Molecular weight detection method of DNA tetrahedron or drug compound thereof

Abstract

The invention discloses a method for detecting the molecular weight of a DNA tetrahedron or a drug compound thereof. According to the method, a high performance liquid chromatography-mass spectrometry method is adopted for detection. According to the detection method provided by the invention, the accurate quality control of the DNA tetrahedron or the drug compound thereof in industrial development can be ensured, the safety, the curative effect and the consistency of the drug can be ensured, and more accurate guidance is provided for the drug treatment of the DNA tetrahedron.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a method for detecting the molecular weight of a DNA tetrahedron or its drug complex. Background Art

[0002] DNA tetrahedrons (Tetrahedral DNA Nanostructures, TDNs), also known as nucleic acid tetrahedrons, tetrahedral framework nucleic acids, tetrahedral DNA nanostructures, etc., are tetrahedral structures formed by 4 single-stranded DNAs through denaturation and renaturation and then through base complementary pairing between strands. It is easy to synthesize, has high biocompatibility, high safety, no cytotoxicity, low immunogenicity, and is stable in vivo. It is a drug carrier with good application prospects. For example, Patent CN112007044A discloses the use of TDNs-miR155 complex and its use in the preparation of drugs for preventing or treating wet age-related macular degeneration, and Patent CN112843085A discloses the use of TDNs-miR22 complex and its use in the preparation of drugs for treating optic nerve injury, etc.

[0003] The quality management of drugs is an important link to ensure the safety, effectiveness and quality control of drugs. In the "Technical Guidelines for Pharmaceutical Research and Evaluation of Gene Therapy Products" (Draft for Comment), regarding the quality research and quality control of gene drugs, it is proposed that the content of drug quality research should cover all characteristics that may be related to the safety and effectiveness of the product, including structure, identification, general physical and chemical properties, purity, etc. Among them, the confirmation of the molecular weight of drug molecules belongs to the key content in the verification of structure, purity, etc. The "Technical Guidelines for Pharmaceutical Research and Evaluation of In Vivo Gene Therapy Products (Trial)" stipulates that for nucleic acid products, if there are single / double strands, etc., the components should be identified and the proportion analyzed. The research on the analysis of complexes formed by nucleic acids and delivery materials includes the composition ratio of the complexes, etc.

[0004] It can be seen that in the industrial research and development of DNA tetrahedrons and their drug complexes, it is crucial to develop an analytical method that can quickly and efficiently confirm their molecular weights and verify the component ratios. However, due to the complex multi-stranded composition and framework structure of DNA tetrahedrons and their drug complexes, there is no existing technology for detecting the molecular weights of such nucleic acid molecules. For example, CN116429955A discloses an analytical method for the molecular weight of single-stranded nucleic acid drugs. This method uses multiple single-stranded nucleic acid reference standards with known molecular weights to establish a standard curve in GPC software, and then imports the chromatographic signals obtained after chromatographic analysis of the test solution into the GPC software to calculate the molecular weight of the test sample. CN116858953A discloses a method for determining the molecular weight of double-stranded nucleic acids. It uses gel chromatography to analyze the reference standard and the sample to be detected under the same chromatographic conditions, draws a standard curve based on the chromatographic results of the reference standard, and calculates the molecular weight of the sample to be detected according to the standard curve. The above methods can only be used for nucleic acid molecules with simple structures and are not applicable to DNA tetrahedrons and their drug complexes with a four-stranded framework structure. In addition, existing research has also reported using gel electrophoresis to determine the molecular weight of proteins or nucleic acids. Such detection methods have disadvantages such as cumbersome operation and inaccurate detection results, cannot meet the detection requirements of the industrial development of nucleic acid drugs, and EB (ethidium bromide) is usually used as a fluorescent dye in the experiment. EB is highly toxic and carcinogenic.

[0005] In view of the strict requirements for drug quality control and the research gap in the quality analysis methods of framework nucleic acids in the existing technology, therefore, developing a simple, efficient, and accurate method for detecting molecular weight is of great significance for the research and development, quality control, etc. of framework nucleic acids, especially for the development of DNA tetrahedrons and their drug compositions. Summary of the Invention

[0006] To solve the above problems, the present invention provides a method for detecting the molecular weight of a DNA tetrahedron or its drug complex, including: (1) determining the molar ratio and mass number of each single strand constituting the DNA tetrahedron or its drug complex; (2) determining the molecular weight of the DNA tetrahedron or its drug complex.

[0007] In certain specific embodiments, the determination of the molar ratio and mass number of each single strand in step (1) includes the following operating steps:

[0008] a. Preparation of the test sample and the mixed standard solution, wherein the test sample is prepared by adding water to the DNA tetrahedron or its drug complex, and the mixed standard is prepared by mixing the single-strand standards of the DNA tetrahedron or its drug complex in a molar ratio of 1:1:1:1 and adding water.

