Eukaryotic protein for targeted degradation of HIF-1alpha protein as well as preparation method and application of eukaryotic protein
By targeting eukaryotic proteins that bind and degrade HIF-1α, the problem of poor effectiveness of existing inhibitors is solved, and effective degradation of HIF-1α protein is achieved, with significant therapeutic effects and simple operational procedures.
Patent Information
- Application Number
- CN202510548252.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-28
- Publication Date
- 2025-07-18
AI Technical Summary
Existing HIF-1α-targeting inhibitors such as small molecule inhibitors, RNA interference and antisense oligonucleotides are poor in the treatment of HIF-1α-related diseases and are low in safety, and cannot effectively reduce the protein level of HIF-1α in cells.
A eukaryotic protein targeting binding and degradation of HIF-1α is developed, and ubiquitination is used to modify HIF-1α protein to promote its degradation and reduce the protein level of HIF-1α in cells. The preparation method includes pcDNA3.1-HA-DTX3L-RD vector construction, HEK293 cell transfection and recombinant protein purification.
The specific binding and degradation of HIF-1α protein was achieved, the level of HIF-1α in cells was downregulated, and the effect of treating diseases such as tumors and rheumatoid arthritis was significant. The operation was simple and protein expression and purification were easier.
Smart Images

Figure CN120330157A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of pharmaceutical bioengineering, and specifically, to a eukaryotic protein that specifically targets, binds to, and degrades HIF-1α, and a preparation method and application thereof. Background Art
[0002] The abnormal activation of HIF-1α is closely related to a variety of diseases, such as tumors, sepsis, inflammatory bowel disease, rheumatoid arthritis, etc. Hypoxia is a common feature of solid tumors, and the increase in HIF-1α is closely related to poor prognosis and reduced survival rate. Hypoxia promotes angiogenesis and glycolysis by upregulating VEGF and IL-8, accelerating tumor growth. Under hypoxic conditions, the expression level of PD-L1 in cancer cells will increase with the increase in the expression level of HIF-1α, leading to an increase in the apoptosis of cytotoxic T cells (CTLs), further causing tumor immune escape. HIF-1α can increase the expression of the surface protein CD47 of tumor cells, induce anti-phagocytic signal transduction, and help tumors avoid phagocytosis by macrophages. In addition, HIF-1α can also promote the expression of A2A adenosine receptor (A2AR) on tumor-infiltrating immune cells. When adenosine binds to A2AR on T cells, it will rapidly induce apoptosis, causing immunosuppression. Studies have shown that HIF-1α can promote the secretion of chemokines and pro-inflammatory factors, exacerbating sepsis infection. The level of HIF-1α in Th17 cells of Crohn's patients is significantly higher than that of healthy people, and the use of HIF-1α inhibitors can significantly relieve the symptoms of the disease. The joints of patients with rheumatoid arthritis (RA) are usually in a hypoxic state, resulting in an increase in the expression of HIF-1α in the synovium. The increase in HIF-1α not only promotes the production of many pro-inflammatory mediators, but also promotes synovial inflammation, angiogenesis, cartilage destruction, and bone erosion, further aggravating the condition of RA. These studies indicate that HIF-1α can be used as an important diagnostic and therapeutic target for a variety of major and complex diseases, and inhibiting the protein level of HIF-1α may be beneficial to improving the condition of related diseases.
[0003] At present, the development of HIF-1α targeted therapy mostly focuses on small molecule inhibitors of HIF-1α. However, these small molecule inhibitors not only fail to achieve the expected efficacy, but some also show cytotoxicity to cells and tissues. For example, 2-methoxyestradiol can directly inhibit the expression of HIF-1α and HIF-2α, induce the down-regulation of HIF-1 expression in tumor cells, and then inhibit tumor growth and angiogenesis. However, clinical trial studies have shown that although 2-methoxyestradiol alone or in combination shows good safety, the anti-tumor efficacy in clinical trials is not yet ideal. EZN-2968 is an antisense oligonucleotide that can inhibit the mRNA level of HIF-1α, but phase I trials have shown that its anti-tumor effect is still limited. Therefore, it is urgent to develop HIF-1α-related protein inhibition schemes from other perspectives to effectively combat HIF-1α-mediated disease progression. Summary of the Invention
[0004] Aiming at the problems of poor efficacy and low safety of the above-mentioned targeted inhibitors, RNA interference, antisense oligonucleotides and decoy oligonucleotides in inhibiting HIF-1α, the present invention provides a eukaryotic protein that targets and degrades HIF-1α, its preparation method and application. By ubiquitinating HIF-1α, it promotes the targeted degradation of HIF-1α protein and reduces the protein level of HIF-1α in cells, so as to achieve the remission and treatment of diseases such as tumors and rheumatoid arthritis.
