Primer probe combination, kit and method for detecting salmonella enteritidis

Abstract

The invention provides a primer probe combination, a kit and a method for detecting salmonella enteritidis, and belongs to the technical field of rapid detection of pathogenic microorganisms. A series of primer probes are designed aiming at the Prot6e gene of the salmonella enteritidis, a primer probe combination with the best amplification effect is screened from the primer probes, and the salmonella enteritidis is detected by utilizing the primer probe combination and adopting a fluorescent RAA method. The detection efficiency, sensitivity (the lowest detection limit is 1.5 * 10 <-1 > pg / mu L) and accuracy of the detection method are all higher than those of common PCR, and rapid specific detection of salmonella enteritidis can be achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of rapid detection of pathogenic microorganisms, and particularly relates to a primer-probe combination, a kit and a method for detecting Salmonella enteritidis. Background Art

[0002] Salmonella enteritidis is an important pathogen of poultry, which has been isolated from broiler chickens, breeding chickens and commercial laying hen flocks. It is one of the invasive pathogens without host specificity, and its hosts include humans and various animals. This bacterium can not only cause livestock morbidity and death, resulting in serious economic losses, but also the contaminated livestock products, as carriers of Salmonella enteritidis, seriously endanger human health. This kind of bacterium mainly causes poisoning and even death through animal-derived food sources, mainly including meat, eggs, milk and related products.

[0003] Salmonella enteritidis is an important threat to human food safety and poultry farming. The existing methods for identifying Salmonella enteritidis mainly include bacterial isolation and culture method, serological test method, PCR detection method and biochemical test method. Currently, the most commonly used diagnostic method in chicken farms is the serological test method (plate agglutination test). This method is simple and easy to operate, with a short reaction time, but it requires collecting blood samples, which will cause physical harm to the chicken flock. Although the traditional bacterial isolation method is the gold standard, it is time-consuming and laborious, and it takes about 5 days to complete the isolation, culture and serotype identification. There are limitations in the detection specificity and sensitivity; the biochemical test method has the advantages of simple operation and low cost, but it also has the disadvantages of long time consumption and limited sensitivity, and the tissue samples such as heart and liver that need to be collected are not easy to collect; the PCR detection method has a short detection time and high sensitivity, but it requires cumbersome thermal control equipment and trained staff, and is prone to aerosol contamination.

[0004] Recombinase Aided Amplification (RAA) is a newly emerging isothermal nucleic acid amplification technology that uses recombinase, single-stranded binding protein and DNA polymerase for nucleic acid amplification. It does not require specific thermal cycling equipment. Compared with the dependence on thermal cycling of traditional nucleic acid amplification technologies, the breakthrough progress of this technology has significantly improved the convenience of nucleic acid in vitro amplification. Based on the optimized design of specific primers and probes, the rapid detection of pathogenic microorganisms can be efficiently realized. Therefore, there is an urgent need to establish a rapid and specific method for detecting Salmonella enteritidis primers and probes, which can provide a scientific basis and technical support for fields such as food safety, clinical diagnosis, and animal disease prevention and control. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a primer-probe combination, a kit and a method for detecting Salmonella enteritidis.

[0006] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0007] The present invention provides a primer-probe combination for detecting Salmonella enteritidis, and the primer-probe combination includes an upstream primer, a downstream primer, and a probe;

[0008] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3;

[0009] The nucleotide sequence of the downstream primer is as shown in SEQ ID NO.5;

[0010] The nucleotide sequence of the probe is as shown in SEQ ID NO.7.

[0011] Preferably, the probe is modified, and the modification includes: labeling the 31st nucleotide T in the nucleotide sequence as shown in SEQ ID NO.7 with the fluorophore hexachlorofluorescein, labeling the 33rd nucleotide T in the nucleotide sequence as shown in SEQ ID NO.7 with the fluorescence quenching group BHQ1, modifying between the 31st nucleotide T and the 32nd nucleotide G in the nucleotide sequence as shown in SEQ ID NO.7 with the non-base spacer idsp, and modifying the 48th nucleotide A in the nucleotide sequence as shown in SEQ ID NO.7 with C3-spacer.