[0009] b. The test sample and the mixed standard solution are respectively determined by high performance liquid chromatography-mass spectrometry, and the high performance liquid chromatography-mass spectrometry includes the following chromatographic conditions and mass spectrometry conditions:

[0010] The chromatographic conditions include using Oligonucleotide BEH C18, 4.6 mm×50 mm, 2.5 μm as the chromatographic column; and a mixed mobile phase with an aqueous solution containing N,N-diisopropylethylamine and hexafluoroisopropanol as mobile phase A and a mixed solution of an aqueous solution containing N,N-diisopropylethylamine and hexafluoroisopropanol and acetonitrile as mobile phase B; and the gradient elution program is:

[0011]

[0012]

[0013] The mass spectrometry conditions are: the ion source is ESI; the mass spectrometry detection mode is the negative ion detection mode.

[0014] In some specific embodiments, mobile phase A is an aqueous solution containing 0.05% - 0.15% N,N-diisopropylethylamine and 0.5 - 1.5% hexafluoroisopropanol, preferably an aqueous solution containing 0.1% N,N-diisopropylethylamine and 1.0% hexafluoroisopropanol;

[0015] and / or: mobile phase B is a mixed solution of an aqueous solution containing 0.75% hexafluoroisopropanol and 0.0375% N,N-diisopropylethylamine and acetonitrile, and the volume ratio of the aqueous solution to the acetonitrile solution is 35:65.

[0016] In some specific embodiments, the chromatographic conditions further include: flow rate: 0.2 - 0.5 mL / min, preferably flow rate: 0.3 mL / min;

[0017] and / or: detection wavelength: 220 - 280 nm, preferably detection wavelength: 260 nm.

[0018] In some specific embodiments, the chromatographic conditions further include: column temperature: 25 - 40 °C, preferably column temperature: 30 °C;

[0019] and / or: injection volume is 10 - 25 μL, preferably injection volume is 18 - 20 μL, more preferably injection volume is 18 μL, 19 μL or 20 μL.

[0020] In some specific embodiments, the mass spectrometry conditions further include: capillary voltage 0.8 kv, cone voltage 40 v, collision voltage 80 v, source temperature 140 °C, desolvation temperature 400 °C, scan range 400 - 5000 m / z, cone flow rate 50 L / h, desolvation gas flow rate 800 L / h, scan rate 2 Hz.

[0021] In some specific embodiments, the molar ratio of each single strand of the DNA tetrahedron or its drug complex in step (1) is calculated by the following formula:

[0022]

[0023] Wherein the test sample and the mixed standard sample are used to calculate the molar ratio of each single strand with the same sample loading amount.

[0024] In some specific embodiments, the molecular weight of the DNA tetrahedron or its drug complex is calculated by the following formula:

[0025]

[0026] In some specific embodiments, the DNA tetrahedron drug complex is a complex of a DNA tetrahedron and a small nucleic acid drug or a small molecule chemical drug, preferably a complex of a DNA tetrahedron and a small nucleic acid drug.

[0027] In some specific embodiments, the small nucleic acid drug is selected from antisense oligonucleotides, siRNA, miRNA or aptamers, preferably siRNA or miRNA.

[0028] Single strand 1, single strand 2, single strand 3, and single strand 4 involved in the present invention respectively correspond to the single strands S1, S2, S3, and S4 of the DNA tetrahedron, or the single strands S1mR, S2, S3, and S4 of the DNA tetrahedron drug complex.

[0029] Beneficial effects:

[0030] In the process of research on the present invention, it was found that when the test sample DNA tetrahedron or its drug complex was directly injected for testing, the peak shape was messy, the impurities overlapped with the main peak and could not be separated, and the detection signal value was low, making it difficult to analyze the molecular weight of the test sample. Considering the particularity of the molecular composition of the DNA tetrahedron or its drug complex, the inventor developed a method for determining the molecular weight of its special composition structure under specific conditions. In addition, during the establishment of the standard curve, it was found that there was an interaction between the responses of the four single strands of the DNA tetrahedron or its drug complex. When each single strand standard was injected for testing separately, the standard curve drawn based on the results made the molecular weight result finally converted extremely inaccurate, with too large an error. On this basis, the inventor surprisingly found that by mixing the four single strand standards that make up them and injecting them for testing, establishing a standard curve, and then combining with the measured value of the sample to be tested, it was not only possible to quickly determine the molar ratio of each single strand in the DNA tetrahedron or its drug complex molecule, but also accurately determine the molecular weight of the sample to be tested.

[0031] The detection method provided by the present invention ensures that the DNA tetrahedron or its drug complex unwinds more completely and sufficiently, and also takes into account the influence of the interaction between the four single strands after unwinding on the test results, greatly increasing the accuracy of the test results, making the molar composition of each single strand of the DNA tetrahedron or its drug complex measured by this detection method and the measured molecular weight highly consistent with the theoretical values. Moreover, when increasing the injection volume of the sample to be tested, the test results are also highly consistent with the theoretical values.

