DsRNA of targeted alpha amylase gene AMY and application of dsRNA in prevention and control of spider mites

Abstract

The invention discloses dsRNA of a targeted alpha-amylase gene alpha-AMY and application of the dsRNA in prevention and control of spider mites, and relates to the technical field of genetic engineering, and the dsRNA is technically characterized in that the nucleotide sequence of the dsRNA of the alpha-amylase gene AMY is as shown in SEQ ID NO: 1, and the dsRNA can be used for preventing and controlling spider mites or preparing products for preventing and controlling spider mites. The dsRNA of the alpha amylase gene AMY provided by the invention has a relatively high lethal effect on female adult spider mites, and can effectively control the population quantity of the spider mites and reduce the field harm of the spider mites. The compound can be applied to development of transgenic anti-mite plants or novel acaricides, can specifically resist specific types of mites without influencing other beneficial insects and organisms, and can also improve the anti-mite capability of the plants.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a dsRNA targeting the α - amylase gene AMY and its application in controlling spider mites. Background Art

[0002] Spider mites, commonly known as red spiders, are extremely tiny. Usually, they can only be identified after they gather into a web or have already caused damage to plants. There are mainly Tetranychus cinnabarinus, Tetranychus urticae, Tetranychus truncatus, etc. Spider mites have strong host adaptability and can harm hundreds of agricultural and economic crops such as vegetables, cotton, and fruit trees. Applying chemical pesticides is currently the main means of controlling agricultural spider mites. However, due to their short generation cycle, strong reproductive ability, parthenogenesis and other biological characteristics, combined with the unreasonable and unscientific use of chemical agents, the problem of their drug resistance is more prominent than that of other agricultural pests.

[0003] RNA interference (RNAi) is a conserved post - transcriptional specific gene silencing mechanism, mainly caused by the degradation of mRNA triggered by endogenous or exogenous double - stranded RNA (dsRNA), resulting in the phenomenon of specifically hindering the expression of target genes. RNAi has the advantages of high efficiency, specificity, pollution - free, and a large number of available target genes. It can be targeted at pests and spider mites for precise control and is also considered an ideal means to address the problem of drug resistance in pests and spider mites.

[0004] Spider mites have a high affinity for exogenous dsRNA, and dsRNA can be delivered to them by simple feeding or spraying, indicating that the development of nucleic acid pesticides targeting spider mite control based on RNAi technology has broad prospects. Currently, the research and development of spider mite nucleic acid pesticides progress slowly, and the core problem lies in the lack of effective target information.

[0005] Therefore, in view of the biological characteristics of spider mites' strong feeding and digestion ability on different host plants, the present invention discovers and proposes a dsRNA targeting the α - amylase gene AMY for the efficient control of spider mites and also provides ideal target information for the research and development of spider mite nucleic acid pesticides. Summary of the Invention

[0006] To solve the above - mentioned technical problems, the present invention provides a dsRNA targeting the α - amylase gene AMY and its application in controlling spider mites.

[0007] To achieve the above object, the technical solution of the present invention is as follows:

[0008] The present invention provides a dsRNA targeting the α - amylase gene AMY, and the nucleotide sequence of the dsRNA is as shown in SEQ ID NO: 1.

[0009] The present invention also provides a method for synthesizing dsRNA targeting the α-amylase gene AMY, comprising the following steps:

[0010] S11. Based on the nucleotide sequence of the α-amylase gene AMY, use software to design primer pair AMY-A2 containing the T7 promoter. The primer pair AMY-A2 includes upstream primer AMY-A2-F1 with the nucleotide sequence shown in SEQ ID NO: 3 and downstream primer AMY-A2-R1 with the nucleotide sequence shown in SEQ ID NO: 4, as well as upstream primer AMY-A2-F2 with the nucleotide sequence shown in SEQ ID NO: 5 and downstream primer AMY-A2-F2 with the nucleotide sequence shown in SEQ ID NO: 6;

[0011] S12. Synthesize the RNAi fragment by PCR amplification, recover the amplification product, and perform the synthesis and purification of dsRNA to obtain dsRNA targeting the α-amylase gene AMY.

