifidobacterium animalis subsp. lactis, the strain preservation number is BL-M40, and the deposit number is CGMCC No. 32403.
[0103] Example 2: Tolerance of Bifidobacterium animalis subsp. lactis Ca360 to artificial gastric juice, artificial intestinal juice and artificial bile salts
[0104] In this example, the acid resistance of Bifidobacterium animalis subsp. lactis Ca360 of the present invention to artificial gastric juice, artificial intestinal juice, and artificial bile salts was tested, and Lactiplantibacillus plantarum Lp299V with good tolerance and the ability to promote mineral absorption was used as a positive control strain.
[0105] The test method was as follows: The rejuvenated lactic acid bacteria strain was inoculated into MRS liquid medium. After culturing at 37 °C for 18 h, it was centrifuged at 4 °C and 2500 rpm for 10 min to collect the bacterial cells.
[0106] The test strains were incubated in artificial gastric juice with different pH values (SGJ pH 1.5, pH 2.5, pH 3.5) for 3 h, in artificial intestinal juice (pH 6.8) for 4 h, and in artificial bile salts with different concentrations (0.1%, 0.3%, and 1%) for 24 h, and then viable plate counting was performed to evaluate the acid and intestinal juice resistance of the strains. Survival rate = (number of viable bacteria after treatment / number of viable bacteria at 0 h) × 100%.
[0107] The survival rate of the strain in artificial gastric juice was as Figure 5 (A) shown. The survival rate of Bifidobacterium animalis subsp. lactis Ca360 after being treated in artificial gastric juice (pH 2.5) for 3 h was 69.4%, and the survival rate after being treated in artificial gastric juice (pH 3.5) for 3 h was 93.6%, with no significant difference from the positive strain (Lp299V) (p > 0.05) ( Figure 5 (A)). This indicates that Bifidobacterium animalis subsp. lactis Ca360 of the present invention has excellent gastric acid resistance and can pass through the stomach to reach the gastrointestinal tract more smoothly.
[0108] The survival rate of the strain in artificial intestinal juice was as Figure 5 (B) shown. The survival rate of Bifidobacterium animalis subsp. lactis Ca360 after being treated in artificial intestinal juice (pH 6.8) for 4 h was 61.2%, with no significant difference from the positive strain (Lp299V) (p > 0.05) ( Figure 5 (B)). The survival rate of the strain in artificial bile juice was as Figure 5 (C) shown. The survival rate of Bifidobacterium animalis subsp. lactis Ca360 after co-culturing with 0.3% artificial bile salts for 24 h was 66.3%, and the survival rate after co-culturing with 1% artificial bile salts for 24 h was 23.3%, with no significant difference from the positive strain (Lp299V) (p > 0.05). This indicates that Bifidobacterium animalis subsp. lactis Ca360 of the present invention has the ability to resist intestinal juice and bile salts and can survive and colonize in the intestine.
[0109] Example 3: Strain safety assessment of Bifidobacterium animalis subsp. lactis Ca360
[0110] The MIC value of Bifidobacterium animalis subsp. lactis Ca360, i.e., the results of the sensitivity test, is shown in Table 1.
[0111] 3.1. Hemolytic assay
[0112] The rejuvenated strain of Bifidobacterium animalis subsp. lactis Ca360 was inoculated onto a blood agar plate and cultured in an incubator at 37 °C for 36 h. The presence of hemolysis was observed. As Figure 4 shown, Bifidobacterium animalis subsp. lactis Ca360 showed no hemolysis on the hemolytic agar plate, i.e., hemolysis negative. This indicates that the target strain is a non-pathogenic bacterium and has a high level of safety.
[0113] 3.2. MIC assay
[0114] The drug resistance of the strain was determined according to the method of antimicrobial susceptibility in EFSA 5206-2018 "Guidelines on the Microbiological Characteristics of Feed Additives or Microorganisms Used in the Production of Fermented Products". The results showed that Bifidobacterium animalis subsp. lactis Ca360 was sensitive to ampicillin, vancomycin, gentamicin, streptomycin, erythromycin, clindamycin, tetracycline, and chloramphenicol (Table 1).