[0005] To achieve the above object, on the one hand, the present invention provides a eukaryotic protein that targets and degrades HIF-1α, which is derived from the 560-748th amino acids of the gene DTX3L (mouse source: Chromosome 16, NC_000082.7 (35746885..35759397,complement); human source: Chromosome 3, NC_000003.12 (122564338..122575203)), a total of 189 amino acids, covering the RING and CTD functional domains of the DTX3L protein.
[0006] The amino acid sequence (SEQ ID No.1) of the eukaryotic protein that targets and degrades HIF-1α is: AASKGTEDYCVICMDTISNKHVLPKCKHEFCTSCISKAMLIKPVCPVCLTSYGIQKGNQPEGTMSYSTQKGSLPGYEGCGTIVINYEIKDGIQTKEHPNPGKAYHGTRRTAYLPDNTEGRKVLDLLHEAFKHRLTFTIGYSRATGVSDVITWNDIHHKTSKFGGPANFGYPDPDYLKRVKEELKAKGIE; The base sequence (SEQ ID No.2) corresponding to the above-mentioned eukaryotic protein that targets and degrades HIF-1α is as follows: GCAGCTTCGAAGGGGACTGAGGACTACTGTGTCATCTGCATGGATACCATCAGCAACAAGCACGTGCTCCCCAAGTGCAAGCATGAATTCTGCACCTCGTGTATCAGCAAAGCCATGCTTATCAAGCCTGTCTGTCCTGTGTGTCTGACTTCCTACGGCATCCAGAAAGGGAACCAGCCAGAGGGAACCATGTCTTACTCCACTCAAAAAGGGTCACTTCCAGGTTATGAAGGCTGTGGCACCATTGTGATTAATTATGAAATAAAAGATGGCATCCAAACAAAAGAGCACCCAAACCCAGGAAAGGCTTATCATGGAACACGGCGAACTGCATACTTGCCTGATAATACTGAGGGAAGAAAGGTTTTGGATCTGCTCCACGAAGCCTTTAAGCACAGACTGACTTTCACAATAGGATACTCTCGAGCAACAGGAGTCTCGGATGTCATTACATGGAATGATATTCATCACAAAACATCCAAGTTTGGAGGACCAGCAAATTTTGGCTACCCTGATCCTGATTACCTGAAACGTGTCAAGGAGGAGCTGAAAGCAAAAGGCATTGAG。
[0007] The second aspect of the present invention provides the use of the above-mentioned eukaryotic protein in the preparation of a drug for treating HIF-1α-related diseases.
[0008] The eukaryotic protein promotes the targeted degradation of HIF-1α protein by ubiquitinating HIF-1α, reduces the protein level of HIF-1α in cells, thereby achieving the remission and treatment of diseases.
[0009] The HIF-1α-related diseases are tumors, rheumatoid arthritis or inflammatory bowel disease.