[0012] Preferably, in step S12, the reaction system for the PCR amplification is: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction procedure for the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 10 s, for a total of 34 cycles; final extension at 72°C for 3 min.

[0013] Preferably, the nucleotide sequence of the α-amylase gene AMY is shown in SEQ ID NO: 2.

[0014] The present invention also provides a preparation method targeting the α-amylase gene AMY, which comprises the following steps:

[0015] S21. Extract the total RNA of the spider mite and reverse-transcribe it into cDNA;

[0016] S22. According to the genomic databases of Tetranychus urticae and Tetranychus cinnabarinus, use software to design the corresponding primer pair AMY-A1;

[0017] S23. Use the primer pair AMY-A1 to perform PCR amplification with cDNA as the template to obtain it.

[0018] Preferably, the primer pair AMY-A1 includes upstream primer AMY-A1-F with the nucleotide sequence shown in SEQ ID NO: 7 and downstream primer AMY-A1-R with the nucleotide sequence shown in SEQ ID NO: 8.

[0019] Preferably, in step S23, the reaction system for PCR amplification is as follows: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction program for PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, for a total of 34 cycles; final extension at 72°C for 3 min.

[0020] The present invention also provides an application of dsRNA targeting the α-amylase gene AMY for preventing and controlling spider mites or for preparing a product for preventing and controlling spider mites.

[0021] Preferably, the spider mites include, but are not limited to, Tetranychus urticae, Tetranychus cinnabarinus, and Tetranychus truncatus.

[0022] Preferably, the method for preventing and controlling spider mites is to feed dsRNA targeting the α-amylase gene AMY or to feed a composition containing dsRNA targeting the α-amylase gene AMY.

[0023] Compared with the prior art, the beneficial effects of this solution are as follows:

[0024] In view of the gluconeogenesis process of spider mites, the present invention discovers and provides dsRNA of the α-amylase gene AMY, which can efficiently inhibit the starch digestion function of spider mites, has an excellent lethal effect on them, can efficiently control the population of spider mites, and reduce the field damage of spider mites. This dsRNA can be used for the development of transgenic mite-resistant plants or new acaricides, can specifically prevent and control agricultural pest mites without affecting other beneficial insects and predatory mites, its application can also effectively reduce the use of chemical acaricides, has higher environmental protection, and can also enrich the RNAi target information library specific to spider mites, laying a foundation for the creation of green mite control agents. Description of the Drawings

[0025] Figure 1 is the electrophoretic analysis diagram of the amplification of the α-amylase gene AMY in Example 1 of the present invention;

[0026] Figure 2 is the electrophoretic analysis diagram of the amplification of dsRNA of the α-amylase gene AMY in Example 2 of the present invention;

[0027] Figure 3 is the statistical result of the survival rate of spider mites fed with dsRNA of the α-amylase gene AMY in Example 3 of the present invention;

[0028] Figure 4 is the death phenotype of spider mites in Example 3 of the present invention. Detailed Embodiments

[0029] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts shall fall within the scope of protection of the present invention.

[0030] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0031] Example 1 Synthesis of α - amylase gene AMY

[0032] 1 Tetranychus population

[0033] Tetranychus urticae and Tetranychus cinnabarinus were collected from a rose garden in Kunming, Yunnan, and Tetranychus truncatus was collected from a soybean field in Lanzhou, Gansu. All Tetranychus populations were reared in a constant - temperature light incubator. The test host was cowpea seedlings, and the rearing conditions were 26 °C, 14 - hour light, and 10 - hour darkness.

[0034] 2 RNA extraction and reverse transcription

[0035] Two hundred female adult mites at 3 - 5 days old were picked, and total RNA was extracted using Trizol after being quickly frozen in liquid nitrogen. Subsequently, 1 μg of RNA was taken and 1 μL of DNase Ⅰ was added to remove genomic DNA contamination. Using the purified RNA as a template, the first - strand cDNA was synthesized by reverse transcription using the PrimeScriptII 1st Strand cDNA Synthesis Kit from Takara Company, and the reaction system and conditions were strictly operated according to the kit instructions.

