Gene for inducing apomixis of plants, induction method formed by gene and application of gene
By introducing specific genes of Arabidopsis and other plants into rice and combining them with the MiMe system, a fusion-free reproductive system was constructed, which solved the problems of low fruiting rate and cloning efficiency in rice breeding, and achieved efficient rice breeding methods.
Patent Information
- Application Number
- CN202510831584.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2045-06-20
AI Technical Summary
The existing rice-free fusion reproductive system has defects in fruiting rate and cloning efficiency, which hinders its application in production.
Arabidopsis AtCPRO1, corn ZmCPRO3, ZmCPRO4, soybean GlCPRO2, and rapeseed BnaCPRO8 genes were introduced. By ectopic expression in rice egg cells and combining with the MiMe system, a fusion-free reproductive system was constructed, and the rice was induced to reproduction in parto-reproduction and diploid seeds were obtained.
Without affecting the growth and development of the plant, the fruiting rate and cloning efficiency of the rice fusion-free reproductive system are improved, providing new solutions for rice breeding and shortening the breeding cycle.
Smart Images

Figure CN120330218A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of biotechnology and plant breeding, and particularly relates to a method for inducing the generation of cloned diploid offspring by combining genes capable of inducing the generation of haploids to construct an apomixis system. MiMe system Background Art
[0002] Rice is one of the most important food crops in China and even the world. Breeding excellent varieties is conducive to ensuring stable and high yields of rice. The rice breeding process generally takes 5 - 10 years, while through the haploid - diploid breeding technology, the line purification can be completed within 1 - 2 generations, which can greatly shorten the breeding cycle. Traditionally, rice reproduction relies on sexual reproduction, that is, seeds are formed through the combination of male and female gametes. However, this process is greatly affected by environmental factors, and genetic variation is difficult to precisely control. Apomixis, as a reproductive mode that can produce offspring without relying on gamete combination, has great potential in plant genetic improvement and rapid propagation.
[0003] Currently, an artificial apomixis system has been achieved in rice, which is composed of MiMe ( Mitosis instead of meiosis mitosis replacing meiosis) elements and parthenogenesis genes.
[0004] Among them, the chromosome elimination gene MTL and MiMe were combined to construct an apomixis system, but the seed - setting rate and cloning efficiency of the obtained materials are generally low, and practical production applications face challenges. The parthenogenesis genes BBM1, BBM4 and ToPAR were respectively combined with MiMe to construct an apomixis system. MiMe and BBM1 The combination has a cloning efficiency exceeding 95%, but the seed - setting rate is only 44%, and there are significant differences (20% - 65%) among different genetic backgrounds. In contrast, MiMe and BBM4 and ToPAR The combination has a seed - setting rate equal to that of the wild type, but the cloning efficiency is lower than that of the combination of MiMe and BBM1 , only 2.4% and 54% respectively. In summary, the seed - setting rate and cloning efficiency of the currently constructed apomixis systems have certain defects to a certain extent, which hinder the application of apomixis in hybrid rice production. Summary of the Invention
[0005] The present invention provides genes for inducing apomixis in plants, namely: Arabidopsis thaliana AtCPRO1, Zea mays ZmCPRO3, ZmCPRO4, Glycine max GlCPRO2, Brassica napus BnaCPRO8, and their nucleotide sequences are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 respectively.
[0006] The present invention provides an apomixis system for rice composed of the genes for inducing apomixis in plants described above, which is composed of the promoter of the Arabidopsis thaliana egg cell-specific expression gene AtEC1.2 and the MiMe system respectively combined with any one of Arabidopsis thaliana AtCPRO1, Zea mays ZmCPRO3, ZmCPRO4, Glycine max GlCPRO2, Brassica napus BnaCPRO8, and the nucleotide sequence of the promoter of AtEC1.2 is shown as SEQ ID NO.6.
[0007] The present invention also provides a method for producing cloned seeds in the apomixis system of rice using the genes for inducing apomixis in plants described above, which includes the following steps: using the promoter of the Arabidopsis thaliana egg cell-specific expression gene AtEC1.2 to induce any one of the above genes AtCPRO1, ZmCPRO3, ZmCPRO4, GlCPRO2, BnaCPRO8 and combining with the MiMe system to ectopically express in rice egg cells, inducing rice to perform parthenogenesis to obtain rice diploid seeds; specifically including the following steps: (1) Vector construction: First, design primers, and use the primers to clone the promoter of the gene AtEC1.2 and the gene AtCPRO1 from Arabidopsis thaliana respectively, clone the genes ZmCPRO3, ZmCPRO4 from Zea mays, clone the gene GlCPRO2 from Glycine max, and clone the gene BnaCPRO8 from Brassica napus; then digest the backbone vector pgg; finally, use the multi-fragment homologous recombination kit to digest the backbone vector pgg; finally, use the multi-fragment homologous recombination kit to construct a complete composite vector by combining the promoter of AtEC1.2 with any one of the genes AtCPRO1, ZmCPRO3, ZmCPRO4, GlCPRO2 or BnaCPRO8 to obtain the recombinant product; (2) Clone the recombinant product obtained above; (3) Genetic transformation: Use Agrobacterium containing the recombinant product to transform the embryogenic callus prepared from rice seeds, and obtain transgenic plants through culture; (4) Perform diploid identification on the seeds of the transgenic plants.