[0032] The detection method provided by the present invention can ensure accurate quality control of the DNA tetrahedron or its drug complex in industrial development, contribute to ensuring the safety, efficacy and consistency of drugs, and provide more accurate guidance for DNA tetrahedron drug treatment.

[0033] Obviously, based on the above content of the present invention, according to the common general knowledge and conventional means in the art, without departing from the above basic technical idea of the present invention, various other forms of modification, substitution or change can be made.

[0034] The following is a further detailed description of the above content of the present invention through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Deconvolution mass spectrometry diagram of the initial conditions of the DNA tetrahedron

[0036] Figure 2 Deconvolution mass spectrometry diagram of Experimental Example 2 of the DNA tetrahedron

[0037] Figure 3 Deconvolution mass spectrum of DNA tetrahedron at column temperature of 40 °C

[0038] Figure 4 Deconvolution mass spectrum of DNA tetrahedron at cone voltage of 60 V

[0039] Figure 5 Deconvolution mass spectrum of DNA tetrahedron at cone voltage of 40 V

[0040] Figure 6 Deconvolution mass spectrum of DNA tetrahedron at desolvation temperature of 300 °C

[0041] Figure 7 Deconvolution mass spectrum of DNA tetrahedron at desolvation temperature of 200 °C

[0042] Figure 8 Deconvolution mass spectrum of DNA tetrahedron at desolvation temperature of 50 °C Detailed implementation mode

[0043] Example 1 Detection method for the molecular weight of DNA tetrahedron of the present invention

[0044] (1) Establishment of standard curves for four single strands of DNA tetrahedron

[0045] a. Preparation of mixed standard solution

[0046] Take the standard products of the four single strands in the DNA tetrahedron, mix them evenly at a molar ratio of 1:1:1:1, and then dilute them with enzyme-free water or distilled water to a series of concentrations, thus obtaining;

[0047] b. Respectively suck the mixed standard solutions with a series of concentrations and inject them into the high performance liquid chromatography-mass spectrometry (HPLC-MS) instrument to measure the peak intensity response values. Respectively use the concentrations or injection amounts of each single strand in the mixed standard solutions with a series of concentrations as the abscissa (X), and use the peak intensity response values of each single strand as the ordinate (Y) to plot the standard curves of the four single strands; The chromatographic conditions are:

[0048] Chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm);

[0049] Mobile phase: Mobile phase A: aqueous solution containing 1.0% HFIP and 0.1% DIPEA, Mobile phase B: aqueous solution containing 0.75% HFIP and 0.0375% DIPEA and acetonitrile, where the volume ratio of the aqueous solution to the acetonitrile solution is 35:65;

[0050] Flow rate: 0.3 mL / min, detection wavelength: 260 nm, column temperature: 30 °C, injection volume: 20 μL,

[0051] Gradient elution program is:

[0052] Time Mobile Phase A Mobile Phase B 0 90 10 2 90 10 10 0 100 16 0 100 16.1 90 10 20 90 10

[0053] The mass spectrometry conditions are as follows: the ion source is ESI; the mass spectrometry detection mode is the negative ion detection mode;

[0054]

[0055]

[0056] (2) Determination of the molar ratio and molecular weight of each single strand constituting the DNA tetrahedron

[0057] c. Preparation of the test solution

[0058] Take the DNA tetrahedron, mix it evenly with enzyme-free water or distilled water to obtain the test solution;

[0059] d. Aspirate the test solution and inject it into the high performance liquid chromatography-mass spectrometry (HPLC-MS) instrument, and detect it under the same conditions as in step b to obtain the deconvolution mass spectrum and response value of the test solution. The molar ratio of each single strand of the DNA tetrahedron is obtained according to the following calculation formula:

[0060]

[0061] Note: The molar ratio of each single strand is calculated for the test solution and the mixed standard under the same sample loading amount.

[0062] The molecular weight of the DNA tetrahedron is obtained according to the following calculation formula:

[0063]

[0064] The test shows that the composition ratio of the four single strands is 1:1:1:1, and the molecular weight of the test DNA tetrahedron is the sum of the mass numbers of each single strand.

[0065] Example 2 Method for detecting the molecular weight of the DNA tetrahedron drug complex of the present invention

[0066] (1) Establishment of the standard curves of the four single strands of the DNA tetrahedron drug complex

[0067] a. Preparation of the mixed reference solution

[0068] Take the standards of the four single strands in the DNA tetrahedron drug complex, mix them evenly at a molar ratio of 1:1:1:1, and then dilute them with enzyme-free water or distilled water to a series of concentrations to obtain;

[0069] b. Respectively aspirate the mixed standard solution of a series of concentrations and inject it into the high-performance liquid chromatography-mass spectrometry (HPLC-MS) instrument to measure the peak intensity response value. Respectively, take the concentration or injection volume of each single strand in the mixed standard solution of a series of concentrations as the abscissa (X), and take the peak intensity response value of each single strand as the ordinate (Y) to plot the standard curves of the four single strands; the chromatographic conditions are as follows:

[0070] Chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm);