[0036] 3 Primer design and gene cloning

[0037] According to the genomic databases of Tetranychus urticae and Tetranychus cinnabarinus, the full - length CDS primers A1 (Table 1) were designed using Primer5.0 software. After being synthesized by Tsingke Biological Gene Company, the primers were used for PCR amplification with Tetranychus cDNA as a template. The reaction system was: 12.5 μL of K5HiFi 2×PCR Master Mix, 1 μL of each upstream and downstream primer (10 μM), 1 μL of cDNA template, and made up to 25 μL with ddH2O.

[0038] Table 1 Amplification primers for α - amylase gene AMY sequence

[0039]

[0040]

[0041] 4. PCR Amplification and Product Verification

[0042] The PCR reaction program was set as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, for a total of 34 cycles; final extension at 72°C for 3 min; store the product at -20°C. Electrophoresis analysis showed that the position of the amplified product band was consistent with the expected target fragment size of 1704 bp (see Figure 1 ), indicating good primer specificity. The full-length CDS of the α-amylase gene could be successfully obtained by PCR amplification, and the nucleotide sequence was as shown in SEQ ID NO: 2.

[0043] CDS nucleotide sequence of the α-amylase gene AMY (SEQ ID NO: 2):

[0044]

[0045] After the amplified product was recovered by gel extraction, it was ligated to the pClone007 (Qingke Biotechnology) vector using a rapid TA ligase, and then transformed into 5α competent cells. The revived competent cells were evenly spread onto a solid LB culture plate and incubated at 37 °C for 14 hours. Single colonies were picked for bacterial detection and sequencing. Positive colonies were expanded in LB culture medium and plasmids were extracted.

[0046] Example 2 Synthesis of dsRNA of α-amylase gene AMY

[0047] 1 Primer design

[0048] Based on the CDS sequence of the α-amylase gene AMY cloned in Example 1, the dsRNA primer A2 (Table 2) was designed using Primer5.0 software. The primer design included the following key features: a 300 - 500 bp region was selected as the template in the full-length CDS sequence; the T7 RNA polymerase promoter sequence (5'-TAATACGACTCACTATAGGGAGAGAATAGGCATGCGTAGATC-3') was added to the 5' ends of the upstream and downstream primers.

[0049] The Tm value of the primer was controlled at 55 ± 3 °C, the GC content was 40 - 60%, the 3' end avoided three consecutive G / C bases, and the last base was preferably T.

[0050] Table 2 Amplification primers for the dsRNA sequence of α-amylase gene AMY

[0051]

[0052] 2 Synthesis and purification of dsRNA

[0053] The upstream and downstream fragments were amplified separately using the full-length plasmid of the α-amylase gene as the template. The reaction system was: 12.5 μL of K5HiFi 2×PCR Master Mix, 1 μL of each upstream and downstream primer (10 μM), 1 μL of cDNA template, and ddH2O was added to make up to 25 μL. The PCR program was set as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s, annealing at 55 °C for 15 s, extension at 72 °C for 10 s, for a total of 34 cycles; final extension at 72 °C for 3 min; the product was stored at -20 °C.

[0054] The dsRNA was synthesized using the T7 RiboMAXTM Express RNAi System. The reaction system was as follows: 10 μL of RiboMAXTM Express T7 2× Buffer, 1 - 8 μL of DNA template, 2 μL of Enzyme Mix, and made up to 20 μL with Nuclease-free Water. Incubate at 37 °C for 4 h. Remove the DNA template and mix equal volumes of the sense and antisense RNA solutions. After incubating at 70 °C for 10 min, slowly cool to room temperature. Add 1 μL of RQ1 High Purity RNase-Free DNase and 1 μL of RNase A solution (diluted 1:200), and incubate at 37 °C for 30 min to degrade the residual DNA.

