Alkali-resistant application of soybean GmNPF7.13 gene

Abstract

The invention discloses an alkali-resistant application of a soybean GmNPF7.13 gene. The nucleotide sequence of the soybean GmNPF7.13 gene is as shown in SEQ ID NO. 1. The plant GmNPF7.13 gene silencing vector comprises a recombinant GmNPF7.13 gene silencing vector, the gene GmNPF7.13 segment is inserted into multiple cloning sites of a no-load VIGS-EV of the silencing vector, and GmNPF7.13 gene silencing is realized in a plant. According to the invention, two independent verification systems, including two mutants and a virus-induced GmNPF7.13 gene silencing material, both show enhanced alkali resistance and are strong in verification consistency. The GmNPF7.13 gene disclosed by the invention not only facilitates analysis of a response mechanism of soybeans to alkali stress, but also can be used as a target gene for creating alkali-resistant plants and expanding planting of the soybeans in soda saline-alkali soil, and has important theoretical significance and breeding application prospects.

Description

Technical Field

[0001] The invention belongs to the field of biological agriculture and relates to soybean GmNPF7.13 Alkali-resistant application of genes. Background Art

[0002] Soybean [Glycine max (L.) Merr.] is one of the most important food, oil and high-protein feed crops in the world.

[0003] Alkali stress is mainly caused by sodium bicarbonate (NaHCO3) and sodium carbonate (Na2CO3). Its hazards include not only high salt ion toxicity, but also high pH stress, which causes more serious interference to the plant rhizosphere environment, metabolic processes and cell homeostasis. Alkali stress seriously restricts the normal growth and development of soybeans in soda saline-alkali land by destroying ion balance, inhibiting physiological metabolism and inducing oxidative damage. It is an important obstacle to the sustainable development of the soybean industry. Therefore, it is urgent to explore key alkali-resistant genes from genetic resources, analyze their mechanisms of action, and promote the cultivation of new alkali-resistant varieties and the utilization of saline-alkali land resources.

[0004] In the study of genetic improvement of salt-alkali tolerance, some studies have identified and functionally verified genes involved in salt stress response. For example, it has been reported that genes such as GmSALT3 and GmNHX1 in soybean can regulate sodium ion excretion or vacuolar sequestration, thereby improving salt tolerance. However, compared with salt stress, high pH stress caused by alkaline stress is more complex and serious to plants, and related research is relatively lagging, especially the lack of functional genes for improving crop alkaline tolerance.

[0005] As a multifunctional transmembrane transporter, the NPF (NRT1 / PTR) family is widely involved in the transport of substrates such as nitrate, small peptides, and hormones, and plays a regulatory role in plant abiotic stress responses. It has been reported that OsNPF7.2 is involved in the regulation of nitrogen use efficiency in rice, AtNPF7.3 mediates nitrate trans-tissue transport in Arabidopsis and participates in the regulation of salt tolerance and drought resistance; GmNPF5.29 affects soybean nodule development, and GmNPF7.5 participates in the co-transport of nitrate and chloride ions. However, to date, there has been no report on the functional research or application of GmNPF7.13 in soybean in response to alkaline stress. Summary of the invention

[0006] The purpose of the present invention is to provide a soybean alkali resistance related gene to address the deficiencies of the above-mentioned prior art. GmNPF7.13 specific purpose.

[0007] The purpose of the present invention can be achieved through the following technical solutions: A soybean alkali tolerance-related gene GmNPF7.13, whose nucleotide sequence is shown in SEQ ID NO.1, with a total length of 1791 bases, and the start codon is ATG. The GmNPF7.13 is a member gene of the NPF family located on chromosome 1 of soybean.

[0008] The alkali-tolerant gene of soybean GmNPF7.13 encodes a protein, and the amino acid sequence of the protein is shown in SEQ ID NO.2, encoding 596 amino acids.