[0071] Mobile phase: Mobile phase A: Aqueous solution containing 1.0% HFIP and 0.1% DIPEA, Mobile phase B: Aqueous solution containing 0.75% HFIP and 0.0375% DIPEA and acetonitrile, where the volume ratio of the aqueous solution to the acetonitrile solution is 35:65;

[0072] Flow rate: 0.3 mL / min, detection wavelength: 260 nm, column temperature: 30 °C, injection volume: 20 μL,

[0073] The gradient elution program is as follows:

[0074] Time (min) Mobile Phase A (%) Mobile Phase B (%) 0 90 10 2 90 10 10 0 100 16 0 100 16.1 90 10 20 90 10

[0075] The mass spectrometry conditions are as follows: The ion source is ESI; the mass spectrometry detection mode is the negative ion detection mode;

[0076]

[0077] (2) Determination of the molar ratio and molecular weight of each single strand of the DNA tetrahedron drug complex

[0078] c. Preparation of the test solution

[0079] Take the DNA tetrahedron drug complex, add enzyme-free water or distilled water and mix well to obtain the test solution;

[0080] d. Aspirate the test solution and inject it into the HPLC-MS instrument, and detect it under the same conditions as in step b to obtain the deconvolution mass spectrum and response value of the test solution. The molar ratio of each single strand of the DNA tetrahedron drug complex is obtained according to the following calculation formula:

[0081]

[0082] Note: The molar ratio of each single strand is calculated for the test sample and the mixed standard under the same injection volume.

[0083] The molecular weight of the DNA tetrahedron drug complex is obtained according to the following calculation formula:

[0084]

[0085] The composition ratio of the four single strands obtained by the test is 1:1:1:1, and the molecular weight of the DNA tetrahedron drug complex of the test sample is the sum of the mass numbers of each single strand.

[0086] The beneficial effects of the present invention are further illustrated by the following experimental examples.

[0087] 1. Experimental instruments

[0088] Experimental instruments for Experimental Examples 1-8:

[0089] 1) Mass spectrometer RDa, Waters

[0090] 2) Liquid chromatography I-Class, Waters

[0091] Experimental instruments for Experimental Example 9:

[0092] 3) Liquid phase: Waters ultra-high performance liquid chromatograph, model Waters UPLC H-Class

[0093] 4) Mass spectrometry: Waters quadrupole-time of flight mass spectrometry, model Waters Xevo G2-XS

[0094] 2. Experimental reagents:

[0095] 1) Methanol (207899, Fisher)

[0096] 2) DIPEA, N,N-diisopropylethylamine (Alfa Aesar, A11801)

[0097] 3) HFIP, hexafluoroisopropanol (RDC20210514, Quzhou Rundong Chemical Co., Ltd.)

[0098] 4) Enzyme-free water (2008040, invitrogen)

[0099] 5) Source of DNA tetrahedron or its drug complex single-strand standard: WuXi AppTec (Tianjin) Co., Ltd.

[0100] 3. Test samples

[0101] DNA tetrahedron: Prepared according to the method described in the examples of Patent CN109646450A

[0102] The DNA tetrahedron drug complex is a complex formed by the ligation of TDN and miR22 through the linker -TTTTT-, and is prepared according to the method described in Example 1 of Patent CN112843085A.

[0103] The specific sequences of the single strands (5′→3′) are as follows:

[0104] S2: ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG

[0105] S3: ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0106] S4: ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG

[0107] S1: ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA

[0108] S1mR: AAGCUGCCAGUUGAAGAACUGUTTTTTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA

[0109] 4、 Sample Pretreatment

[0110] According to the preparation method disclosed in the patent under "3. Test Substances", obtain the test substance solution, ultrafiltrate and concentrate it, discard the filtrate, and add enzyme-free water or distilled water to prepare it into the test concentration.

[0111] Experimental Example 1 Study on the Liquid Phase Detection Conditions of DNA Tetrahedron ① (Initial Conditions, Isocratic Elution)

[0112] Take 50.6 ng / μL of the prepared test substance solution and perform the determination according to the following detection conditions:

[0113] Mobile Phase A: H2O solution containing 50 mM HFIP and 5 mM DIPEA, Mobile Phase B: H2O solution containing 50 mM HFIP and 5 mM DIPEA and acetonitrile, where the volume ratio of the aqueous solution to the acetonitrile solution is 30:70; Flow rate: 0.2 mL / min, Detection wavelength: 220 nm, Column temperature: 30 °C, Injection volume: 18 μL, Chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm), Isocratic elution: The volume ratio of Mobile Phase A to Mobile Phase B is 50:50;

[0114] Mass spectrometry conditions: Cone voltage 30V, Capillary voltage: Default (0.8 kV), Desolvation temperature 100 °C.

[0115] The test results showed that the peaks of the test samples were messy, the impurity peaks could not be separated from the main peaks, and the response signal was weak, making it impossible to analyze the molecular weight of the test samples, as Figure 1 .