[0010] The third aspect of the present invention provides a method for preparing the eukaryotic protein that targets and binds to and degrades HIF-1α, which includes: (1) Construction of the pcDNA3.1-HA-DTX3L-RD vector Using the pcDNA3.1-HA-DTX3L vector as a template, the 1678-2245th bases of DTX3L are amplified with a high-fidelity PCR enzyme, that is, the base sequence corresponding to its 560-748th amino acids, and BamH I and EcoR I restriction enzyme sites are introduced at both ends of the sequence to obtain a PCR product; The above PCR product and the pcDNA3.1-HA vector are digested with the restriction enzymes BamH I and EcoR I. After 1% agarose gel electrophoresis, a gel extraction kit is used for extraction to obtain a PCR digestion product and a linearized vector; The above PCR digestion product and the linearized vector are ligated using T4 DNA ligase and reacted overnight at 16°C; The ligation product is transformed into E. coli Dh5α competent cells and then spread on an LB solid medium containing 50 μg / ml ampicillin and cultured overnight at a temperature of 37°C; Single colonies are picked, cultured overnight in an LB liquid medium, and then subjected to first-generation sequencing and plasmid extraction using a plasmid extraction kit to obtain a positive plasmid: pcDNA3.1-HA-DTX3L-RD; (2) Transfection and expression of HEK293 cells After transfecting HEK293 cells with the pcDNA3.1-HA-DTX3L-RD plasmid using a liposome transfection reagent for 48 hours, neomycin is added for resistance screening to construct a stable HEK293 cell line expressing the HA-DTX3L-RD gene; (3) Isolation and purification of the HA-DTX3L-RD recombinant protein The above stable HEK293 cell line is expanded in culture, and then the cells are collected and lysed to obtain total protein. The protein extraction solution is filtered through a 0.45 μm filter, and an anti-HA magnetic bead is used to purify the recombinant protein with an HA tag.
[0011] The method for preparing the eukaryotic protein that targets and binds to and degrades HIF-1α further includes: after subjecting the eukaryotic protein that targets and binds to and degrades HIF-1α to SDS-PAGE electrophoresis and membrane transfer, the eukaryotic protein that targets and binds to and degrades HIF-1α is identified by an HA monoclonal antibody.
[0012] Through the above technical solutions, the present invention achieves the following beneficial effects: 1. The full-length eukaryotic protein that specifically binds to and degrades HIF-1α provided by the present invention has 189 amino acids, and contains the RING domain and CTD domain of the DTX3L protein (collectively referred to as the RD domain). This protein can specifically bind to the HIF-1α protein, perform ubiquitination modification on it, promote the degradation of the HIF-1α protein, and down-regulate the level of HIF-1α in cells, overcoming the defects of poor efficacy of existing targeted inhibitors, RNA interference, antisense oligonucleotides, and decoy oligonucleotides, and has great application prospects in diseases such as rheumatoid arthritis and tumors.
[0013] 2. The RD domain of the protein is only 25KD in size. From the perspective of protein expression and purification, it is easier to express and purify than the full-length DTX3L, with simpler operation and higher expression level. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 is a schematic diagram of the construction principle of the positive plasmid pcDNA3.1-HA-DTX3L-RD in Example 1 of the present invention; Figure 2 is a schematic diagram of the results of identifying the eukaryotic protein that specifically binds to and degrades HIF-1α by Western blot using an anti-HA monoclonal antibody in Example 1 of the present invention; Figure 3 is a schematic diagram of the Co-IP results of the eukaryotic protein that specifically binds to and degrades HIF-1α binding to HIF-1α in Example 2 of the present invention; Figure 4 is a schematic diagram of the results of the eukaryotic protein that specifically binds to and degrades HIF-1α ubiquitinating intracellular HIF-1α in Example 3 of the present invention; Figure 5 is a schematic diagram of the Western blot results of the eukaryotic protein that specifically binds to and degrades HIF-1α degrading intracellular HIF-1α in Example 3 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0015] The following details the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only for the purpose of illustrating and explaining the present invention, and are not intended to limit the present invention.