[0012] The present invention also provides a reagent for detecting Salmonella enteritidis, including the primer-probe combination.

[0013] The present invention also provides a kit for detecting Salmonella enteritidis, including the primer-probe combination.

[0014] The present invention also provides the application of the primer-probe combination, the reagent, and the kit in detecting Salmonella enteritidis.

[0015] The present invention also provides a method for detecting Salmonella enteritidis for non-diagnostic purposes, including the following steps:

[0016] 1) Mix the primer-probe combination, buffer VI, and water to prepare a reaction system. First, add magnesium acetate I to the reaction system, and then add the test sample and the negative control product respectively, and perform pre-amplification;

[0017] 2) Perform fluorescence detection after the pre-amplification is completed;

[0018] 3) When the amplification curve of the test sample exceeds the threshold of the negative control product and shows an exponential growth characteristic, it can be determined that Salmonella enteritidis exists in the test sample.

[0019] Preferably, the negative control product in step 1) is nuclease-free water.

[0020] Preferably, the total volume of the reaction system in step 1) is 40 - 60 μL, and the volume ratio of the primer-probe combination to buffer VI in the reaction system is 2.2 - 3.2:20 - 30;

[0021] In the primer-probe combination, the volume ratio of the primer to the probe is 1.8 - 2.4:0.4 - 0.8.

[0022] Preferably, the temperature for fluorescence detection in step 2) is 37 - 42 °C, and the time for fluorescence detection is 15 - 25 min.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention designs a series of primer-probes for the Prot6e gene of Salmonella enteritidis, and screens out the primer-probe combination with the best amplification effect from them. Using this primer-probe combination, the fluorescence RAA method is used to detect Salmonella enteritidis. The detection efficiency, sensitivity (the lowest detection limit is 1.5×10 -1 pg / μL), and accuracy of the detection method of the present invention are all higher than those of ordinary PCR, and can achieve rapid and specific detection of Salmonella enteritidis.

[0025] The detection method of the present invention has high detection efficiency. The fluorescence RAA detection time is two hours faster than that of ordinary PCR, greatly shortening the diagnostic cycle. Moreover, the fluorescence RAA detection time omits the step of agarose gel electrophoresis, thus greatly simplifying the experimental operation process and reducing the operation burden and time cost of experimental personnel.

[0026] The detection method of the present invention has high sensitivity. The fluorescence RAA method has higher sensitivity compared with the colloidal gold immunochromatographic strip on-site detection technology. Although the strip detection is simple to operate, due to relying on visual observation of results, its sensitivity is relatively low and may not meet the requirements of high-precision detection.

[0027] The detection method of the present invention has high accuracy. The fluorescence RAA method has higher accuracy compared with the LAMP technology (loop-mediated isothermal amplification technology). The LAMP technology needs to use multiple primers to react under constant temperature conditions, and the risk of non-specific amplification increases accordingly, which may lead to the appearance of false positive results, thereby affecting the accuracy and reliability of detection.

[0028] The detection method of the present invention has low cost and wide application. The fluorescence RAA method has lower cost and wider application scenarios compared with the qPCR technology. Although the qPCR method has high sensitivity and specificity, it depends on expensive instrument equipment and harsh experimental conditions. In contrast, the fluorescence RAA detection method is more suitable for income diagnostic laboratories with scarce resources and farms in marginal areas. Description of the Drawings

[0029] Figure 1 is the screening result diagram of 9 pairs of fluorescent RAA primers Prot6e;

[0030] Figure 2 is the negative control result diagram of 9 pairs of fluorescent RAA primers Prot6e;

[0031] Figure 3 is the experimental result diagram of the fluorescence RAA specificity of Salmonella enteritidis (1: Salmonella enteritidis, 2 - 10: Salmonella pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella indiana, Staphylococcus aureus, Campylobacter coli, Bacillus cereus, Staphylococcus epidermidis, Escherichia coli as negative controls);