[0008] Furthermore, a method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis is provided, characterized in that the primers designed in the vector construction step are as follows: AtEC1.2-R: tatTCTTTCTTTTTGGGG (SEQ ID NO. 7); AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO. 8); AtCPRO1-F: caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC (SEQ ID NO. 9); AtCPRO1-R: AATGTTTGAACGATCTCAAGCTACAAAATCATGTACCAATTGTG (SEQ ID NO. 10); ZmCPRO3-F: caaaaagaaagaataATGGCTACCTACTACTCGAGCC (SEQ ID NO. 11; ZmCPRO3-R: AATGTTTGAACGATCTCACGCCACAAAATCATGGAG (SEQ ID NO. 12); ZmCPRO4-F: caaaaagaaagaataATGGCCACATTCTTCTCCACTTC (SEQ ID NO. 13); ZmCPRO4-R: AATGTTTGAACGATCTCACGCCACAAAATCGTGC (SEQ ID NO. 14); GlCPRO2-F: caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG (SEQ ID NO. 15); GlCPRO2-R: AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG (SEQ ID NO. 16); Bna CPRO8-F: caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG (SEQ ID NO. 17); Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG (SEQ ID NO. 18); NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19); NOS-F: GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0009] Furthermore, provided is a method for producing cloned seeds in the apomixis system of rice using the gene for inducing plant apomixis. Preferably, when cloning the recombinant product, the recombinant product is transferred into competent cell DH5α for cloning.
[0010] Furthermore, provided is a method for producing cloned seeds in the apomixis system of rice using the gene for inducing plant apomixis. Preferably, in genetic transformation, the genetic transformation method mediated by Agrobacterium strain EHA105 is used.
[0011] Furthermore, provided is a method for producing cloned seeds in the apomixis system of rice using the gene for inducing plant apomixis. Preferably, the rice variety to be transformed is the indica-japonica hybrid rice variety Chunyou 84.
[0012] Furthermore, provided is a method for producing cloned seeds in the apomixis system of rice using the gene for inducing plant apomixis. Preferably, the method for diploid identification is: identifying diploids using flow cytometry.
[0013] Finally, provided is the application of the gene for inducing plant apomixis, the apomixis system of rice, and the method for producing cloned seeds in the apomixis system of rice using the gene for inducing plant apomixis in the preparation of excellent rice varieties.
[0014] The method of the present invention, by introducing the ones existing in nature from Arabidopsis thaliana AtCPRO1, from maize Zm CPRO3, Zm CPRO4, from soybean GlCPRO2, from rapeseed Bna CPRO8 into rice respectively, and by allowing them to be ectopically expressed in egg cells and then combined with MiMe system under the premise of not affecting the growth and development of plants, can induce the production of cloned diploid offspring, providing a new solution for rice breeding and having important application prospects and economic value. Description of the Drawings
[0015] Figure 1 is the vector map; Figure 2 is the positive detection chart of transgenic plants; Figure 3 is the detection chart of transgenic plant mutation types; Figure 4 It is the phenotypic diagram of the transgenic T0 generation transgenic plants; Figure 5 It is the diagram of screening diploids by flow cytometry; Figure 6 It is the diagram of the whole genome sequencing data of diploid plants; Figure 7 It is the phenotypic diagram of the cloned plants. Specific implementation manners
[0016] Example 1: In Arabidopsis thaliana AtCPRO1 and MiMe The method for producing cloned seeds by the apomixis system of rice composed of the system combination Applying this method to the indica - japonica hybrid rice Chunyou 84, transgenic lines with high and stable seed - setting rates were obtained. In the ploidy identification of the offspring plants, cloned diploid plants with fixed genotypes were successfully identified. It is mainly divided into vector construction, genetic transformation, genotype identification and result detection.
[0017] Vector construction: 1.1 AtEC1.2 Obtaining the promoter and the Arabidopsis thaliana AtCPRO1 gene coding sequence (1) Amplify the required AtEC1.2 promoter and gene AtCPRO1 from the Arabidopsis thaliana genome, and PC1300 - ACTIN - CAS9 amplify the terminator on the vector NOS . The primers are as follows: AtEC1.2 - R: tatTCTTTCTTTTTGGGG (SEQ ID NO.7); AtEC1.2 - F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8); AtCPRO1 - F: caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC (SEQ ID NO.9); AtCPRO1 - R: AATGTTTGAACGATCTCAAGCTACAAAATCATGTACCAATTGTG (SEQ ID NO.10); NOS - R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19); NOS-F: GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO. 20).
[0018] The products were purified using a recovery kit to obtain amplification products 1, 2, and 3 respectively.