[0016] Example 1 Construction of pcDNA3.1-HA-DTX3L-RD Plasmid and Purification of RD Recombinant Protein The amino acid sequence of the eukaryotic protein that specifically targets and binds to and degrades HIF-1α provided by the present invention is: AASKGTEDYCVICMDTISNKHVLPKCKHEFCTSCISKAMLIKPVCPVCLTSYGIQKGNQPEGTMSYSTQKGSLPGYEGCGTIVINYEIKDGIQTKEHPNPGKAYHGTRRTAYLPDNTEGRKVLDLLHEAFKHRLTFTIGYSRATGVSDVITWNDIHHKTSKFGGPANFGYPDPDYLKRVKEELKAKGIE; Its corresponding base sequence is: GCAGCTTCGAAGGGGACTGAGGACTACTGTGTCATCTGCATGGATACCATCAGCAACAAGCACGTGCTCCCCAAGTGCAAGCATGAATTCTGCACCTCGTGTATCAGCAAAGCCATGCTTATCAAGCCTGTCTGTCCTGTGTGTCTGACTTCCTACGGCATCCAGAAAGGGAACCAGCCAGAGGGAACCATGTCTTACTCCACTCAAAAAGGGTCACTTCCAGGTTATGAAGGCTGTGGCACCATTGTGATTAATTATGAAATAAAAGATGGCATCCAAACAAAAGAGCACCCAAACCCAGGAAAGGCTTATCATGGAACACGGCGAACTGCATACTTGCCTGATAATACTGAGGGAAGAAAGGTTTTGGATCTGCTCCACGAAGCCTTTAAGCACAGACTGACTTTCACAATAGGATACTCTCGAGCAACAGGAGTCTCGGATGTCATTACATGGAATGATATTCATCACAAAACATCCAAGTTTGGAGGACCAGCAAATTTTGGCTACCCTGATCCTGATTACCTGAAACGTGTCAAGGAGGAGCTGAAAGCAAAAGGCATTGAG。
[0017] A method for preparing a eukaryotic protein that targets and degrades HIF-1α, comprising: (1) Construction of the pcDNA3.1-HA-DTX3L-RD vector As Figure 1As shown, using the pcDNA3.1-HA-DTX3L vector as a template, the 1678-2245th bases of DTX3L were amplified with a high-fidelity PCR enzyme, that is, the base sequence corresponding to its 560-748th amino acids. BamH I and EcoR I restriction enzyme sites were introduced at both ends of the sequence to obtain a PCR product; The above PCR product and the pcDNA3.1-HA vector were digested with the restriction enzymes BamH I and EcoR I. After 1% agarose gel electrophoresis, a gel extraction kit was used for extraction to obtain a PCR digestion product and a linearized vector; The above PCR digestion product and the linearized vector were ligated using T4 DNA ligase and reacted at 16°C overnight; After the ligation product was transformed into E. coli Dh5α competent cells, it was spread on an LB solid medium containing 50 μg / ml ampicillin and cultured overnight at 37°C; Single colonies were picked, cultured overnight in LB liquid medium, and then extracted by first-generation sequencing and a plasmid extraction kit to obtain a positive plasmid pcDNA3.1-HA-DTX3L-RD; (2)Transfection and expression of HEK293 cells After transfecting HEK293 cells with the pcDNA3.1-HA-DTX3L-RD plasmid using a liposome transfection reagent for 48 hours, neomycin was added for resistance screening to construct a stable HEK293 cell line expressing the HA-DTX3L-RD gene; (3)Isolation and purification of HA-DTX3L-RD recombinant protein The above stable HEK293 cell line was expanded in culture, and then the cells were collected and lysed to obtain total protein. The protein extraction solution was filtered through a 0.45 μm filter, and Anti-HA Magnetic Beads were added and incubated overnight at 4°C. After washing three times, an elution buffer (2 mg / mL HA peptide, 50 mM Tris, 150 mM NaCl, pH 7.4) was added to elute the protein, and after further ultrafiltration and concentration, a eukaryotic protein RD that targets and degrades HIF-1α was obtained.
[0018] (4)Western blot identification of HA-DTX3L-RD recombinant protein After subjecting the above purified eukaryotic recombinant protein to SDS-PAGE electrophoresis and membrane transfer, it was incubated with an anti-HA monoclonal antibody for identification. The identification results are shown Figure 2 .
[0019] (5)Results: As Figure 2 shown, the purified protein has a high purity and the correct protein size.