[0032] Figure 4 is the experimental result diagram of the fluorescence RAA sensitivity of Salmonella enteritidis (1 - 10: 1.5×10 3 、1.5×10 2 、1.5×10 1 、1.5×10 0 、1.5×10 -1 、1.5×10 -2 、1.5×10 -3 、1.5×10 -4 、1.5×10 -5 、1.5×10 -6 pg / μL, negative control);

[0033] Figure 5 is the experimental result diagram of the specificity and sensitivity of the common PCR of Salmonella enteritidis (the left figure is the specificity result diagram, where 1: Salmonella enteritidis, 2 - 10: Salmonella pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella indiana, Staphylococcus aureus, Campylobacter coli, Bacillus cereus, Staphylococcus epidermidis, Escherichia coli as negative controls; the right figure is the sensitivity result diagram, where 1 - 10: 1.5×10 3 、1.5×10 2 、1.5×10 1 、1.5×10 0 、1.5×10 -1 、1.5×10 -2 、1.5×10 -3 、1.5×10 -4 、1.5×10 -5 、1.5×10 -6 pg / μL, negative control);

[0034] Figure 6 is the detection result of the fluorescence RAA of Salmonella enteritidis in the clinical samples of Broiler Farm 1;

[0035] Figure 7 It is the detection result of clinical samples of Salmonella enteritidis by fluorescence RAA in broiler farm 2;

[0036] Figure 8 It is the detection result of clinical samples of Salmonella enteritidis by fluorescence RAA in broiler farm 3;

[0037] Figure 9 It is the detection result of clinical samples of Salmonella enteritidis by fluorescence RAA in broiler farm 4;

[0038] Figure 10 It is the detection result of clinical samples of Salmonella enteritidis by fluorescence RAA in broiler farm 5;

[0039] Figure 11 It is the detection result of clinical samples of Salmonella enteritidis by fluorescence RAA in broiler farm 6;

[0040] Figure 12 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 1;

[0041] Figure 13 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 2;

[0042] Figure 14 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 3;

[0043] Figure 15 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 4;

[0044] Figure 16 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 5;

[0045] Figure 17 It is the detection result of clinical samples of Salmonella enteritidis by the national standard (GB 4789.4-2016) in broiler farm 6. Detailed implementation manners

[0046] The present invention provides a primer-probe combination for detecting Salmonella enteritidis, and the primer-probe combination includes an upstream primer, a downstream primer and a probe;

[0047] The nucleotide sequence of the upstream primer is as shown in SEQ ID NO.3, specifically AATCAGGATGGCTCATGGAATGTTGTGAC;

[0048] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.5, specifically TGGTTCAAACCTCGCCCTCACATTCATAAA;

[0049] The nucleotide sequence of the probe is shown in SEQ ID NO.7, specifically TGGTGACCCCCATCTCAAAAATCTATAAGCTGTGTACGGCGATTTCTA.

[0050] In the present invention, the probe is modified, and the modification includes: labeling the 31st nucleotide T in the nucleotide sequence shown in SEQ ID NO.7 with the fluorescent group hexachlorofluorescein (i6HEXdT), labeling the 33rd nucleotide T in the nucleotide sequence shown in SEQ ID NO.7 with the fluorescence quenching group BHQ1 (IBHQ1DT), modifying with a non-base spacer idsp between the 31st nucleotide T and the 32nd nucleotide G in the nucleotide sequence shown in SEQ ID NO.7, and modifying the 48th nucleotide A (3'-terminal nucleotide) in the nucleotide sequence shown in SEQ ID NO.7 with C3-spacer. The nucleotide sequence of the modified probe is: TGGTGACCCCCATCTCAAAAATCTATAAGC / i6HEXdT / idsp / G / iBHQ1dT / GTACGGCGATTTCTA-3’C3Spacer.

[0051] The present invention also provides a reagent for detecting Salmonella enteritidis, comprising the primer-probe combination described above.