[0019] 1.2 Construction of expression cassette A The main steps are as follows (the specific operations can also be carried out with reference to the method described in the paper Wang C, Shen L, Fu Y, Yan C, Wang K. A Simple CRISPR / Cas9 System for Multiplex Genome Editing in Rice. J Genet Genomics. 2015 Dec 20;42(12):703 - 6. doi:10.1016 / j.jgg.2015.09.011, with slight modifications): (1) sgMiMe Construction of the intermediate vector PAIR1, REC8, OSD1 The 4 target sequences of the three genes (the underlined ones are PAM sequences), specifically: Target site of PAIR1: AAGCAACCCAGTGCACCGC TGG (SEQ ID NO. 21); Target site of REC8: CGGAGAGCCTTAGTGCCAT GGG (SEQ ID NO. 22); Target site of OSD1 - g1: TTGACCGCCACGGCTCCCGG CGG (SEQ ID NO. 23); Target site of OSD1 - g3: CTGCCGCCGACGAGCAACA AGG (SEQ ID NO. 24).
[0020] Two complementary DNA sequences were designed respectively. The forward primer of the target site was GGCA added before the forward target sequence, and the reverse primer of the target site was AAAC added before the reverse complementary target sequence. PAIR1, REC8, OSD1
[0021] There are two AarI restriction enzyme sites on the SK-gRNA intermediate vector. After digestion with AarI, a vector with sticky ends is formed. The forward and reverse primers of the target are mixed and denatured and annealed to form a fragment with sticky ends. The vector and the fragment are ligated using T4 ligase to form the intermediate vector of a single sgMiMe target gene, which are respectively labeled as SK-gPAIR1, SK-gREC8, SK-gOSD1-g1, and SK-gOSD1-g3.
[0022] (2) sgMiMe Construction of the vector Taking advantage of the property that BglII and BamHI, NheI and XbaI, and SalI and XhoI are isocaudomers, gRNA polymerization is carried out: SK-gRNA OSD1-g1 is digested with KpnI and XhoI as the vector; SK-gRNA PAIR1 is digested with SalI and BamHI to provide the PAIR1 sgRNA fragment, and SK-gRNA REC8 is digested with BglII and KpnI to provide the REC8 sgRNA fragment for one-step rapid polymerization of 3 gRNAs. Finally, the polymerized gRNA OSD1-gRNA REC8-gRNA PAIR1 vector is digested with KpnI and BglII and the fragment is recovered and ligated into the binary vector pC1300-Cas9 expressing Cas9 protein (between the KpnI and BamHI sites). Subsequently, the above-ligated vector is digested with KpnI and XbaI, and SK-gRNA OSD1 -g3 is digested with KpnI and NheI, and the two parts are ligated using T4 ligase to finally obtain the multi-gene knockout expression cassette A that can simultaneously knockout 4 targets of the three genes REC8, OSD1, and PAIR1.
[0023] 1.3 Construction of expression cassette B The AtEC1.2 promoter, Arabidopsis AtCPRO1 gene coding sequence, and the NOS terminator are integrated onto expression cassette A to obtain expression cassette B. The vector map is as Figure 1 : (1)Digest the vector expression cassette A with PmeⅠ COMPONENT 50 µl REACTION pC1300-Act-Cas9 1 µg 10 X rCutSmart Buffer 5 µl (1X) PmeⅠ 20 units Nuclease-free Water to 50 µl The enzyme was digested at 37°C for 5 h, and the product was purified using a recovery kit to obtain the expression cassette A.
[0024] (2) Using the multi-fragment homologous recombination kit (Novozyme C113): COMPONENT 20 µl REACTION pC1300-Act-Cas9 (PmeⅠ cut) 100ng Amplification product 1 20ng Amplification product 2 10ng Amplification product 3 20ng 5 xCE MultiS Buffer 4 µl Exnase MultiS 2 µl Nuclease-free Water to 20 µl Incubate at 37°C for 30 min; cool to 4°C or place on ice immediately.
[0025] (3) Transformation of recombinant products: Thaw the chemical competent cells for cloning on ice; add 10µl of the recombinant product to 500µl of competent cells, flick the tube wall to mix, and place on ice for 30 min; heat shock in a 42℃ water bath for 45 sec, and immediately place on ice to cool for 2 min; add 900µl of LB medium (without antibiotics), shake at 37℃ for 1 h (speed 200 rpm); centrifuge at 5,000 rpm for 1 min, keep 100µl to resuspend, and spread on the corresponding resistance plate; incubate inverted in a 37℃ incubator for 12 - 16 h. Positive clones were detected by colony PCR and sent to the company for sequencing. The sequencing primer is pC1300-F: acactttatgcttccggctc (SEQ ID NO.31).
[0026] 2. Genetic Transformation The sequencing of the cloned vector was correct, and the next step was to carry out the Agrobacterium transformation experiment. The indica-japonica hybrid rice variety Chunyou 84 (CY84) was transformed using the genetic transformation method mediated by the Agrobacterium EHA105 strain to obtain transgenic materials. The seeds were shelled, disinfected with 75% ethanol for 1 min, the ethanol was poured out, and 2% sodium hypochlorite solution was added for disinfection for 20 min, and placed on a shaker during this period; the sodium hypochlorite solution was poured out in the clean bench, and the seeds were rinsed with sterile water for 4-5 times, and the seeds were placed on sterilized filter paper to absorb the water; then the seeds were inoculated on N6 mature embryo callus induction medium, cultured in the dark at 28℃ for about 1 month, and the embryonic callus in good condition was selected for subculture 2-3 times, and the embryonic callus of the second subculture 3-5 days was selected for transformation.