[0009] GmNPF7.13 The silencing vector of the gene, preferably at the recombination site of the virus-mediated gene silencing vector VIGS (Virus Induced Gene Silencing) empty vector (VIGS-EV, that is, pBPMV-IA-V2-R2), through restriction endonucleases BamH Ⅰ and Sal Ⅰ are double-digested, and the fragment of the gene shown in SEQ ID NO.7 is inserted. The obtained silencing vector is named VIGS - GmNPF7.13 . GmNPF7.13 .

[0010] To achieve the specific amplification of the above gene, the present invention also designs a pair of primers, which are suitable for GmNPF7.13 full-length PCR amplification and cloning. The upstream sequence of the primer pair is as shown in F1, and the downstream sequence is as shown in R1.

[0011] Upstream primer sequence (F1): 5'- TTCACCTCAATAAACAACCCTT -3' (SEQ ID NO.3) Downstream primer sequence (R1): 5'- GAGGCAGAAACTCGTGTAAGAA -3' (SEQ ID NO.4) This primer pair is suitable for experimental operations such as ordinary PCR, cDNA cloning or sequencing.

[0012] The above alkali-tolerant gene of soybean GmNPF7.13 , the above protein or the above recombinant silencing vector are used in the application of soybean in resisting alkali stress and in the cultivation of alkali-tolerant plants.

[0013] Beneficial effects:

[0014] 1. Clear alkali-tolerant function: GmNPF7.13 The open reading frame is 1791 bp in length and encodes 596 amino acids. Through the phenotypic analysis of soybean mutants and VIGS silencing materials, it is proved that knocking out or silencing GmNPF7.13 can significantly increase the relative water content and chlorophyll content of soybean, slow down leaf yellowing, and improve alkali tolerance.

[0015] 2. Sufficient evidence: The present invention has been verified by two independent verification systems, including two mutants ( gmnpf7.13-1, gmnpf7.13-2 , one of which is an amino acid missense mutation and the other terminates prematurely in exon 5), as well as viral-induced GmNPF7.13 The gene silencing materials all showed enhanced alkali resistance with strong verification consistency.

[0016] 3. Outstanding potential for breeding applications: GmNPF7.13 The gene not only helps to analyze the response mechanism of soybean to alkaline stress, but can also be used as a target gene to create alkali-tolerant plants and expand the cultivation of soybean in soda saline-alkali land. It has important theoretical significance and breeding application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Soybean mutant GmNPF7.13 The mutation position and amino acid changes of the gene. Two soybean mutants are shown in GmNPF7.13 The mutation sites in exon 3 and exon 5 of the gene, and the amino acid substitutions or premature translation termination caused by them.

[0018] Figure 2 GmNPF7.13 Gene mutation improves soybean alkali tolerance. a: Phenotypes of soybeans after normal culture and alkali treatment for 18 days, scale bar = 10 cm. b: relative water content (RWC) of leaves; c: chlorophyll content (SPAD).

[0019] Figure 3 VIGS- GmNPF7.13 Schematic diagram of the vector. Bam H Ⅰ and Sal Ⅰ is the restriction site, inserted between the double restriction sites GmNPF7.13 Silence fragment.

[0020] Figure 4 GmNPF7.13 Obtaining gene-silenced soybean plants. a: Gel electrophoresis after PCR amplification GmNPF7.13 M: DL 2000 bp marker; 1: ddH2O negative control; 2: soybean VIGS empty (VIGS-EV) plant (amplification product is 250 bp vector partial sequence); 3-5: soybean GmNPF7.13 Silence (VIGS- GmNPF7.13 ) plants (amplified product is 572 bp, i.e. 250 bp of vector sequence + silencing target gene GmNPF7.13 Fragment 322 bp). b: GmNPF7.13 Relative expression.