[0115] Table 1 MIC value of Bifidobacterium animalis subsp. lactis Ca360 and the results of the sensitivity test Antibacterial agents Critical value (mg / L) MIC value (mg / L) Drug sensitivity Ampicillin 2 0.064 Sensitive Vancomycin 2 0.25 Sensitive Gentamicin 64 64 Sensitive Streptomycin 128 16 Sensitive Erythromycin 1 0.064 Sensitive Clindamycin 1 ≤0.032 Sensitive Tetracycline 8 8 Sensitive Chloramphenicol 4 1 Sensitive
[0116] Note: 1. MIC: Minimum inhibitory concentration
[0117] Example 4: In vitro simulation of human intestinal fermentation: Simulating the in vivo fermentation of probiotics
[0118] A simulated intestinal flora medium was used, and the medium was prepared according to the following medium formula table (Table 2). After heating and stirring until the medium was dissolved, the medium was dispensed into vials, filled with gas, and the upper lid was closed. It was placed in an autoclave for sterilization. For the rejuvenated bacterial solution, a sterile 1 mL syringe was used to inoculate 2-3% of the bacterial solution into the vial. After gently shaking and mixing, it was placed in a constant temperature incubator at 37 °C for 24 hours. After the incubation, samples were taken to detect the pH and SCFA.
[0119] Table 2. Formula of the simulated intestinal medium (1L) Ingredient Content Tryptone 10g Yeast extract 2.5g L-Cysteine 1g Hemin 2ml Sodium chloride 0.9g <![CDATA[CaCl2·6H2O]]> 0.009g <![CDATA[KH2PO4]]> 0.45g <![CDATA[K2HPO4]]> 0.45g <![CDATA[MgSO4·7H2O]]> 0.09g Vitamin I 200 μl Resazurin (1 mg / ml) 1ml Starch 8g
[0120] Note: In Table 1, before heating, 5 mg / ml of hemin was added to 1M NaOH for resazurin, and 100 μl of vitamin II solution / 1L PBS was added. The formulas of vitamin I solution in Table 1 and vitamin II solution added to resazurin are shown in Table 3 and Table 4, respectively.
[0121] Table 3. Formulation of Vitamin I Solution (40 mL, stored at -30°C) Ingredient Content Biotin (VH) 2 mg <![CDATA[Cobalamin (VB 12 )]]> 2 mg p-Aminobenzoic acid 6 mg Folic acid 10 mg <![CDATA[Pyridoxamine (VB6)]]> 30 mg
[0122] Table 4. Formulation of Vitamin II Solution (1 mL, stored at -30°C) Ingredient Content <![CDATA[Thiamine (VB1)]]> 5 mg <![CDATA[Riboflavin (VB2)]]> 5 mg
[0123] The pH value of the sample was detected using a handheld pH meter. Before measurement, the electrode was washed 3 times with UP water. After drying the residual moisture with experimental paper, the electrode was placed into the sample solution, and the reading was recorded after it stabilized.
[0124] The short-chain fatty acids in the fermented broth samples were quantitatively evaluated using the external standard calibration method of gas chromatography. Briefly, 500 μL of the fermented broth to be measured was added with 100 μL of crotonic acid at 15.0168 μmol / mL. After mixing, it was centrifuged at 16000 rpm for 5 minutes, and the supernatant was collected and filtered into a sampling bottle equipped with a water system filter membrane. 0.5 μL of the supernatant was measured using a gas chromatography system equipped with a DB-FFAP chromatographic column. The chromatographic conditions were as follows: the column temperature was raised to 180°C at a rate of 20°C per minute for 1 minute, and then raised to 220°C at a rate of 50°C per minute for 1 minute; the split ratio was 10:1, and the flow rate was 2.8 mL / min per minute.
[0125] To detect the phytase activity of the strain, 100 μL of the bacterial solution of the strain to be measured after subculture was added to 10 mL of MRS medium and incubated at 37°C and 200 rpm for 24 h. The culture solution was quickly frozen and thawed three times and then centrifuged at 4°C and 8,000 rpm for 10 min. The supernatant was taken, and the phytase activity was detected and analyzed using a phytase assay kit (Beijing Boxbio Science & Technology Co., Ltd.).