[0027] Immerse the embryogenic callus in the activated Agrobacterium tumefaciens EHA105 bacterial solution (containing acetosyringone) with the target plasmid for 30 min, wash the callus several times with sterile water, dry the residual liquid in a laminar flow hood, and co-culture at 19°C for 2 - 3 d. Then transfer it to a selection medium containing a selection marker antibiotic for screening. Each screening process lasts for 2 weeks. After 2 - 3 rounds of screening, new-grown callus can be obtained. Then transfer the newly grown callus to a pre-differentiation medium for 7 d, and then transfer it to a differentiation medium. Culture it under a light condition of 25°C and 16 h / d for about 10 d. Green dots will appear, and then regenerated plants can be obtained. Cut off the roots of the differentiated transgenic seedlings and place them in a rooting medium for 2 - 3 weeks. Then remove the sealing film, add water to acclimatize the seedlings for 1 week, and transplant them.
[0028] 3. Detection of mutations and ectopic expression in T0 transgenic plants Screening OsPAIR1 、 OsREC8 and OsOSD1 A method for obtaining T0 transgenic plants with homozygous mutations in all three genes. The specific method is as follows: (1)Design Hi-TOM detection primers according to the gene sequences of OsPAIR1, OsREC8 and OsOSD1 . The primer sequences are as follows: PAIR1-Hi-F: ggagtgagtacggtgtgccttcttgcgcgcgagaagagtctc (SEQ ID NO.25); PAIR1-Hi-R: gagttggatgctgagtgggagatgtagtgcgtgggtcttg (SEQ ID NO.26); REC8-Hi-F: ggagtgagtacggtgtgcttgggttagtgaggagat (SEQ ID NO.27); REC8-Hi -R: gagttggatgctgagtggtgcgatcggaactatggagac (SEQ ID NO.28); OSD1-Hi-F: ggagtgagtacggtgtgctatcaggaggacgacgtcgccg (SEQ ID NO.29); OSD1-Hi-R: gagttggatgctgagtggctcctcctcttgggtgtagc (SEQ ID NO.30).
[0029] The above three pairs of primers were used for PCR amplification of T0 transgenic plants, and the Hi-TOM system was used to detect the mutation types of the three genes in all plants, and transgenic plants with homozygous mutations (i.e., homozygous knockout) of all three genes were screened.
[0030] (2)The genomic DNA of these plants was extracted by the CTAB method, and the transgenic positive identification of the transgenic lines was carried out using the primer combination of At C1-PCR-F and AtC1-PCR-R. The primer information used is as follows: At C1-PCR-F: gtgactatttaccgtcaatcctttc (SEQ ID NO. 32); AtC1-PCR-R: CTCGGCGCCATATTTTGATG (SEQ ID NO. 33).
[0031] 4. Identification of plant ploidy and genotype: The offspring of T0 transgenic plants with homozygous mutations of all five genes were detected using flow cytometry and genomic sequencing technology to screen plants with fixed heterosis. Flow cytometry was used to identify the ploidy of the offspring plants of T0 transgenic plants with homozygous mutations of all five genes. The specific experimental operations were as follows: Cut fresh rice leaves that have grown for 10 days and are 4 - 5 cm long and put them into a glass dish. Add 1 ml of plant lysis buffer LB01, and quickly chop the tissue vertically downward with a blade. Aspirate the lysate in the culture dish, filter it through a 50 µm nylon mesh into a centrifuge tube, and mark the sample on the tube cap. In a tabletop refrigerated centrifuge, centrifuge at 1,200 rpm for 5 min at 4°C. Gently take out the centrifuge tube, slowly aspirate the supernatant, and add 450 µl of LB01, 25 µl of pre-cooled PI, and 25 µl of RNase A. Stain in the dark at 4°C for 10 min. Detect with a BD Accuri C6. If it is diploid, its peak should be consistent with the wild-type peak. The specific reagent formula is as follows: Lysis buffer LB01: 363.4 mg of Tris, 148.9 mg of Na2EDTA, 34.8 mg of Sperminetetrahydrochloride, 1.193 g of KCl, 233.8 mg of NaCl, 200 µl of Triton X-100, made up to 200 mL, adjusted to pH 7.5 with 1M HCl, and 220 µl of β-mercaptoethanol was added in a fume hood. Filter and sterilize with a 0.22 µm filter head and aliquot in a laminar flow hood, and store at -20°C.
[0032] Propidium iodide (PI) stock solution (1 mg / ml): Weigh 50 mg of the powder and dissolve it in 50 mL of ddH2O; filter and sterilize it with a 0.22 μm filter head in a laminar flow hood and aliquot, then store at -20°C.
[0033] RNase stock solution (1 mg / ml): Weigh 25 mg of RNase (IIA Sigma) and dissolve it in 25 ml of ddH2O; filter and sterilize it with a 0.22 µm filter head in a laminar flow hood and aliquot; heat it at 90°C for 15 min to inactivate DNase; store at -20°C.