[0116] Experimental Example 2: Study on the liquid-phase detection conditions of DNA tetrahedra ② (gradient elution, other conditions same as Experimental Example 1)

[0117] Mobile phase A: H2O solution containing 50 mM HFIP and 5 mM DIPEA, Mobile phase B: H2O solution containing 50 mM HFIP and 5 mM DIPEA and acetonitrile, where the volume ratio of the aqueous solution to the acetonitrile solution is 30:70; Flow rate: 0.2 mL / min, Detection wavelength: 220 nm, Column temperature: 30 °C, Injection volume: 18 μL, Chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm);

[0118] Mass spectrometry conditions: Cone voltage 30V, Capillary voltage: Default (0.8 kV), Desolvation temperature 100 °C.

[0119] The elution procedure is as follows:

[0120] Time (min) Mobile Phase A Mobile Phase B 0 100 0 5 80 20 12 40 60 15 0 100 16 90 10 20 90 10

[0121] The test results showed that the peaks of the test samples were still messy, the impurity peaks could not be separated from the main peaks, and it was difficult to analyze the molecular weight of the test samples, as Figure 2 shown.

[0122] Experimental Example 3: Study on the liquid-phase detection conditions of DNA tetrahedra ③ (changing the composition ratio of the mobile phase, other conditions same as Experimental Example 2)

[0123] It was found in the experimental study that gradient elution still could not effectively separate the main peak and impurities, and the detection results had large errors. Subsequently, the detection conditions were investigated.

[0124] Mobile phase A: H2O solution containing 1.0% HFIP and 1.0% DIPEA, mobile phase B: H2O solution containing 1.0% HFIP and 1.0% DIPEA and acetonitrile, wherein the volume ratio of aqueous solution to acetonitrile solution is 30:70; flow rate: 0.2mL / min, detection wavelength: 220nm, column temperature: 30℃, injection volume: 18μL, chromatographic column: Oligonucleotide BEH C18 (4.6mm×50mm, 2.5μm);

[0125] The elution procedure is as follows:

[0126] Time (min) Mobile Phase A Mobile Phase B 0 100 0 5 80 20 12 40 60 15 0 100 16 90 10 20 90 10

[0127] Mass spectrometry conditions: cone voltage 30V, capillary voltage: Default (0.8kV), desolvation temperature 100℃.

[0128] During the test, it was found that the DNA tetrahedron also had a disordered peak shape, and the separation effect of the main peak and the impurity peak was not ideal. It was impossible to accurately measure the molecular weight of the DNA tetrahedron, so further investigation of the detection conditions was needed.

[0129] Experimental Example 4 Study on the liquid phase detection conditions of DNA tetrahedron④ (changing the mobile phase composition and gradient elution procedure, other conditions are the same as those of Experimental Example 2)

[0130] Mobile phase A: H2O solution containing 1.0% HFIP and 1.0% DIPEA, mobile phase B: H2O solution containing 1.0% HFIP and 0.375% DIPEA and acetonitrile, wherein the volume ratio of aqueous solution to acetonitrile solution is 35:65; flow rate: 0.2mL / min, detection wavelength: 220nm, column temperature: 30℃, injection volume: 18μL, chromatographic column: Oligonucleotide BEH C18 (4.6mm×50mm, 2.5μm);

[0131] The elution procedure is as follows:

[0132] Time (min) Mobile Phase A Mobile Phase B 0 100 0 5 90 10 12 60 40 15 0 100 16.1 100 0 20 100 0

[0133] Mass spectrometry conditions: cone voltage 30V, capillary voltage: Default (0.8kV), desolvation temperature 100℃.

[0134] The test results showed that there were still problems with the messy peak shape of the main peak in the DNA tetrahedron, and the main peak and impurity peaks could not be completely separated, so the accurate molecular weight of the DNA tetrahedron could still not be obtained. Further investigation of the test conditions was still needed.

[0135] Based on the previous research findings, it was found that the method of directly injecting the test sample to measure the complete molecular weight was completely inapplicable to the determination of the molecular weight of DNA tetrahedron. Considering the special composition of the DNA tetrahedron molecular weight, it was considered to measure the molecular weights of the four single strands separately and then add them up to obtain the final complete molecular weight of the DNA tetrahedron.

[0136] Since the DNA tetrahedron is composed of four single strands, in order to finally obtain accurate molecular weight results, it is a great challenge to quickly and fully unwind the DNA tetrahedron during detection and ensure the integrity of the single strands.

[0137] Experimental Example 5 Study on the Liquid Phase Detection Conditions of DNA Tetrahedron ⑤ (Compared with Experimental Example 4, the liquid phase column temperature was investigated, and other test conditions remained unchanged)

[0138] In order to achieve the rapid and full unwinding of the DNA tetrahedron during detection, the column temperature during separation was first considered to be changed.

[0139] The test sample DNA tetrahedron was analyzed for its complete molecular weight under three column temperature conditions respectively. Condition 1: column temperature 60 °C, Condition 2: column temperature 40 °C, Condition 3: column temperature 15 °C, and other conditions were the same as those in Experimental Example 4.