[0021] Figure 5 silence GmNPF7.13 Improving the alkali tolerance of soybean. a. Phenotypes after 8 days of normal culture or alkali treatment. VIGS-EV and VIGS- GmNPF7.13 Represents the empty control plants and GmNPF7.13 Silent plants, scale bar = 2.5 cm. b: Relative water content (RWC) of soybean leaves; c: Chlorophyll content (SPAD) of soybean leaves. DETAILED DESCRIPTION

[0022] Example 1 Soybean GmNPF7.13 Gene cloning The experimental material is the alkali-resistant soybean variety M8206, provided by the National Soybean Improvement Center of Nanjing Agricultural University. GmNPF7.13 The corresponding gene ID ( Glyma.01G200100 ), design specific primers, and clone GmNPF7.13 The full-length sequence of gene cDNA. The specific method is as follows: soybean root tips were taken, ground in liquid nitrogen, and RNA was extracted using a plant RNA rapid extraction kit (Kangwei Century, CW0598S). HiScript® ⅡQ RT SuperMix for qPCR reverse transcription kit (Vazyme, R223) was used for two-step reverse transcription, and the obtained cDNA fragment was used as a template, and PCR amplification was performed using primer pair F1: 5'- TTCACCTCAATAAACAACCCTT -3' (SEQ ID NO.3), R1: 5'-GAGGCAGAAACTCGTGTAAGAA -3' (SEQ ID NO.4). The following PCR reaction system (50 μl) was prepared on ice, 2 μl cDNA, 2 μl upstream and downstream primers, 25 μl 2× Super Kfx Master Mix, and ultrapure water was used to make up to 50 μl. After mixing all components, PCR amplification was performed. Reaction conditions: 98 ℃ 3 min; 35 cycles of 98 ℃ 30s, 58 ℃ 30s, 72 ℃ 1 min; 72 ℃ 5 min. The PCR product was recovered and sequenced, and then sequence analysis was performed. The results showed that the open reading frame sequence of the gene was shown in SEQ ID NO.1, with a total length of 1791 bp, encoding 596 amino acids shown in SEQ ID NO.2.

[0023] Example 2 Soybean mutants gmnpf7.13 Acquisition Through the isoybean website created by Professor Song Qingxin's team at Nanjing Agricultural University ( https: / / isoybean.org), search for and obtain EMS soybean mutants. Select two mutants, NJAU0395 ( GmNPF7.13 ), which have mutations at the gmnpf7.13- gene locus, and NJAU0217 ( gmnpf7.13- ). Among them, gmnpf7.13- in the genome of GmNPF7.13 , there is a point mutation (C to T) in the GmNPF7.13 gene, resulting in the mutation of threonine (Thr) to isoleucine (Iie) in the third exon, gmnpf7.13- and in the genome of GmNPF7.13 , there is also a point mutation (C to T) in the GmNPF7.13 gene, leading to premature termination in the fifth exon.

[0024] Example 3 Enhanced alkali tolerance of soybean mutants gmnpf7.13 (1) Alkali stress treatment: The sowing and cultivation conditions of soybeans were the same as in Example 2. When the gmnpf7.13 -1 and gmnpf7.13 -2 mutants and the control Williams 82 were sown until the first trifoliolate leaf pair was just emerging (about 14 days), the control group was watered normally, and the treatment group was treated with an equal amount of 90 mmol / L NaHCO3:Na2CO3 (9:1), pH = 9.0 aqueous solution for alkali stress treatment.

[0025] (2) Measurement of relative water content (RWC) of leaves: Take leaves from the same part of each pot of plants and measure the fresh weight (FW). Subsequently, immerse the leaves in water for 24 h, blot the surface moisture with filter paper, and measure the turgid weight (TW). Finally, dry the leaves in an 80 °C oven for one week to measure the dry weight (DW). Calculate the relative water content of the leaves according to the formula . The experiment was set up with 3 replicates, and 15 seedlings were treated in each replicate.

[0026] (3) Measurement of chlorophyll (Soil and Plant Analyzer Development, SPAD) content in leaves: Use a chlorophyll meter (SPAD-502, Konica Minolta, Japan) to measure the SPAD value of the middle leaf of the upper, middle, and lower trifoliolate leaves of each seedling, and take the average value. The experiment was set up with 3 replicates, and 15 seedlings were treated in each replicate.