[0034] Detect the genotype of diploid plants using genome sequencing technology, specifically: For the plants detected as diploid above, extract their DNA and construct a library, and perform paired-end sequencing using the Illumina Hiseq2500 sequencing platform. The average sequencing depth of each sample is 10 - 15 times. First, filter the obtained raw data using NGSQCtoolkit v2.3.3, then align the filtered data to the reference genome to obtain SNPs data, and finally compare the SNPs data with the genome of wild-type Chunyou 84 to clarify the genotype of diploid plants. If it is a diploid plant with fixed heterosis, its genome is theoretically a heterozygous genotype consistent with Chunyou 84.
[0035] 5. Detection results: A total of 48 lines were obtained through genetic transformation. Using the Hi-TOM detection technology, the mutation types of 3 genes OsPAIR1, OsREC8 and OsOSD1 were detected, and the transgenic positives were identified. The results showed that a total of 5 lines (PGR-5, PGR-6, PGR-18, PGR-33, PGR-36) simultaneously had the AtEC1.2: AtCPRO1 expression element ( Figure 2 ) and PAIR1, REC8, OSD1 homozygous mutations of the three genes ( Figure 3 ). The growth and development of these 5 lines were consistent with the wild type ( Figure 4 ), and their seed setting rates fluctuated to some extent, 62.41 - 73.76%, while the seed setting rate of the wild-type Chunyou 84 was 71.24 ± 6.51%. When the seeds were mature, harvest the seeds of these lines. Germinate the T1 progeny seeds obtained from the 5 lines, and perform flow cytometry analysis on the ploidy of the progeny at the seedling stage. One diploid plant was screened from each of the two lines (PGR-33 and PGR-36) ( Figure 5). Subsequently, these two genotypes were further verified through whole-genome sequencing data. The results showed that the whole-genome sequencing data of these two strains revealed a diploid genotype, and both were consistent with the genotype of Chunyou 84, being in a heterozygous state ( Figure 6 ). These two plants are both apomictic clone plants, and the cloning efficiencies are 1.85% and 2.50% respectively (Table 1). In addition, the growth and development of these two cloned plants are consistent with those of the wild type ( Figure 7 ).
[0036] Example 2: In maize ZmCPRO3, ZmCPRO4 And MiMe Method for producing cloned seeds by a rice apomixis system composed of a system combination Applying this method to the indica-japonica hybrid rice Chunyou 84, transgenic lines with high and stable seed setting rates were obtained. In the ploidy identification of the offspring plants, cloned diploids with fixed genotypes were successfully identified. It mainly includes vector construction, genetic transformation, genotype identification, and result detection.
[0037] Vector construction: 1.1 AtEC1.2 Obtaining the promoter and the maize ZmCPRO3, ZmCPRO4 Gene coding sequence (1) Amplify the required AtEC1.2 Promoter from the Arabidopsis genome and the required ZmCPRO3, ZmCPRO4 from the maize genome, and amplify the terminator on the PC1300-ACTIN-CAS9 vector NOS .
[0038] The primers are as follows: AtEC1.2-R: tatTCTTTCTTTTTGGGG (SEQ ID NO.7); AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8); ZmCPRO3-F: caaaaagaaagaataATGGCTACCTACTACTCGAGCC (SEQ ID NO.11); ZmCPRO3-R: AATGTTTGAACGATCTCACGCCACAAAATCATGGAG (SEQ ID NO.12); ZmCPRO4-F: caaaaagaaagaataATGGCCACATTCTTCTCCACTTC (SEQ ID NO.13); ZmCPRO4-R: AATGTTTGAACGATCTCACGCCACAAAATCGTGC (SEQ ID NO.14); NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19); NOS-F: GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0039] The products were purified using a recovery kit to obtain amplification products 1, 2, 3, and 4 respectively.
[0040] 1.2 Construction of expression cassette A The expression cassette A was obtained in the same way as in Example 1.
[0041] 1.3 Construction of expression cassette B The AtEC1.2 promoter, the maize ZmCPRO3, ZmCPRO4 gene coding sequence, and the NOS terminator were integrated onto the expression cassette A to obtain the expression cassette B. The vector map is as Figure 1 , and the specific method is the same as in Example 1.
[0042] 2. Genetic transformation The specific method is the same as in Example 1.
[0043] 3. Detection of mutations and ectopic expression in T0 transgenic plants (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for screening T0 transgenic plants with homozygous mutations in all three genes, the specific method is the same as in Example 1, to screen transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0044] (2) The genomic DNA of these plants was extracted using the CTAB method, and the transgenic lines were identified for transgenic positivity using the primer pairs ZmC3-PCR-F and ZmC3-PCR-R, ZmC4-PCR-F and ZmC4-PCR-R. The primer information used is as follows: ZmC3-PCR-F: cccattcctcccactaatcc (SEQ ID NO.34); ZmC3-PCR-R: GCCCGCCAGAAGCCGGGCTG (SEQ ID NO.35); ZmC4-PCR-F: cccattcctcccactaatcc (SEQ ID NO.36); ZmC4-PCR-R: CTTCCGACGACACGATGGTG (SEQ ID NO. 37).
[0045] 4. Ploidy and genotype identification of plants: The specific method is the same as that in Example 1.