[0140] The results showed that under the three column temperatures, the test sample was not fully unwound, and there were multiple groups of overlapping peaks, and the molecular weights of each single strand could not be accurately distinguished. The test results at a column temperature of 40 °C are shown in the appendix Figure 3 .

[0141] Experimental Example 6 Study on the Liquid Phase Detection Conditions of DNA Tetrahedron ⑥ (Compared with Experimental Example 4, the composition of the mobile phase and the elution program were changed, and the cone voltage was investigated)

[0142] Based on the previous research results, the effects of the liquid phase elution conditions and the mass spectrometry cone voltage on the unwinding level were further investigated.

[0143] Mobile phase A: H2O solution containing 1.0% HFIP and 0.1% DIPEA, Mobile phase B: H2O solution containing 0.75% HFIP and 0.0375% DIPEA and acetonitrile, where the volume ratio of the aqueous solution to the acetonitrile solution was 35:65; flow rate: 0.3 mL / min, detection wavelength: 260 nm, column temperature: 30 °C, injection volume: 18 μL, chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm), and the elution program was as follows:

[0144]

[0145]

[0146] The mass spectrometry conditions were as follows: the ion source was ESI; the mass spectrometry detection mode was the negative ion detection mode;

[0147]

[0148] The results showed that under these elution conditions, the level of impurity peaks was controlled to a certain extent, and the main peak became gradually clear. However, the error in the molecular weights collected under the conditions of cone voltage 60 V and cone voltage 20 V was increased compared with that under the condition of cone voltage 40 V, and there were many interfering impurity peaks. The test spectra of cone voltage 60 V and cone voltage 40 V are shown in Figure 4 、 5 respectively.

[0149] Experimental Example 7 Desolvation temperature

[0150] While maintaining the liquid phase elution conditions in Experimental Example 6, the desolvation temperature of the mass spectrometry was further investigated under the condition that the mass spectrometry cone voltage was 40 V, and the influence on the detection results was studied.

[0151] Among them, Condition 1: Desolvation temperature 300 °C, Condition 2: Desolvation temperature 200 °C, Condition 3: Desolvation temperature 50 °C, and the other mass spectrometry parameter settings were the same as those in Experimental Example 6.

[0152] The results showed that the lower the set value of the three Desolvation temperatures, the lower the liquid chromatography - mass spectrometry detection signal, and the greater the error in the detection results. The relevant results are shown in Table 1, Figure 6 、 7 、8.

[0153] Table 1 Test results of different desolvation temperatures of the test article DNA tetrahedron

[0154]

[0155]

[0156] In addition, it was also found in the study that when the sample to be tested was directly subjected to mass spectrometry, all substances were detected and eluted together, making it impossible to separate impurities from the main component. The peak broadening was severe, the signal value was low, and a relatively high concentration of the sample was required to observe the peak value.

[0157] Based on the above research results, the detection conditions for the molecular weight of DNA tetrahedron or its drug complex were finally determined as follows: Mobile phase A: an H2O solution containing 1.0% HFIP and 0.1% DIPEA; Mobile phase B: an H2O solution containing 0.75% HFIP and 0.0375% DIPEA and acetonitrile, where the volume ratio of the aqueous solution to acetonitrile was 35:65; Flow rate: 0.3 mL / min; Detection wavelength: 260 nm; Column temperature: 30 °C; Injection volume: 20 μL; Chromatographic column: Oligonucleotide BEH C18 (4.6 mm × 50 mm, 2.5 μm), and the elution program was:

[0158] Time Mobile Phase A (%) Mobile Phase B 0 90 10 2 90 10 10 0 100 16 0 100 16.1 90 10 20 90 10

[0159] The mass spectrometry conditions were as follows:

[0160]

[0161] Experimental Example 8 Analysis of the relative proportions of the constituent single strands of the test DNA tetrahedron and determination of its molecular weight

[0162] Considering the special composition of the DNA tetrahedron or its drug complex, in order to further verify that the measured value is the four single strands constituting the DNA tetrahedron or its drug complex, relative proportion analysis was performed on the constituent single strands in the test sample.

[0163] 1) Separate tests of the four single-strand standards (single-label method)

[0164] Take the four single-strand standards in the DNA tetrahedron: S1: 144.9 ng / μL, S2: 156.1 ng / μL, S3: 160.7 ng / μL, S4: 137.9 ng / μL; Dilute them 1-fold and 20-fold respectively with distilled water, load the samples according to the injection volume in Table 2 below, and inject and measure under the detection conditions determined in Experimental Example 7. The functional relationships between the loading amounts of the four single strands and their response values were obtained as follows: S1 (y = 100,865.63x + 2,595,839.10, R 2 = 0.99), S2 (y = 71,149.55x + 3,268,537.06, R 2 = 0.99), S3 (y = 51,097.38x + 1,867,341.91, R 2= 0.98), S4(y = 68,654.89x + 3,169,900.31, R 2 = 0.98).