[0020] Example 2 HA-DTX3L-RD recombinant protein can specifically target and bind to HIF-1α The recombinant eukaryotic protein HA-DTX3L-RD that targets, binds, and degrades HIF-1α is a C-terminal truncated protein of protein DTX3L. To verify whether the recombinant eukaryotic protein HA-DTX3L-RD can specifically target and recognize HIF-1α protein, we constructed a pcDNA3.1-Flag-HIF-1α plasmid. At the same time, the full-length sequence of DTX3L, the nucleotide sequences corresponding to the 1-215 and 214-560 amino acids at the N-terminus were inserted into the above pcDNA3.1-HA vector respectively. After co-transfecting these plasmids with pcDNA3.1-Flag-HIF-1α into 293 cells, Co-IP was used to detect whether there was an interaction with HIF-1α.
[0021] (1)Construction of pcDNA3.1-Flag-HIF-1α, pcDNA3.1-HA-DTX3L FL / D1-2 / D3 plasmids According to the method in step (1) of Example 1, the above fragments were respectively subjected to PCR, recovered by 1% agarose gel, ligated with the linearized vector, and sequenced after transformation and plating to obtain positive plasmids; (2)Verification of protein-protein interaction by Co-IP According to Figure 3 The combination was transfected into 293 cells. After 48 h of transfection, the cells were collected, lysed, and anti-Flag Magnetic Beads were added, incubated overnight at 4°C, washed three times, lysed with loading buffer, boiled at 95°C for 5-10 min, and the supernatant was taken after centrifugation for SDS-PAGE electrophoresis; (3)Results: As Figure 3 shown, the full-length DTX3L protein and DTX3L-RD can specifically target and bind to HIF-1α, while the first 1-560 amino acids of DTX3L cannot bind to HIF-1α, indicating that the RD domain can specifically recognize and bind to HIF-1α.
[0022] Example 3 HA-DTX3L-RD can specifically ubiquitinate and degrade HIF-1α (1)HA-DTX3L-RD can ubiquitinate HIF-1α According to Figure 4 shown, 293T cells were transfected. After 48 h of transfection, MG132 with a final concentration of 1 μM was added to the medium, and after culturing for 6 h, the protein was harvested and the ubiquitination level of HIF-1α was detected; (2)HA-DTX3L-RD can degrade HIF-1α According to Figure 5 Transfect 293T cells as shown, and collect proteins 48 hours after transfection to detect the protein level of HIF-1α; (3) Results: As Figure 4 shown, HA-DTX3L-RD can ubiquitinate and modify HIF-1α; as Figure 5 shown, HA-DTX3L-RD can significantly reduce the protein level of HIF-1α in cells.
[0023] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0024] In addition, it should be noted that, in the case of no conflict, the various specific technical features described in the above specific embodiments can be combined in any appropriate manner. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.
[0025] Furthermore, any combination can be made between different embodiments of the present invention, as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.
Claims
1. A eukaryotic protein that targets and binds to and degrades HIF-1α, characterized in that, It has the amino acid sequence shown in SEQ ID No.1, and the corresponding base sequence is shown in SEQ ID No.
2.
2. Use of the eukaryotic protein according to claim 1 in the preparation of a medicament for treating HIF-1α-related diseases.
3. The application according to claim 2, characterized in that, The eukaryotic protein promotes the targeted degradation of HIF-1α protein by ubiquitinating HIF-1α, reduces the protein level of HIF-1α in cells, thereby achieving the remission and treatment of diseases.
4. The application according to claim 2, characterized in that The HIF-1α-related diseases are tumors, rheumatoid arthritis or inflammatory bowel disease.
5. The method for preparing the eukaryotic protein according to claim 1, characterized in that, It includes the following steps: (1) Amplify the bases at positions 1678-2245 of DTX3L using the pcDNA3.1-HA-DTX3L vector as a template, then digest the amplification product and the pcDNA3.1-HA vector to obtain digested products and a linearized vector. Use a ligase to ligate the digested product and the linearized vector, and after culturing, obtain the positive plasmid pcDNA3.1-HA-DTX3L-RD; (2) Transfect the pcDNA3.1-HA-DTX3L-RD plasmid into HEK293 cells, add neomycin for resistance screening, and construct a stable HEK293 cell line expressing the HA-DTX3L-RD gene; (3) Expand the culture of the above-mentioned stable HEK293 cell line, and obtain a recombinant protein with an HA tag after purification.