[0046] 5. Detection results: 5.1 ZmCPRO3 A total of 28 lines were obtained through genetic transformation. Using the Hi-TOM detection technology, the mutation types of 3 genes OsPAIR1, OsREC8 and OsOSD1 were detected, and the transgenic positives were identified. The results showed that a total of 14 lines (PHJ-1, PHJ-2, PHJ-3, PHJ-5, PHJ-7, PHJ-8, PHJ-10, PHJ-14, PHJ-15, PHJ-17, PHJ-19, PHJ-21, PHJ-23, PHJ-24) simultaneously had the AtEC1.2: ZmCPRO3 expression element and PAIR1, REC8, OSD1 homozygous mutations of the three genes. The growth and development of these 14 lines were consistent with those of the wild type, and the seed setting rate was 73.63 ± 1.32%, while the seed setting rate of the wild type of Chunyou 84 was 71.24 ± 6.51%. When the seeds matured, the seeds of these lines were harvested. The T1 progeny seeds obtained from the 14 lines were germinated, and the ploidy of the progeny was analyzed by flow cytometry at the seedling stage. One diploid plant was screened out in one line (PHJ-24). Then, the genotype of this plant was further verified through whole-genome sequencing data. The results showed that the whole-genome sequencing data of this plant showed a diploid genotype, and all were consistent with the genotype of Chunyou 84, being in a heterozygous state. This plant material was an apomictic clone plant, and the cloning efficiency was 1.67% (Table 1). In addition, the growth and development of this cloned plant were consistent with those of the wild type.
[0047] 5.2 ZmCPRO4 A total of 27 lines were obtained through genetic transformation. Using the Hi-TOM detection technology, the mutation types of 3 genes OsPAIR1, OsREC8 and OsOSD1 were detected, and the transgenic positives were identified. The results showed that a total of 8 lines (PHK-1, PHK-5, PHK-11, PHK-14, PHK J-16, PHK-17, PHK-22, PHK-24) simultaneously had the AtEC1.2: ZmCPRO4 expression element and PAIR1, REC8, OSD1Homozygous mutations of three genes. The growth and development of these 8 lines were consistent with those of the wild type, and the seed setting rate was 76.10±9.90%, while that of the wild type of Chunyou 84 was 71.24±6.51%. When the seeds matured, the seeds of this line were harvested. The T1 progeny seeds obtained from the 8 lines were germinated, and the ploidy of the progeny was analyzed by flow cytometry at the seedling stage. Three diploid plants were screened out in one line (PHK-5). Then, the genotypes of these 3 plants were further verified by whole-genome sequencing data. The results showed that the whole-genome sequencing data of these 3 plant materials showed a diploid genotype, and all were consistent with the genotype of Chunyou 84 and were in a heterozygous state. These 3 plant materials were apomictic clone plants, and the cloning efficiency was 25% (Table 1). In addition, the growth and development of these 3 cloned plants were consistent with those of the wild type.
[0048] Example 3: In soybean GlCPRO2 and MiMe Method for producing cloned seeds by an apomictic system of rice composed of a system combination This method was applied to the indica-japonica hybrid rice Chunyou 84, and transgenic lines with high and stable seed setting rates were obtained. In the ploidy identification of the progeny plants, cloned diploids with fixed genotypes were successfully identified. It mainly includes vector construction, genetic transformation, genotype identification, and result detection.
[0049] Vector construction: 1.1 AtEC1.2 Obtaining of promoter and soybean GlCPRO2 gene coding sequence (1) Amplify the required AtEC1.2 promoter from the Arabidopsis genome and the required GlCPRO2 from the soybean genome, and amplify the terminator on the PC1300-ACTIN-CAS9 vector NOS . The primers are as follows: AtEC1.2-R: tatTCTTTCTTTTTGGGG (SEQ ID NO.7); AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8); GlCPRO2-F: caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG (SEQ ID NO.15); GlCPRO2-R: AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG (SEQ ID NO.16); NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO. 19); NOS-F: GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO. 20).
[0050] The products were purified using a recycling kit to obtain amplification products 1, 2, and 3 respectively.
[0051] 1.2 Construction of expression cassette A The expression cassette A was obtained in the same way as in Example 1.
[0052] 1.3 Construction of expression cassette B The AtEC1.2 promoter, soybean GlCPRO2 gene coding sequence and the NOS terminator were integrated onto the expression cassette A to obtain the expression cassette B. The vector map is as Figure 1 , and the method was the same as in Example 1.
[0053] 2. Genetic transformation The method was the same as in Example 1.
[0054] 3. Detection of mutations and ectopic expression in T0 transgenic plants (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for screening T0 transgenic plants with homozygous mutations in all three genes, the specific method was the same as in Example 1, to screen transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0055] (2) The genomic DNA of these plants was extracted using the CTAB method, and the transgenic lines were identified for transgenic positivity using the primer pair GlC2-PCR-F and GlC2-PCR-R. The primer information used is as follows: GlC2-PCR-F: caccactaagcttcgaatcc (SEQ ID NO. 38); GlC2-PCR-R: GCCCCTACTGATGGTGATGG (SEQ ID NO. 39).
[0056] 4. Ploidy and genotype identification of plants: The specific method was the same as in Example 1.