[0052] The present invention also provides a kit for detecting Salmonella enteritidis, comprising the primer-probe combination described above.

[0053] The present invention also provides the application of the primer-probe combination, the reagent, and the kit in detecting Salmonella enteritidis.

[0054] The present invention also provides a method for detecting Salmonella enteritidis for non-diagnostic purposes, comprising the following steps:

[0055] 1) Mix the primer-probe combination, buffer VI, and water to prepare a reaction system. First add magnesium acetate I to the reaction system, and then add the test sample and the negative control product respectively for pre-amplification;

[0056] 2) Perform fluorescence detection after pre-amplification;

[0057] 3) When the amplification curve of the test sample exceeds the threshold of the negative control product and shows an exponential growth characteristic, it can be determined that Salmonella enteritidis exists in the test sample.

[0058] In the present invention, the negative control product is nuclease-free water; the total volume of the reaction system is preferably 40 - 60 μL, more preferably 45 - 55 μL; the volume ratio of the primer-probe combination to buffer VI in the reaction system is preferably 2.2 - 3.2:20 - 30, more preferably 2.5 - 2.9:22 - 28; the volume ratio of the primer to the probe in the primer-probe combination is preferably 1.8 - 2.4:0.4 - 0.8, more preferably 2.0 - 2.2:0.5 - 0.7. The temperature for fluorescence detection is preferably 37 - 42 °C, more preferably 38 - 41 °C; the time for fluorescence detection is preferably 15 - 25 min, more preferably 18 - 22 min.

[0059] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0060] Example 1

[0061] 1. Experimental strains

[0062] The experimental strains Salmonella enteritidis, Salmonella pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella indiana, Staphylococcus aureus, Campylobacter coli, Bacillus cereus, Staphylococcus epidermidis, Escherichia coli are all provided by the Pathogenic Hygiene Monitoring Laboratory of the China Animal Health Epidemiology Center, as shown in Table 1 for details.

[0063] Table 1 Experimental strains for the fluorescence RAA method of Salmonella enteritidis

[0064]

[0065]

[0066] Note: ATCC (American Type Culture Collection).

[0067] 2. Design and screening of RAA primers and probes

[0068] The genome of Salmonella enteritidis contains a unique 60-kb virulence plasmid, which contains the Prot6e gene. The Prot6e gene may be related to the encoding of the specific surface flagella in Salmonella enteritidis and is often used as a molecular marker for Salmonella enteritidis. Therefore, a simple, specific real-time fluorescence RAA method for Salmonella enteritidis targeting the Prot6e gene was established.

[0069] According to the nucleotide sequence of the Prot6e gene of Salmonella enteritidis (accession number U66901.1), the nucleic acid of the standard strain Salmonella enteritidis ATCC13076 was extracted as the DNA template for the primer screening reaction. Three pairs of specific primers (Table 2) were designed respectively, and a fluorescent probe was designed between the upstream and downstream primers. The three pairs of upstream and downstream primers were combined pairwise to screen the optimal primers.

[0070] Table 2 Primers and probes used in the experiment

[0071]

[0072] 3. Preparation of DNA template

[0073] The boiling method was used to extract different genomic DNAs of bacteria. The strains in Table 1 were purified and cultured. An appropriate amount of colonies was transferred to 1 mL of sterile ultrapure water. After vortex mixing, it was centrifuged at 12000 rpm for 5 min to remove the supernatant. Subsequently, 500 μL of sterile ultrapure water was added to resuspend. The mixture was placed in a 100 °C metal bath for 10 min, and then quickly transferred to an ice bath to cool for 10 min. It was centrifuged again at 12000 rpm for 10 min. 200 μL of the supernatant was taken as the DNA template. At the same time, the standard strain of Escherichia coli (ATCC 25922) and the standard strain of Salmonella enteritidis (ATCC 13076) were selected as the negative and positive controls respectively.