[0027] (4) Result analysis: As can be seen from Figure 2 , under the cultivation conditions of normal watering, the control Williams 82 and soybean mutant plants​gmnpf7.13 -1 and gmnpf7.13- 2 grew well and were relatively consistent; under alkaline stress, the leaves of all materials turned yellow and the plants became shorter ( Figure 2 a in). Under control culture conditions, there were no significant differences in the relative water content and chlorophyll content between the mutants and the control. However, after alkaline stress, the relative water content and chlorophyll content of the leaves of all materials decreased significantly. But for soybean mutants gmnpf7.13 -1 and gmnpf7.13- 2, the relative water content and chlorophyll content of the leaves were significantly higher than those of the control Williams 82 ( Figure 2 b and c in). The results showed that GmNPF7.13 the mutation of the gene enhanced the alkali tolerance of soybeans.

[0028] Example 4 Silencing GmNPF7.13 gene to enhance the alkali tolerance of soybeans Using the BPMV-mediated virus-induced gene silencing (VIGS) system to silence GmNPF7.13 , this system includes the helper plasmid pBPMV-IA-R1M and the silencing vector pBPMV-IA-V2-R2. According to the prediction results of the SGN VIGS website (https: / / vigs.solgenomics.net / ), a 322bp coding region near the 3' end of the GmNPF7.13 gene was selected as the GmNPF7.13 gene silencing fragment. Using BioEdit to design one-step cloning primers F2: 5'- gaatcctctgcatgaggatccCCATTTTGCACATGCAATATAAGC -3' (SEQ IDNO.5), R2: 5'-ctctcgaggcctggagtcgacAAGCATCTTCTGGCAAATCCC -3' (SEQ ID NO.6) for GmNPF7.13 , and using the cDNA of GmNPF7.13 in the soybean variety Meng 8206 as a template for PCR amplification. The PCR amplification system and procedure were the same as in Example 1. The amplified product was inserted into the vector VIGS-EV (i.e., pBPMV-IA-V2-R2) through the restriction enzyme sites BamH Ⅰ and Sal Ⅰ to construct the GmNPF7.13 gene silencing vector VIGS– GmNPF7.13 , as shown in Figure 3 . After verifying the correct positive clone by sequencing, the bacterial solution with the correct band was selected for preserving bacteria.

[0029] Extract the recombinant target gene silencing vector VIGS- GmNPF7.13Plasmid, empty VIGS-EV plasmid of the silencing vector, and auxiliary plasmid pBPMV-IA-R1M. Concentrating the plasmid concentration at 800 - 1000 ng / µl is beneficial for successful infection. Select the soybean material Nannong 1138-2. After germinating for 5 days until the true leaves are fully expanded, conduct a one-day dark treatment, and then prepare for infection. Take out the dark-treated soybean plants, drop 20 µl of the mixed solution of the auxiliary plasmid pBPMV-R1M and the silencing vector plasmid at the same concentration (1:1) on the true leaves, smear the leaves with silicon carbide powder by rubbing, and then spray water to keep them moist. About two to three weeks after infection, observe whether the upper leaves are diseased. If the soybean leaves show symptoms of bean pod mottle virus, it is considered a successful infection. Collect the young leaf samples of the infected and diseased plants, perform RNA extraction, PCR amplification, and sequencing to verify the target gene, and detect the GmNPF7.13 gene silencing efficiency; continuously collect the young leaf samples of the diseased plants and the leaf samples of the empty vector plants during this period.