[0126] An in vitro simulated human intestinal fermentation model was used, as Figure 6 shown, Bifidobacterium animalis subsp. lactis Ca360 could ferment to produce substances such as acetic acid, propionic acid, and butyric acid, which were significantly higher than those of the positive strain Lp299V (p<0.0001).
[0127] Example 5: Promote the absorption and transport of minerals by cells
[0128] The human colon cancer cell line Caco-2 was purchased from Wuhan Pure Science Life Technology Co., Ltd. The cell line was cultured in DMEM (Servicebio, G4511), which is a modified version of Dulbecco Eagle medium, enriched with 10% fetal bovine serum (FBS, Gibco, 10,270,106) and supplemented with 1% penicillin-streptomycin (Beyotime, C0222). The cell line was used between passages 10 and 25. The medium was changed every two days after cell confluence.
[0129] 1. Cytotoxicity assay
[0130] The cytotoxicity of the test strains was evaluated on the Caco-2 cell line. The test strains were incubated in the medium for 24 h and washed in HBSS buffer, and then the strain density was adjusted to 10 7 CFU / mL in DMEM medium. The cells were grown in a 96-well tissue culture plate for 7 days until confluence, washed twice in PBS buffer, and then 300 μL of different bacterial suspensions were added to the cell monolayer. PBS buffer was used as a negative control. After incubation at 37 °C and 5% CO2 for 24 h, 50 μL of cell supernatant was taken, and the lactate dehydrogenase (LDH) activity was measured using an LDH-based in vitro toxicology assay kit (Sigma-Aldrich, St. Louis, USA). The results were expressed as a percentage of the LDH activity of the negative cells.
[0131] 2. Ca, Fe, Zn absorption and transport cell experiments
[0132] Cells were seeded at 50,000 cells / well on a transwell permeable support (0.4 µm, polyester membrane) in a 12-well tissue culture plate and incubated in a CO2 incubator at 37 °C with 95% O2 and 5% CO2 for 15 - 20 days. The transepithelial electrical resistance (TEER) value of the Caco-2 monolayer was measured using a voltmeter ohmmeter MilliCell resistance system (Merck Millipore, Burlington, USA). The TEER value was calculated according to the following equation: TEER (Ω⋅cm^2) = (R_t - R_0) × S. A monolayer was considered formed when the TEER value was greater than 600. The transport efficiency of calcium was determined with some modifications according to the method of Raveschot C et al. The bacterial suspension was prepared as described in Section 2.5. The Caco-2 cell monolayer was washed twice with HBSS, and then 500 μL of the bacterial suspension (DMEM medium as a control), CaCl2 (250 mM), Zn2SO4 (50 uM), and FeSO4 (50 μM) were added to the upper chamber (apical side) of the cells. Then, after incubation at 37 °C and 5% CO2 for 24 h, the medium in the lower chamber was collected, and the calcium content was measured by inductively coupled plasma optical emission spectrometry (iCAP7400, Thermo Fisher Scientific, USA). The Caco-2 monolayer cells were washed with HBSS, washed and collected with ice-cold buffer, and then the intracellular fluid was collected by rapid freeze-thaw method. The collected intracellular fluid was also measured for calcium uptake by inductively coupled plasma optical emission spectrometry.
[0133] Caco-2 cells were used to study the absorption and transport of minerals by the strains. As Figure 7 shown, neither the strain (Lp299V) nor the added minerals (CaCl2, FeSO4, ZnSO4) were toxic to the cells. Both strains, Lp299V and Ca360, could significantly promote the absorption and transport of Ca 2+ , Fe 2+ and Zn 2+ (p < 0.05), and the transport rate of Ca 2+ promoted by Ca360 was significantly higher than that by Lp299V. This indicates that Bifidobacterium animalis subsp. lactis Ca360 has a significant function in promoting mineral absorption and transport, and it is most effective in promoting the absorption and transport of Ca 2+ (p < 0.0001).
[0134] Example 6: Study on the intervention effect of probiotics on an ovariectomized osteoporosis mouse model
[0135] Ovariectomy method: After hair removal, the skin was disinfected with 10% povidone iodine, and the mice were anesthetized and subjected to aseptic surgery. At the intersection of the bilateral femurs and the horizontal line of the spine, the bilateral ovarian tissues were found and excised.