[0057] 5. Detection results: A total of 32 lines were obtained through genetic transformation. Using the Hi-TOM detection technology, for the three genes OsPAIR1, OsREC8 andOsOSD1 The mutation types were detected, and the transgenic positives were identified. The results showed that a total of 9 lines (PGL-2, PGL-4, PGL-8, PGL-10, PGL-11, PGL-13, PGL-14, PGL-20, PGL-26) were identified to have both the AtEC1.2:GlCPRO2 expression element and PAIR1, REC8, OSD1 homozygous mutations in three genes. The growth and development of these 9 lines were consistent with those of the wild type, and the seed setting rate was 70.1 ± 7.83%, while that of the wild type of Chunyou 84 was 71.24 ± 6.51%. When the seeds matured, the seeds of these lines were harvested. The T1 progeny seeds obtained from the 9 lines were germinated, and the ploidy of the progeny was analyzed by flow cytometry at the seedling stage. One diploid plant was screened from one line (PGL-2). Then, the genotype of this plant was further verified by whole-genome sequencing data. The results showed that the whole-genome sequencing data of this plant showed a diploid genotype, and all were consistent with the genotype of Chunyou 84, being in a heterozygous state. This plant material was an apomictic cloning plant, and the cloning efficiency was 1.51% (Table 1). In addition, the growth and development of this cloned plant were consistent with those of the wild type.
[0058] Example 4: In rapeseed Bna CPRO8 And MiMe Method for producing cloned seeds by an apomictic rice system composed of a system combination This method was applied to the indica-japonica hybrid rice Chunyou 84, and transgenic lines with relatively high and stable seed setting rates were obtained. In the ploidy identification of the progeny plants, cloned diploids with fixed genotypes were successfully identified. It mainly included vector construction, genetic transformation, genotype identification, and result detection.
[0059] Vector construction: 1.1 AtEC1.2 Obtaining of the promoter and rapeseed Bna CPRO8 Gene coding sequence (1) The required AtEC1.2 promoter was amplified from the Arabidopsis thaliana genome, and the required BnaCPRO8 was amplified from the rapeseed genome. The terminator was amplified on the PC1300-ACTIN-CAS9 vector NOS .
[0060] The primers were as follows: AtEC1.2-R: tatTCTTTCTTTTTGGGG (SEQ ID NO.7); AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc (SEQ ID NO.8); Bna CPRO8-F: caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG (SEQ ID NO.17); Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG (SEQ ID NO.18); NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC (SEQ ID NO.19); NOS-F: GATCGTTCAAACATTTGGCAATAAAG (SEQ ID NO.20).
[0061] The products were purified using a recycling kit to obtain amplification products 1, 2, and 3 respectively.
[0062] 1.2 Construction of expression cassette A The expression cassette A was obtained in the same manner as in Example 1.
[0063] 1.3 Construction of expression cassette B The AtEC1.2 promoter, rapeseed Bna CPRO8 gene coding sequence and NOS terminator were integrated onto the expression cassette A to obtain the expression cassette B. The vector map is as Figure 1 , and the method was the same as in Example 1.
[0064] 2. Genetic transformation The method was the same as in Example 1.
[0065] 3. Detection of mutations and ectopic expression in T0 transgenic plants (1) Screening OsPAIR1 , OsREC8 and OsOSD1 The method for screening T0 transgenic plants with homozygous mutations in all three genes, the specific method was the same as in Example 1, to screen transgenic plants with homozygous mutations in all three genes (i.e., homozygous knockout).
[0066] (2) Genomic DNA of these plants was extracted using the CTAB method, and the transgenic lines were identified for transgenic positivity using the primer pair BnaC8-PCR-F and BnaC8-PCR-R. The primer information used is as follows: BnaC8-PCR-F: caccactaagcttcgaatcc (SEQ ID NO.40); BnaC8-PCR-R: GTTAGGGATATCGAGACCGC (SEQ ID NO.41).
[0067] 4. Identification of plant ploidy and genotype: The specific method is the same as that in Example 1.
[0068] 5. Detection results: A total of 35 lines were obtained through genetic transformation. Using the Hi-TOM detection technique, the mutation types of three genes OsPAIR1, OsREC8 and OsOSD1 were detected, and the transgenic positives were identified. The results showed that a total of 10 lines (PGY-2, PGY-4, PGY-6, PGY-9, PGY-12, PGY-15, PGY-22, PGY-25, PGY-28, PGY-30) simultaneously had the AtEC1.2: BnaCPRO8 expression element and PAIR1, REC8, OSD1 homozygous mutations of the three genes. The growth and development of these 10 lines were consistent with those of the wild type, and their seed setting rates fluctuated to some extent, ranging from 54.07% to 88.67%. The seed setting rate of the wild type of Chunyou 84 was 71.24 ± 6.51%. When the seeds matured, the seeds of these lines were harvested. The T1 progeny seeds obtained from the 10 lines were germinated, and the ploidy of the progeny was analyzed by flow cytometry at the seedling stage. One diploid plant was screened from each of the two lines (PGY-28 and PGY-30). Then, the genotypes of these two plants were further verified through whole-genome sequencing data. The results showed that the whole-genome sequencing data of these two plants showed a diploid genotype, and both were consistent with the genotype of Chunyou 84 and were in a heterozygous state. These two plants were both apomictic clone plants, and the cloning efficiencies were 1.79% and 1.92% respectively (Table 1). In addition, the growth and development of these two cloned plants were consistent with those of the wild type.