[0074] 4. Real-time fluorescence RAA detection

[0075] The RAA nucleic acid amplification kit (fluorescence method) was used for detection, and a 50 μL reaction system was prepared. This system consisted of 25 μL of buffer VI, 2.1 μL of specific primer pairs, 0.6 μL of probe P, and 15.2 μL of deionized water. After preparation, it was shaken and mixed evenly and centrifuged briefly. Subsequently, 5 μL of magnesium acetate I was added to the inner wall of the tube cap of each reaction unit, and 1 μL of the sample to be tested and the negative quality control product (nuclease-free water) were added respectively. The prepared reaction tube was transferred to a preheated RAA-B6108 sample pretreatment system for pre-amplification. After pre-amplification, the reaction tube was placed in an RAA-F1620 constant temperature nucleic acid amplification detector, and the reaction parameters were set at 39 °C for 20 min. By real-time monitoring of the fluorescence signal, when the amplification curve of the sample exceeded the threshold of the negative quality control product based on nuclease-free water and showed an exponential growth characteristic, it could be determined as a positive result.

[0076] Experimental results: As Figure 1 and Figure 2As shown in the figure. Nine pairs of fluorescent RAA primers for Salmonella enteritidis Prot6e (F1\R1, F1\R2, F1\R3, F2\R1, F2\R2, F2\R3, F3\R1, F3\R2, F3\R3) designed and synthesized were subjected to fluorescent RAA amplification. After amplification, the results showed that the fluorescence curve of the primer pair Prot6eF3 / Prot6eR2 was the best.

[0077] 5. Specificity detection

[0078] To evaluate the specificity of the real-time fluorescent RAA method for Salmonella enteritidis, common bacteria in broilers were detected, including Salmonella enteritidis, Salmonella pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella indiana, Staphylococcus aureus, Campylobacter coli, Bacillus cereus, Staphylococcus epidermidis, and Escherichia coli. Nuclease-free water was used as a negative control, and a specificity detection experiment was carried out according to the fluorescent RAA method established in step 4.

[0079] Experimental results: As Figure 3 shown. The results showed good specificity.

[0080] 6. Sensitivity detection

[0081] To evaluate the sensitivity of the real-time fluorescent RAA method for Salmonella enteritidis, the nucleic acid concentration of Salmonella enteritidis was determined to be 1.5×10 3 pg / μL using an ultra-micro ultraviolet-visible spectrophotometer. The nucleic acid concentration of Salmonella enteritidis was diluted 10-fold into 10 concentrations with sterile normal saline, namely 1.5×10 3 、1.5×10 2 、1.5×10 1 、1.5×10 0 、1.5×10 -1 、1.5×10 -2 、1.5×10 -3 、1.5×10 -4 、1.5×10 -5 、1.5×10 -6 and 1.5×10 -6 pg / μL. Nuclease-free water was used as a negative control, and a specificity experiment was carried out according to the fluorescent RAA method established in step 4.

[0082] Experimental results: As Figure 4 shown. The results showed that the lowest detection limit was 1.5×10 -1 pg / μL.

[0083] 7. Method comparison experiment

[0084] To illustrate the sensitivity and specificity of the fluorescence RAA method established for this invention, Salmonella enteritidis, Salmonella pullorum, Salmonella typhimurium, Salmonella kentucky, Salmonella indiana, Staphylococcus aureus, Campylobacter coli, Bacillus cereus, Staphylococcus epidermidis and Escherichia coli were used, with nuclease-free water as the negative control. A PCR detection comparison test was carried out with reference to the Salmonella enteritidis PCR method established by Asma Afshari et al. (Asma Afshari, Ahmad Baratpour, Saeed Khanzade, et al. Salmonella Enteritidis and Salmonella Typhimorium identification in poultry carcasses.. Iranian Journal of Microbiology. 2018;10(1):45 - 50.).

[0085] Experimental results: As Figure 5 shown. The results of the ordinary PCR of Salmonella enteritidis showed consistency with the specificity and sensitivity of the real-time fluorescence RAA method, with the lowest detection limit being 1.5×10 -1 pg / μL.