[0136] Fifty 4-week-old female C57BL / 6J mice were maintained at a temperature range of 23 - 25 °C with a humidity of 40 - 60% and subjected to a consistent 12-hour light / dark cycle. After 1 week of acclimation feeding, the mice were randomly grouped according to body weight. Thirty of the mice were subjected to ovariectomy (OVX), 10 mice were assigned to the sham operation group (Sham group) (sutured immediately after skin incision), and the remaining 10 mice were assigned to the normal control group (Control group). After 1 week of recovery, the ovariectomized mice were randomly divided into the following 3 groups: (1) model control group (OVX group, n = 10), (2) OVX + Lactobacillus plantarum Lp299V (Lp299v group, n = 10), (3) OVX + Bifidobacterium animalis subsp. lactis Ca360 (Ca360 group). After grouping, the test substances were administered by gavage once a day. In the probiotic groups, namely the Lp299v group and the Ca360 group, the corresponding probiotics were administered by gavage at a dose of 1×10 9 cfu / d / animal. The sham operation group (Sham group), the model control group (OVX group), and the normal control group (Control group) were all gavaged with the corresponding PBS.
[0137] After 10 weeks of intervention, all the mice were sacrificed, and samples such as the uterus, femur, and tibia were collected, and osteoporosis-related indexes such as uterine coefficient, bone microstructure, bone structure model parameters, blood, colon, and feces were measured.
[0138] The changes in the body weights of the animals before and after the intervention are shown in Figure 8 A. After successful model establishment, the body weight of the sham operation group (Sham group) was significantly lower than that of the other ovariectomized groups, which was consistent with that of the normal control group. This is consistent with the significant increase in body weight of postmenopausal women. There was no significant difference between the ovariectomized model group and the intervention groups.
[0139] The uterine coefficient of mice is an important index for evaluating estrogen-like effects or drug effects, and its calculation method is the ratio of uterine wet weight to body weight multiplied by 100% (i.e., uterine coefficient = uterine mass / mouse body weight × 100%). The experimental results showed ( Figure 8B), the uterine coefficients of the ovariectomized model group (OVX) were significantly lower than those of the sham operation group (Sham group) and the normal control group (Control group) (p < 0.0001), indicating that after ovariectomy, with the decrease of estrogen in the body, the uterus shrank significantly. After probiotic intervention, there was no difference in the uterine coefficient between the Lp299v group and the OVX group, while the uterine index of the Ca360 group was significantly higher than that of the OVX group (p < 0.001), indicating that Bifidobacterium animalis subsp. lactis Ca360 could significantly improve the uterine atrophy caused by ovariectomy.
[0140] Results of hematological indexes related to osteoporosis showed that ( Figure 9 ), after ovariectomy, the levels of tartrate-resistant acid phosphatase (TRACP-5b) and parathyroid hormone (PTH) in the OVX group were significantly higher than those in the Control group (p < 0.001) and the Sham group (p < 0.0001), while the levels of VD3 (1,25-(OH)2D3) and serum phosphorus were significantly lower than those in the Control group and the Sham group. This indicates that the sudden drop of estrogen after ovariectomy triggers a high turnover state of bone metabolism, manifested as enhanced bone resorption (TRACP-5b↑) and compensatory increase in PTH secretion. PTH maintains calcium homeostasis in the blood and reduces blood phosphorus by regulating bone calcium release and renal phosphorus excretion. The decrease in VD3 exacerbates the imbalance of calcium and phosphorus metabolism, but the compensatory effect of PTH keeps the blood calcium level from fluctuating significantly.
[0141] After probiotic intervention, the levels of TRACP-5b and PTH in both the Lp299v group and the Ca360 group decreased significantly, and the level of 1,25-(OH)2D3 increased significantly. Moreover, the ability of the Ca360 group to reduce the level of TRACP-5b was significantly better than that of the Lp299v group. This indicates that Bifidobacterium animalis subsp. lactis Ca360 can significantly improve the bone destruction caused by ovariectomy (estrogen deficiency) and promote the balance of calcium and phosphorus metabolism.