[0069] Table 1 Genes for inducing haploids CPRO Statistics of the cloning seed efficiency of apomictic lines .
Claims
1. A rice apomixis system with a gene composition that induces plant apomixis, characterized in that, It consists of the promoter of the Arabidopsis thaliana egg cell-specific expression gene AtEC1.2, the MiMe system, and any one of the genes Arabidopsis thaliana AtCPRO1, Zea mays ZmCPRO3, ZmCPRO4, Glycine max GlCPRO2, Brassica napus BnaCPRO8 that induce apomixis in plants. The gene nucleotide sequences of Arabidopsis thaliana AtCPRO1, Zea mays ZmCPRO3, ZmCPRO4, Glycine max GlCPRO2, and Brassica napus BnaCPRO8 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 sequences respectively, and the nucleotide sequence of the promoter of AtEC1.2 is shown in SEQ ID NO.
6.
2. The method for producing cloned seeds in the apomixis system of rice using the gene for inducing apomixis in plants according to claim 1, characterized in that, It includes the following steps: Use the promoter of the Arabidopsis thaliana egg cell-specific expression gene AtEC1.2 to induce any one of the above-mentioned genes AtCPRO1, ZmCPRO3, ZmCPRO4, GlCPRO2, BnaCPRO8 and combine with the MiMe system to ectopically express in rice egg cells, induce rice parthenogenesis, and obtain rice diploid seeds; specifically includes the following steps: (1) Vector construction: First, design primers, and use the primers to clone the promoter of the gene AtEC1.2 and the gene AtCPRO1 from Arabidopsis thaliana respectively, clone the genes ZmCPRO3, ZmCPRO4 from Zea mays, clone the gene GlCPRO2 from Glycine max, and clone the gene BnaCPRO8 from Brassica napus; then digest the backbone vector pgg; finally, use the multi-fragment homologous recombination kit to construct a complete composite vector with the promoter of AtEC1.2 and any one of the genes AtCPRO1, ZmCPRO3, ZmCPRO4, GlCPRO2 or BnaCPRO8 to obtain the recombinant product; (2) Clone the recombinant product obtained above; (3) Genetic transformation: Transform the embryogenic callus prepared from rice seeds with the Agrobacterium tumefaciens containing the recombinant product, and obtain transgenic plants through culture; (4) Perform diploid identification on the seeds of the transgenic plants.
3. The method for producing cloned seeds in the apomixis system of rice using the gene for inducing apomixis in plants according to claim 2, characterized in that, The primers designed in the vector construction step are: AtEC1.2-R: tatTCTTTCTTTTTGGGG; AtEC1.2-F: aaacactgatagtttaagcatttgcgtttggtttatc; AtCPRO1-F: caaaaagaaagaataATGGAGAATTATCCAGAAACACAGTTTATTC; AtCPRO1-R: AATGTTTGAACGATCTCAAGCTACAAAATCATGTACCAATTGTG; ZmCPRO3-F: caaaaagaaagaataATGGCTACCTACTACTCGAGCC; ZmCPRO3-R: AATGTTTGAACGATCTCACGCCACAAAATCATGGAG; ZmCPRO4-F: caaaaagaaagaataATGGCCACATTCTTCTCCACTTC; ZmCPRO4-R: AATGTTTGAACGATCTCACGCCACAAAATCGTGC; GlCPRO2-F: caaaaagaaagaataATGGCAACTTACTATACGAGTTCAAG; GlCPRO2-R: AATGTTTGAACGATCTCATACTTCAAAATCATGTAGCATATGAGG; Bna CPRO8-F: caaaaagaaagaataATGGCGGTTTATTACCCAACTAGTG; Bna CPRO8-R: AATGTTTGAACGATCTTAGACAACAAAGTCGTGTAACTGATGG; NOS-R: tcccgccttcagtttGATCTAGTAACATAGATGACACCGC; NOS-F: GATCGTTCAAACATTTGGCAATAAAG.
4. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 3, characterized in that, When cloning its recombinant product, the recombinant product is transferred into competent cell DH5α for cloning.
5. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 4, characterized in that, During its genetic transformation, the genetic transformation method mediated by Agrobacterium strain EHA105 is used.
6. The method for producing cloned seeds in a rice apomixis system using the gene for inducing plant apomixis according to claim 5, characterized in that, The rice variety for transformation is the indica-japonica hybrid rice variety Chunyou 84.
7. The method for producing cloned seeds in the apomixis system of rice using the gene for inducing apomixis in plants according to claim 6, characterized in that, The method for diploid identification is: using flow cytometry to identify diploids.
8. Application of the apomictic rice system composed of the genes for inducing plant apomixis described in claim 1 and the genes for inducing plant apomixis described in any one of claims 2-7 in the method for producing cloned seeds in the apomictic rice system in the preparation of rice varieties.
Citation Information
Patent Citations
Method for inducing haploid and application thereof in plant breeding
CN114957422A
Method for inducing apomixis of plants
CN118240863A
Method for fixing rice heterosis by using apomixis system
CN118360328A
Method of C2H6 gene in induction of apomixis and application of C2H6 gene in plant breeding
CN118956944A
Method for inducing apomixis of plants and application
CN119020395A