[0165] Table 2 Molecular weight matching results of four single strands with different sample loading amounts

[0166]

[0167]

[0168] According to the patent method under "3. Test sample" and the method under "4. Pretreatment of test sample", a DNA tetrahedron sample with a concentration of 101.2 ng / μL was prepared, and the target response values of DNA tetrahedron samples with different sample loading amounts (600 ng, 900 ng, 1800 ng) were detected respectively. The response values corresponding to each single strand detected in the DNA tetrahedron samples with different sample loading amounts were substituted into the calibration curve equations of each single strand, and the ratios of S1:S2:S3:S4 with different sample loading amounts were calculated respectively. The results are shown in Table 3.

[0169] Table 3 Molecular weight matching results and ratio values of DNA tetrahedron with different sample loading amounts

[0170]

[0171] Note: The calculated values substituted into the calibration curve refer to the calculated values (corresponding to the x values in the calibration curve) obtained by substituting the test response values (corresponding to the y values in the calibration curve) into each monomer function respectively.

[0172] The results show that the ratios of the four single strands of DNA tetrahedron with different sample loading amounts, S1:S2:S3:S4, are approximately 1.00:1.02 - 1.16:1.63 - 1.65:0.81 - 0.90, which deviate greatly from the theoretical ratio (S1:S2:S3:S4 = 1:1:1:1), and the test results are inaccurate. It is speculated that there is an interaction between the responses of the mixed single strands after the depolymerization of the DNA tetrahedron test sample.

[0173] 2) Mixing and injecting the four single strand standards for testing (mixed standard method)

[0174] Take the four single strand standards in the DNA tetrahedron: S1: 144.9 ng / μL, S2: 156.1 ng / μL, S3: 160.7 ng / μL, S4: 137.9 ng / μL; dilute them 1 time and 2 times with distilled water respectively, mix them at an equimolar ratio (1:1:1:1) at room temperature, inject and measure according to the sample loading amounts in Table 4 below and the detection conditions determined in Experimental Example 7, and obtain the mass spectrometry response values of each single strand. The results are shown in the mixed standard response values in Table 4. The functional relationship between the sample loading amount and the response value is as follows:

[0175] S1: y = 26839x + 655062, R 2 = 0.9996; S2: y = 18203x + 505226, R 2 = 0.9993;

[0176] S3: y = 17527x - 96951, R 2 = 0.9944; S4: y = 15630x + 192224, R 2 = 0.9852;

[0177] Meanwhile, take the DNA tetrahedron test samples and inject 300 ng, 600 ng, 900 ng, 1200 ng, and 1800 ng respectively. The test results are shown in the DNA tetrahedron test response values in Table 4.

[0178] Table 4 Molecular weight matching results and ratio values of DNA tetrahedron with different sample loading amounts

[0179]

[0180]

[0181] Analysis of the relative composition ratio of each single strand of the test sample DNA tetrahedron is obtained according to the following calculation formula:

[0182]

[0183] The results show that the measured ratio of the four single strands in the test sample DNA tetrahedron is close to the theoretical value (S1: S2: S3: S4 = 1:1:1:1).

[0184] Analysis of the molecular weight of the test sample DNA tetrahedron is obtained according to the following calculation formula:

[0185]

[0186] The molecular weights of the four single strands are summed up, and the calculated molecular weight of the DNA tetrahedron is about 77661 Da, which is consistent with the theoretical molecular weight (77661 Da).

[0187] Experimental Example 9 Detection of the molecular weight of the test sample DNA tetrahedron drug complex

[0188] 1) Take the four single-stranded standards of the DNA tetrahedron drug complex: S2: 0.5 uM, S3: 0.5 uM, S4: 0.5 uM, S1mR: 0.5 uM. After mixing them in an equimolar ratio (1:1:1:1) at room temperature, inject 20 uL for testing according to the detection conditions determined in Experimental Example 7. When the concentrations of the four single-stranded standards of the DNA tetrahedron drug complex are 1.0 uM, 1.5 uM, and 2.0 uM respectively, the relevant experimental operations are the same as those at 0.5 uM. The mass spectrometry response values of each single strand are shown as the mixed standard response values in Table 5. The correlation functions between the concentrations of each single-stranded standard and the response values are as follows:

[0189] S1mR: y = 168610x + 4267, R 2 = 0.9988; S2: y = 310062x + 7336, R 2 = 0.9989;

[0190] S3: y = 238393x - 1830, R 2 = 0.9977; S4: y = 168185x + 1299, R 2 = 0.9997;

[0191] 2) At the same time, select the test sample concentrations of 0.5 uM, 1.0 uM, 1.5 uM, and 2.0 uM and inject 20 uL respectively, and conduct tests according to the detection conditions determined in Experimental Example 7. The measurement results are shown in Table 5 below.