[0142] Results of Micro-CT bone tissue analysis showed that ( Figure 10 ), in the OVX group, the trabecular bone was arranged sparsely, the boundary cavities were obvious, and the bone microstructure was damaged, manifested as significant decreases in bone mineral density (BMD), bone volume fraction (BV / TV), bone surface area to tissue volume ratio (BS / TV), and trabecular bone number (Tb.N), and a significant increase in trabecular separation (Tb.Sp). These characteristics are typical manifestations of bone mass loss caused by estrogen deficiency.
[0143] The therapeutic effect on osteoporosis is generally verified by the increase in bone density and the improvement of trabecular bone parameters. In the Ca360 intervention group, the BMD, BS / TV, and Tb.N increased significantly, and the trabecular separation (Tb.Sp) decreased significantly, and there was no significant difference from the Sham group and the normal control group. This indicates that Bifidobacterium animalis subsp. lactis Ca360 can significantly improve the osteoporosis caused by ovariectomy.
[0144] Example 7: Detection of Fecal Metabolites in an Ovariectomized Osteoporosis Mouse Model by Probiotics
[0145] The short-chain fatty acids in mouse samples were quantitatively evaluated using an external standard calibration method with gas chromatography. Briefly, 500 μL of a suspension of feces to be measured and PBS (1:9) was added to 100 μL of crotonic acid at 15.0168 μmol / mL. After mixing, the mixture was centrifuged at 16000 rpm for 5 minutes, and the supernatant was collected and filtered into a sampling bottle equipped with a water system filter membrane. 0.5 μL of the supernatant was measured using a gas chromatography system equipped with a DB-FFAP chromatographic column. The chromatographic conditions were as follows: The column temperature was raised to 180°C at a rate of 20°C per minute for 1 minute, and then raised to 220°C at a rate of 50°C per minute for another 1 minute; the split ratio was 10:1, and the flow rate was 2.8 mL / min per minute.
[0146] The data results are as Figure 11 shown as follows:
[0147] Total short-chain fatty acids: The acetic acid content in the feces of mice in the OVX group was significantly lower than that in the Sham group and the Control group (p<0.0001). Compared with the OVX group, the acetic acid content in the feces of mice in the probiotic Lp299v and Ca360 groups was significantly higher than that in the OVX group (p<0.0001 and p<0.0001), and the acetic acid content in the Ca360 group was significantly higher than that in the normal control group (p<0.05).
[0148] Acetic acid: The acetic acid content in the feces of mice in the OVX group was significantly lower than that in the Sham group and the Control group. Compared with the OVX group, the acetic acid content in the feces of mice in the probiotic Lp299v and Ca360 groups was significantly higher than that in the OVX group (p<0.001 and p<0.0001), and the acetic acid content in the Ca360 group was significantly higher than that in the normal control group (p<0.05).
[0149] Propionic acid: The acetic acid content in the feces of mice in the OVX group was significantly lower than that in the Sham group and the Control group (p<0.0001). Compared with the OVX group, the propionic acid amount in the feces of mice in the probiotic Lp299v group and Ca360 group was significantly higher than that in the OVX group (p<0.01 and p<0.001),
[0150] Butyric acid: The butyric acid content in the feces of mice in the OVX group was lower than that in the Sham group and the Control group (p<0.05). Compared with the OVX group, the butyric acid content in the feces of mice in the probiotic Lp299v group and Ca360 group was significantly higher than that in the OVX group (p<0.01 and p<0.001).
[0151] Example 8: Iron Deficiency Anemia (IDA) Mouse Model and Probiotic Intervention
[0152] Method for constructing an iron deficiency anemia (IDA) mouse model: After the mice were acclimated for one week, they were randomly grouped using SPSS and divided into the following groups: normal control group, model group, positive control group, Lp299v group, and Ca360 group. During the experiment: Normal control group (Control group): Fed a low-iron diet and gavaged with 3 mg / kg bw of FeSO4; Model group (IDA group): Fed an iron-deficient diet and gavaged with 200 μL of normal saline; Positive strain control group (Lp299v group): Fed an iron-deficient diet and gavaged with 200 μL of Lactiplantibacillus plantarum Lp299v at a dose of 1×10 9 cfu / mL) and FeSO4 (3 mg / kg bw); Probiotic Ca360 group: Fed an iron-deficient diet and gavaged with 200 μL of Bifidobacterium animalis subsp. animalis Ca360 (1×10 9 cfu / mL) and FeSO4 (3 mg / kg bw). During the experiment, blood was collected from the tail vein of the mice at a fixed time every week for biochemical detection. After 4 weeks, when the hemoglobin (HGB) in the model group was <90 g / L, the model was considered successfully established, and the experiment could be stopped to collect blood and other samples for detection. A fully automated blood biochemical analyzer was used to analyze blood routine indicators.