[0086] 8. Detection of clinical samples

[0087] Samples were collected from 6 broiler farms, with 50 samples collected from each farm, for a total of 300 samples. Salmonella isolation and culture identification were carried out with reference to the national food safety standard method for Salmonella inspection (GB 4789.4 - 2016), and at the same time, real-time fluorescence RAA detection of Salmonella enteritidis was carried out.

[0088] Experimental results: As shown in Table 3 and Figures 6 to 17 shown.

[0089] Table 3 Detection results of clinical samples

[0090]

[0091]

[0092] The results showed that the positive detection rate of the fluorescence RAA method for Salmonella enteritidis was 5.67% (17 / 300), slightly lower than the positive detection rate of 6.00% (18 / 300) of the Salmonella enteritidis detection method in the national standard (GB 4789.4 - 2016) (P﹥0.05).

[0093] A series of primer-probe pairs were designed for the Prot6e gene of Salmonella enteritidis, and the primer-probe pair with the best amplification effect was screened therefrom. Using this primer-probe pair, Salmonella enteritidis was detected by the fluorescence RAA method. The detection efficiency, sensitivity (the lowest detection limit is 1.5×10 -1 pg / μL), and accuracy of the detection method of the present invention are all higher than those of ordinary PCR, and rapid and specific detection of Salmonella enteritidis can be achieved.

[0094] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting Salmonella enteritidis, characterized in that, The primer-probe combination includes an upstream primer, a downstream primer, and a probe; The nucleotide sequence of the upstream primer is shown in SEQ ID NO.3; The nucleotide sequence of the downstream primer is shown in SEQ ID NO.5; The nucleotide sequence of the probe is shown in SEQ ID NO.

7.

2. The primer-probe combination according to claim 1, wherein The probe is modified, and the modification includes: labeling the 31st nucleotide T in the nucleotide sequence shown in SEQ ID NO.7 with the fluorophore hexachlorofluorescein, labeling the 33rd nucleotide T in the nucleotide sequence shown in SEQ ID NO.7 with the fluorescence quenching group BHQ1, modifying between the 31st nucleotide T and the 32nd nucleotide G in the nucleotide sequence shown in SEQ ID NO.7 with the abasic spacer idsp, and modifying the 48th nucleotide A in the nucleotide sequence shown in SEQ ID NO.7 with C3-spacer.

3. A reagent for detecting Salmonella enteritidis, characterized in that, It includes the primer-probe combination described in claim 1 or 2.

4. A kit for detecting Salmonella enteritidis, characterized in that, It includes the primer-probe combination described in claim 1 or 2.

5. Use of the primer-probe combination described in claim 1 or 2, the reagent described in claim 3, and the kit described in claim 4 in detecting Salmonella enteritidis.

6. A method for detecting Salmonella enteritidis for non-diagnostic purposes, characterized in that, It includes the following steps: 1) Mix the primer-probe combination described in claim 1 or 2, buffer VI, and water to prepare a reaction system. First add magnesium acetate I to the reaction system, and then add the test sample and the negative control product respectively for pre-amplification; 2) Perform fluorescence detection after the pre-amplification is completed; 3) When the amplification curve of the test sample exceeds the threshold of the negative control product and shows an exponential growth characteristic, it can be determined that Salmonella enteritidis exists in the test sample.

7. The method according to claim 6, wherein The negative control product in step 1) is nuclease-free water.

8. The method according to claim 6, wherein The total volume of the reaction system in step 1) is 40 - 60 μL, and the volume ratio of the primer-probe combination to buffer VI in the reaction system is 2.2 - 3.2:20 - 30; The volume ratio of the primer to the probe in the primer-probe combination is 1.8 - 2.4:0.4 - 0.

8.

9. The method according to claim 6, characterized in that, The temperature of the fluorescence detection in step 2) is 37 - 42 °C, and the time of the fluorescence detection is 15 - 25 min.

Images