[0192] Table 5 Related tests of DNA tetrahedron drug complex

[0193]

[0194]

[0195] The relative composition ratios of each single strand of the test sample DNA tetrahedron complex are obtained according to the following calculation formula:

[0196]

[0197] The results show that the measured ratios of the four single strands in the test sample DNA tetrahedron complex are close to the theoretical values (S1: S2: S3: S1mR = 1:1:1:1).

[0198] The analysis of the molecular weight of the test sample DNA tetrahedron complex is obtained according to the following calculation formula:

[0199]

[0200] Sum up the molecular weights of each single strand, and calculate that the molecular weight of the DNA tetrahedron complex is 86307 Da, which is basically consistent with the theoretical molecular weight (86307 Da).

[0201] In summary, under specific chromatographic conditions and mass spectrometry conditions, the present invention can fully unwind the four single strands in the DNA tetrahedron or its drug complex, and effectively separate them on the mass spectrometry map. By injecting a mixture of four single-strand standards for testing, establishing a standard curve, and then combining with the measured values of the sample to be tested, it can not only quickly determine the molar ratio of each single strand in the DNA tetrahedron or its drug complex molecule, but also accurately determine the molecular weight of the sample to be tested, and has practical popularization and application value.

Claims

1. A method for detecting the molecular weight of a DNA tetrahedron or its drug complex, characterized in that, The detection method includes: (1) determining the molar ratio and mass number of each single strand constituting the DNA tetrahedron or its drug complex; (2) determining the molecular weight of the DNA tetrahedron or its drug complex.

2. The molecular weight detection method according to claim 1, wherein step (1) includes the following operations: a. Preparation of the test sample and the mixed standard solution, wherein the test sample is prepared by adding water to the DNA tetrahedron or its drug complex, and the mixed standard is prepared by mixing single-strand standards of the DNA tetrahedron or its drug complex in a molar ratio of 1:1:1:1 and adding water; b. Separately measuring the test sample and the mixed standard solution by high performance liquid chromatography-mass spectrometry (HPLC-MS), wherein the HPLC-MS includes the following chromatographic conditions and mass spectrometry conditions: The chromatographic conditions include using Oligonucleotide BEH C18, 4.6 mm×50 mm, 2.5 μm as the chromatographic column; and a mixed mobile phase with an aqueous solution containing N,N-diisopropylethylamine and hexafluoroisopropanol as mobile phase A and a mixed solution of an aqueous solution containing N,N-diisopropylethylamine and hexafluoroisopropanol and acetonitrile as mobile phase B; and the gradient elution program is as follows: The mass spectrometry conditions are: the ion source is ESI; the mass spectrometry detection mode is the negative ion detection mode.

3. The molecular weight detection method according to claim 2, wherein: The mobile phase A is an aqueous solution containing 0.05% - 0.15% N,N-diisopropylethylamine and 0.5 - 1.5% hexafluoroisopropanol, preferably an aqueous solution containing 0.1% N,N-diisopropylethylamine and 1.0% hexafluoroisopropanol; And / or: The mobile phase B is a mixed solution of an aqueous solution containing 0.75% hexafluoroisopropanol and 0.0375% N,N-diisopropylethylamine and acetonitrile, wherein the volume ratio of the aqueous solution to the acetonitrile solution is 35:

65.

4. The molecular weight detection method according to claim 2, wherein: The chromatographic conditions further include: flow rate: 0.2 - 0.5 mL / min, preferably flow rate: 0.3 mL / min; And / or: detection wavelength: 220 - 280 nm, preferably detection wavelength: 260 nm.

5. The molecular weight detection method according to claim 2, characterized in that: The chromatographic conditions further include: column temperature: 25 - 40 °C, preferably column temperature: 30 °C; And / or: injection volume: 10 - 25 μL, preferably injection volume: 18 μL, 19 μL or 20 μL.

6. The molecular weight detection method according to claim 2, characterized in that: The mass spectrometry conditions further include: capillary voltage 0.8 kv, cone voltage 40 v, collision voltage 80 v, source temperature 140 °C, desolvation temperature 400 °C, scanning range 400 - 5000 m / z, cone orifice flow rate 50 L / h, desolvent gas flow rate 800 L / h, scanning rate 2 Hz.

7. The molecular weight detection method according to any one of claims 1 - 6, wherein the molar ratio of each single strand of the DNA tetrahedron or its drug complex in step (1) is calculated by the following formula: wherein the test sample and the mixed standard are calculated for the molar ratio of each single strand with the same sample loading amount.

8. The molecular weight detection method according to claim 7, wherein the molecular weight of the DNA tetrahedron or its drug complex is calculated by the following formula:

9. The molecular weight detection method according to claim 8, characterized in that: The DNA tetrahedron drug complex is a complex of a DNA tetrahedron and a small nucleic acid drug or a small molecule chemical drug, preferably a complex of a DNA tetrahedron and a small nucleic acid drug.

10. The molecular weight detection method according to claim 9, wherein: The small nucleic acid drug is selected from antisense oligonucleotides, siRNA, miRNA or aptamers, preferably siRNA or miRNA.

Images