[0153] The results of the blood routine showed ( Figure 12 ) that the hemoglobin (HGB), hematocrit (HCT), and mean corpuscular volume (MCV) of the mice in the IDA group were significantly lower than those in the NC group, indicating that the IDA model successfully induced typical anemia characteristics. After treatment with Ca360, the HGB, HCT, and MCV of the mice were significantly increased. Treatment with Ca360 significantly increased the ferritin level (Ferritin) and significantly decreased the total iron binding capacity (TIBC) of the serum, suggesting that these treatments may improve iron metabolism by increasing iron reserves and reducing the demand for iron transport. It shows that Bifidobacterium animalis subsp. animalis Ca360 can significantly improve iron deficiency anemia.
[0154] Example 9: Zinc Deficiency Mouse Model and Probiotic Intervention
[0155] Modeling and Intervention
[0156] Method for constructing zinc-deficient mouse model: After one week of adaptation, mice were randomly grouped using SPSS and divided into the following groups: normal control group, model group, and intervention groups (including zinc gluconate group, zinc sulfate group, and Ca360 group), with 10 mice in each group. During the experiment: Normal control group (Control group): Standard diet + 200 μL normal saline; Zinc-deficient model group (model group): Low-zinc diet + intragastric administration of 200 μL normal saline; Zinc sulfate group (ZnSO4 group): Low-zinc diet + ZnSO4; Zinc gluconate group: Low-zinc diet + zinc gluconate; Ca360 group: Low-zinc diet, intragastric administration of 200 μL of Bifidobacterium animalis subsp. lactis Ca360 (1×10 9 cfu / mL) and ZnSO4. The dose of Zn in the zinc sulfate group, zinc gluconate group, and Ca360 group was 5.22 mg Zn / kg / d. On the 21st day, the mice were euthanized, and blood and colon tissues were collected. The colon tissues were processed for histopathological analysis (fixed with 10% paraformaldehyde), and the sera were subjected to biochemical tests.
[0157] The zinc content of the standard diet was 6.96 mg / kg.bw Zn, and the zinc content of the low-zinc diet was 1.74 mg / kg.bwZn.
[0158] ELISA detection
[0159] Commercial ELISA kits AKBL007M, AKNM005M, AKAO001M, and AKPR014M (Boxbio, China) were used to detect the serum zinc (Zn) content, nitric oxide (NO) level, superoxide dismutase (SOD) activity, and glutathione peroxidase (GPx) activity of mice in each group according to the kit instructions.
[0160] HE staining
[0161] Paraffin sections were dewaxed to water treatment, placed in environment-friendly dewaxing solutions Ⅰ and Ⅱ for 20 minutes each, absolute ethanol Ⅰ and Ⅱ for 5 minutes each, 75% alcohol for 5 minutes, and then rinsed with tap water; Frozen sections were taken out from the -20°C refrigerator and restored to room temperature, fixed with tissue fixative for 15 minutes, and rinsed with running water. Then, the sections were placed in a high-definition constant staining pretreatment solution for 1 minute; Stained with hematoxylin solution for 3 - 5 minutes, rinsed with tap water, differentiated with differentiation solution, rinsed again, blued with bluing solution, and finally rinsed thoroughly with running water. Subsequently, the sections were dehydrated with 95% alcohol for 1 minute and then stained with eosin solution for 15 seconds. After staining, they were successively dehydrated with absolute ethanol Ⅰ, Ⅱ, Ⅲ for 2 minutes each, n-butanol Ⅰ, Ⅱ for 2 minutes each, and xylene Ⅰ, Ⅱ for 2 minutes each for transparency treatment, and finally sealed with neutral balsam. Finally, microscopic examination was carried out under a microscope, and images were collected for analysis.