[0055] The purification of dsRNA was carried out by ethanol precipitation method: ① Add 0.1 volume of 3 M sodium acetate (pH 5.2) and 1 volume of isopropanol, and let stand on ice for 5 min; ② Centrifuge at 14000 rpm for 10 min and discard the supernatant; ③ Wash the precipitate with 0.5 mL of 70% ethanol and dry at room temperature for 15 min; ④ Dissolve the RNA with 20 - 50 volumes of Nuclease-free Water and store at -70 °C. The concentration of dsRNA was measured using NanoDrop2000 (A260 / A280 ≥ 1.8), and the integrity of dsRNA was detected by agarose gel electrophoresis. The nucleotide sequence was as shown in SEQ ID NO: 1.

[0056] The dsRNA nucleotide sequence of the α-amylase gene AMY (SEQ ID NO: 1):

[0057] ATTGGTGTTGCTGGATTCAGAATGGATGCATCAAAGCATATTTGGCCTGGTAATCTTAAAGCAATATTTGATCGCGTCCACAATTTAAATACGGCTTACTTCCCTGAAAACAGTCGCCCAATCCTTTGCCATGAAGTTCAGCCAGGCGGAGCTGTCACAATGGCAGAATACACACCATTAGGTCGAGTCTTGGAATTCAATTATCGATCATCTATTGTTGACGTTTTCCGTGGTAATAATGGACAAAAGTTGAGATGGTTAAAGAACTTTGGCGAAGGCTGGAATTTTGTTAAAAGTGGTGACGCAGTTCCAATGATTGATAATCATGATCTTCAAAGATCCGACGTTTACAAAGGAATCAATTTCCGTTCAAGCCGCCTCTATAAACTTGCTACTGCATTCATGTTGGCCTGGCCCTATGGTGTTCCCAATGTAATGAGCAGTTACGATTGGCCCACTGATATGCAAGGAGATACCGATAAAAACAAATATATGGGACCACCAGCTGATGATCA。

[0058] The results showed that the target dsRNA fragment was successfully cloned using the full-length plasmid of AMY as a template, and the position and size of the further synthesized dsRNA were consistent with the theoretical value of 515 bp (see Figure 2 ).

[0059] Example 3: Experiment on delivering dsRNA by feeding method

[0060] After diluting the purified dsRNA solution in Example 2 with enzyme-free water to 1500 ng / μL, the solution was evenly spotted on a 35 mm culture dish by the drop method using a 10 μL pipette gun to form a rectangular distribution grid of 2×2 cm.

[0061] The fresh cowpea leaves were cut into pieces of 2×2 cm in size, and then dehydrated at 60 °C for 2 min. The dehydrated leaves were divided into two groups, one as the control group and the other as the experimental group. The dehydrated leaves of the experimental group were attached to the dsRNA droplets, and the leaves were allowed to fully absorb the dsRNA solution for 4-5 hours. Then the two groups of leaves were transferred to a new petri dish. Sterile sponges and filter papers were pre-laid at the bottom of the petri dish for leaf water replenishment and preservation. 30 healthy young mites were picked and transferred onto the treated leaves. Three independent biological replicates were set for each group of experiments. They were continuously fed for seven days and the survival rate was observed and recorded daily. The death phenotype of the spider mites was photographed with a super-depth-of-field microscope.

[0062] The dsRNA solution of AMY was delivered to Tetranychus cinnabarinus, Tetranychus urticae and Tetranychus truncatus in the nymph stage by the feeding method. Using the dsGFP targeting green fluorescent protein as a control, it was found that after feeding, the three species of spider mites began to die 2 days after feeding dsRNA compared with the control group, and the mortality rate increased significantly with the feeding time. By the 7th day, the mortality rate of the three species of spider mites exceeded 60% ( Figure 3 ); taking the death phenotype of Tetranychus cinnabarinus as an example, when feeding on the dsRNA of AMY, the growth of the spider mites was significantly restricted, the body was shriveled, and the excrement could not be separated from the body ( Figure 4 ), indicating that the dsRNA targeting AMY could significantly inhibit the digestive system of the mites, thus causing their massive death and having a high precision prevention and control efficiency for spider mites.