[0030] (1) Alkaline stress treatment: Conduct the infection experiment on Williams 82 soybeans about 5 days after germination. Put the young leaves of the collected diseased plants and the leaves of the empty vector plants into a mortar, add an appropriate amount of PBS buffer and silicon carbide powder, and grind them into a homogenate. Use a paintbrush to evenly smear the homogenate on the true leaves, slowly smear from top to bottom along the leaf veins, and repeat 3 times to make them fully infected. The culture conditions are the same as in Example 2. One week after infection, group the soybean plants showing symptoms of bean pod mottle virus and the empty vector into a control group and a treatment group. Add an aqueous solution of 90 mmol / L NaHCO3:Na2CO3 (9:1), pH = 9.0 to the treatment group, and add an equal amount of aqueous solution to the control group. After about 8 days of treatment, observe and record the phenotypic differences between the treatment group and the control group.

[0031] (2) The determination of relative water content (RWC) and chlorophyll content (SPAD) of the leaves is the same as in Example 3.

[0032] (3) Result analysis: If the soybean leaves show symptoms of bean pod mottle virus two to three weeks after infecting the soybean leaves, it may be a successful infection. After extracting the RNA from the diseased leaves, reverse transcription and PCR amplification are carried out, and then GmNPF7.13 the gene silencing plant fragments are verified by gel electrophoresis. The results are as Figure 4 shown in a of GmNPF7.13 The amplified fragment size of the VIGS- GmNPF7.13 plants is 572 bp (vector fragment sequence 250 bp + silencing fragment 322 bp). After sequence alignment verification, the amplified fragment in the VIGS- GmNPF7.13 plants is exactly the same as the silencing target gene GmNPF7.13 fragment, and its corresponding sequence is shown in SEQ ID NO.7. After silencing, then select GmNPF7.13Fluorescence quantitative detection was performed on the leaves with correct sequencing of the gene-silenced plants, and the results showed that GmNPF7.13 the gene expression level was only 21.7% of that of the control plants ( Figure 4 in b), indicating that GmNPF7.13 gene-silenced lines were obtained.

[0033] After 8 days of alkali stress treatment, the phenotypes of plants containing empty vectors (VIGS-EV) and GmNPF7.13 silenced plants (VIGS- GmNPF7.13 ) were recorded and relevant physiological indexes were measured to explore GmNPF7.13 the effect of gene silencing on the alkali tolerance of soybeans. It can be observed that under the alkali stress treatment of 90 mmol / L NaHCO3:Na2CO3 (9:1), GmNPF7.13 the phenotype of the silenced plants was significantly better than that of the empty vector group: the leaves of the empty vector plants were severely yellowed, while GmNPF7.13 the degree of leaf yellowing of the silenced plants was significantly reduced ( Figure 5 in a). Further analysis of physiological indexes showed that under control conditions, GmNPF7.13 there was no significant difference in the relative water content of the leaves ( Figure 5 in b) and chlorophyll content ( Figure 5 in c) between the silenced plants and the empty vector plants. However, under alkali stress conditions, GmNPF7.13 the relative water content and chlorophyll content of the silenced plants were significantly higher than those of the empty vector, indicating that silencing GmNPF7.13 enhanced the alkali tolerance of soybeans.

Claims

1. Soybean GmNPF7.13 A silencing vector for a gene, characterized in that The silencing vector is obtained by inserting the fragment of the GmNPF7.13 gene into the multiple cloning site of the VIGS-EV plasmid.

2. Application of genes related to alkali tolerance in soybean GmNPF7.13 The application in improving alkali tolerance of soybean is characterized in that Soybean alkali tolerance-related gene GmNPF7.13 The nucleotide sequence is as shown in SEQ ID NO.1, and inhibiting the gene GmNPF7.13 expression can improve the alkali tolerance of soybeans.

3. The application according to claim 2, wherein The applications described above include the creation of alkali-tolerant soybean germplasms and stress-resistant soybean breeding.

4. Application of the silencing vector described in claim 1 in improving the alkali tolerance of soybeans.

5. The application according to claim 4, wherein The applications described above include the creation of alkali-tolerant soybean germplasms and stress-resistant soybean breeding.

Images