[0162] Result analysis
[0163] The ELISA test results showed that ( Figure 13 ), the serum Zn content of the mice in the model group was significantly lower than that in the Control group, indicating that the low-zinc mouse model was successfully established. The serum zinc content (Serum Zn) in the intervention group was significantly higher than that in the model group and showed no significant difference from the Control group.
[0164] Studies have shown that zinc deficiency can significantly affect the activity of nitric oxide synthase, thereby affecting the production and metabolism of NO. In the zinc-deficient mouse model, the change in serum NO level was mainly manifested as an increase in NO content. The serum NO level of the mice in the model group increased significantly, while the serum NO level in the intervention group supplemented with the same dose of Zn decreased significantly.
[0165] Zinc plays an important role in the antioxidant process. Zinc deficiency can lead to a decrease in the antioxidant capacity of mice, an increase in the level of lipid peroxidation, and a decrease in the activity of superoxide dismutase (SOD). In this experiment, the intake of Ca360 could also significantly increase the enzyme activities of SOD and glutathione peroxidase (GPx) in the serum of mice. This indicates that the intake of Ca360 can significantly improve the antioxidant level of zinc-deficient mice.
[0166] The HE staining results showed that ( Figure 14 ), obvious intestinal macrophage infiltration was observed in zinc-deficient mice compared with the normal control group, suggesting that their immune barrier was damaged and the inflammatory response was activated. The supplementation of zinc gluconate and zinc sulfate could partially relieve the inflammation, and the inflammatory area was mainly limited to the basal side. The treatment effect of the probiotic Ca360 was more significant, significantly reducing the infiltration of inflammatory cells. It may improve the intestinal microenvironment and promote zinc absorption by regulating the intestinal flora, enhancing the barrier function, and inhibiting the pro-inflammatory pathway.
[0167] Partial sequence SEQ ID NO:1 27F agagtttgatcctggctcag SEQ ID NO:2 1492R ggttaccttgttacgactt SEQ ID NO:3 16S rRNA gene sequencing
Claims
1. Bifidobacterium animalis subsp. lactis( Bifidobacterium animalis subsp. lactis ), which is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No. 32403.
2. Bifidobacterium animalis subsp. lactis( Bifidobacterium animalis subsp. lactis ), the nucleic acid sequence of its 16S rRNA gene is as shown in SEQ ID NO:
3.
3. The culture of Bifidobacterium animalis subsp. lactis according to claim 1 or 2.
4. The culture according to claim 3, wherein, The culture further contains a culture medium.
5. A microbial preparation, characterized in that, The microbial preparation is a microbial preparation with the culture, lysate or extract of Bifidobacterium animalis subsp. lactis according to claim 1 or 2 as the active ingredient.
6. The microbial preparation according to claim 5, characterized in that the microbial preparation further includes at least one excipient suitable for the microbial preparation, and / or the microbial preparation is in the form of powder, pill, capsule, granule, tablet, oil drop, liquid preparation or gel, and / or the microbial preparation is resistant to gastric acid, intestinal juice and / or bile salts.
7. A pharmaceutical composition comprising (1) a pharmaceutically acceptable excipient, and (2) Bifidobacterium animalis subsp. lactis according to claim 1 or 2, the culture according to claim 3 or 4, and / or the preparation according to claim 6.
8. A product comprising Bifidobacterium animalis subsp. lactis according to claim 1 or 2, the culture according to claim 3 or 4, and / or the preparation according to claim 6.
9. The product according to claim 8, wherein The product is a food or a health product.
10. The product according to claim 9, characterized in that the types of the food include: plant-based food, animal-based food, microbial fermented food, processed food, food additive, and / or the dosage forms of the health product include powder, tablet, granule, capsule, solution, emulsion, suspension.
11. The product according to claim 9, wherein the food further includes excipients.
12. The product according to claim 11, wherein, The excipients include additives and / or nutrient fortifiers.
13. The product according to claim 12, characterized in that the additives include one or more selected from the following: flavoring, stabilizer, thickener, preservative, antioxidant, emulsifier, and / or the nutrient fortifiers include one or more selected from the following: vitamin, mineral, amino acid, fatty acid, dietary fiber.