[0063] The above specific embodiments are only explanations of the present invention, and they are not limitations to the present invention. After reading this specification, those skilled in the art can make modifications to the embodiments without creative contributions according to needs, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A dsRNA targeting the α-amylase gene AMY, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO:

1.

2. The method for synthesizing dsRNA targeting the α-amylase gene AMY according to claim 1, characterized in that, It includes the following steps: S11. Based on the nucleotide sequence of the α-amylase gene AMY, primers pair AMY-A2 containing the T7 promoter are designed using software. The primers pair AMY-A2 includes the upstream primer AMY-A2-F1 with the nucleotide sequence shown in SEQ ID NO: 3 and the downstream primer AMY-A2-R1 with the nucleotide sequence shown in SEQ ID NO: 4, as well as the upstream primer AMY-A2-F2 with the nucleotide sequence shown in SEQ ID NO: 5 and the downstream primer AMY-A2-F2 with the nucleotide sequence shown in SEQ ID NO:

6. S12. The RNAi fragment is synthesized by PCR amplification, the amplified product is recovered, and the synthesis and purification of dsRNA are carried out to obtain the dsRNA targeting the α-amylase gene AMY.

3. The synthesis method of the dsRNA targeting the α-amylase gene AMY according to claim 2, wherein In step S12, the reaction system for the PCR amplification is: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of the 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction program for the PCR amplification is: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s, annealing at 55 °C for 15 s, extension at 72 °C for 10 s, for a total of 34 cycles; final extension at 72 °C for 3 min.

4. The synthesis method of the dsRNA targeting the α-amylase gene AMY according to claim 2, wherein, characterized in that, The nucleotide sequence of the α-amylase gene AMY is shown in SEQ ID NO:

2.

5. The preparation method of the targeting α-amylase gene AMY according to any one of claims 2-4, characterized in that, It includes the following steps: S21. Extract the total RNA of the spider mite and reverse transcribe it into cDNA. S22. According to the genomic databases of Tetranychus urticae and Tetranychus cinnabarinus, primers pair AMY-A1 is designed using software. S23. Using cDNA as a template, PCR amplification is carried out with primers pair AMY-A1 to obtain it.

6. The preparation method for targeting the α-amylase gene AMY according to claim 5, characterized in that, The primers pair AMY-A1 includes the upstream primer AMY-A1-F with the nucleotide sequence shown in SEQ ID NO: 7 and the downstream primer AMY-A1-R with the nucleotide sequence shown in SEQ ID NO:

8.

7. The preparation method of targeting the α-amylase gene AMY according to claim 5, characterized in that, In step S23, the reaction system for the PCR amplification is: 12.5 μL of K5 HiFi 2×PCR Master Mix, 1 μL each of the 10 μM upstream and downstream primers, 1 μL of cDNA template, and supplemented with ddH2O to 25 μL; the reaction program for the PCR amplification is: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 30 s, annealing at 55 °C for 15 s, extension at 72 °C for 1 min, for a total of 34 cycles; final extension at 72 °C for 3 min.

8. Use of the dsRNA targeting the α-amylase gene AMY according to claim 1, characterized in that, For controlling spider mites or preparing products for controlling spider mites.

9. Use of the dsRNA targeting the α-amylase gene AMY according to claim 8, characterized in that, The spider mites include but are not limited to Tetranychus urticae, Tetranychus cinnabarinus, and Tetranychus truncatus.

10. Use of the dsRNA targeting the α - amylase gene AMY according to claim 8 or 9, characterized in that, The method for controlling spider mites is feeding the dsRNA targeting the α-amylase gene AMY or feeding a composition containing the dsRNA targeting the α-amylase gene AMY.

Images