14. The product according to claim 9, wherein the food includes one or more selected from the following: dairy product, soy product, probiotic powder, probiotic oil drop, dietary fiber supplement, nutrition bar, rice flour, fruit puree, fruit and vegetable juice, food solid beverage, fruit juice, ice cream, candy, biscuit, infant milk powder, food for special medical purposes.
15. Use of Bifidobacterium animalis subsp. lactis according to claim 1 or 2, the culture according to claim 3 or 4, and / or the preparation according to claim 6 or 7, said use comprising: (a) Use in the preparation of a drug for increasing the content of short-chain fatty acids in the intestine; (b) Use in the preparation of a drug for improving uterine atrophy or its symptoms; (c) Use in the preparation of a drug for promoting mineral absorption and transport; (d) Use in the preparation of a drug for improving osteoporosis or its symptoms; (e) Use in the preparation of a drug for improving iron deficiency anemia or its symptoms; (f) Use in the preparation of a microbial preparation resistant to gastric acid, intestinal juice and / or bile salts; or (g) Use in the preparation of a drug for improving zinc deficiency or its symptoms.
16. The use according to claim 15, characterized in that The short-chain fatty acid is total short-chain fatty acid, and / or the short-chain fatty acid comprises one or more selected from the following: acetic acid, propionic acid, and butyric acid, and / or the uterine atrophy or its symptoms are caused by estrogen deficiency, and / or the mineral is a divalent metal element, and / or the symptoms of osteoporosis include decreased bone mineral density, decreased bone volume fraction, decreased bone surface area to tissue volume ratio, or decreased trabecular bone number, and / or the osteoporosis or its symptoms are caused by estrogen deficiency, and / or the mineral absorption and transport are the absorption and transport of minerals by cells, and / or the symptoms of iron deficiency anemia include low ferritin level, or high serum total iron binding capacity, and / or the symptoms of zinc deficiency include low serum zinc level, high inflammation level.
17. The application according to claim 16, characterized in that, The mineral comprises one or more selected from the following: calcium, iron, and zinc.
18. Use of Bifidobacterium animalis subsp. lactis according to claim 1 or 2, the culture according to claim 3 or 4, the preparation according to claim 6 or 7, and / or the product according to any one of claims 8 - 14, said use comprising: (a) Use for non-therapeutic purposes of increasing the content of short-chain fatty acids in the intestine; (b) Use for non-therapeutic purposes of improving the uterine health status; (c) Use for non-therapeutic purposes of promoting mineral absorption and transport; (d) Use for non-therapeutic purposes of improving the bone health status; (e) Use for non-therapeutic purposes of improving iron metabolism; or (f) Use for non-therapeutic purposes of improving zinc deficiency.
19. The use according to claim 18, wherein the short-chain fatty acid is total short-chain fatty acid, and / or the short-chain fatty acid comprises one or more selected from the following: acetic acid, propionic acid, and butyric acid, and / or the mineral is a divalent metal element, and / or the mineral absorption and transport are the absorption and transport of minerals by cells.
20. The application according to claim 19, wherein, The mineral comprises one or more selected from the following: calcium, iron, and zinc.
Citation Information
Patent Citations
Heat-resistant bifidobacterium animalis subsp.lactis separated from feces of baby
CN110577919A
Bifidobacterium lactis capable of preventing osteoporosis and application of bifidobacterium lactis capable of preventing osteoporosis
CN110964656A
Bifidobacterium lactis for preventing and treating osteoporosis and application thereof
CN111419882A
Bifidobacterium animalis subsp. Lactis with blood fat reducing effect and application thereof
CN116376739A
Bifidobacterium animalis subsp. Lactis Bbm-19 and application thereof in regulating neurotransmitter
CN118755620A
Cited By
Organic animal bifidobacterium and application thereof in intestinal micro-ecological regulation products
CN121495806A
Application of phytobacterium plantarum Hi188 in promotion of bone health
CN121667389A
Preparation method and application of leavening agent and fermented milk thereof
CN121874016A