Gliocladium clavatum FT1 with function of synchronously removing nitrogen and carbon from acidic high-concentration organic wastewater and application of Gliocladium clavatum FT1

Abstract

The invention belongs to the technical field of microorganisms, and provides a Sarocladium sp. FT1 mycelium pellet with functions of synchronously removing nitrogen and carbon from acidic high-concentration organic wastewater and application of the Sarocladium sp. FT1 mycelium pellet. The strain broom cladosporium sp. FT1 is preserved in China General Microbiological Culture Collection Center (CGMCC) on December 11, 2024, and the preservation number is CGMCC NO.41716. The invention further discloses a preparation method of the bacterial strain. The strain is an acid-resistant heterotrophic nitrification and aerobic denitrification fungus, and can effectively remove inorganic nitrogen (ammonia nitrogen and nitrate nitrogen) in acidic wastewater while utilizing an organic carbon source under the conditions that C / N is 10-40 and pH is 3-7. The strain can form mycelium pellets in a special growth state, not only can synchronously remove carbon and nitrogen, but also has very good settling performance, so that the strain can play a role in the fields of low-pH and high-organic-load sewage nitrogen and carbon removal treatment, water body remediation and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to a Scopulariopsis ( Sarocladium sp. ) FT1 with the function of simultaneous denitrification and carbon removal from acidic high-concentration organic wastewater and its application. This strain has the function of simultaneous denitrification and carbon removal. When its mycelial pellets are inoculated into acidic wastewater, denitrification and carbon removal of the acidic wastewater can be achieved, and it has excellent sedimentation performance. Background Art

[0002] Most heterotrophic nitrifying-aerobic denitrifying bacteria prefer neutral or slightly alkaline environments, which makes their treatment effect on acidic wastewater poor. It has been observed that lower pH values, especially pH values below 6, will significantly inhibit the growth and denitrification ability of heterotrophic nitrifying-aerobic denitrifying bacteria. Generally, alkali is added to adjust the pH of acidic wastewater to neutral, which will increase the operating cost in the wastewater treatment process. Therefore, heterotrophic nitrifying-aerobic denitrifying bacteria with denitrification ability in acidic environments play an important role in addressing these challenges.

[0003] Compared with bacteria, fungi can secrete a large amount of extracellular polymeric substances (EPS) and have stronger tolerance to extreme conditions. Extracellular polymeric substances are usually divided into outer dissolved extracellular polymeric substances (S-EPS), interlayer loose extracellular polymeric substances (LB-EPS), and inner tight extracellular polymeric substances (TB-EPS). EPS is composed of polysaccharides, proteins, and humic substances. Existing studies have shown that when nutrients are insufficient, some EPS can be used as a carbon source, which will reduce the demand for carbon sources. Filamentous fungi form mycelial pellets, which are formed by the entanglement of hyphae and are the self-immobilized form of filamentous fungi. Mycelial pellets are excellent biomass carriers for other microorganisms and have advantages such as a high specific surface area and good sedimentation performance. Existing studies have shown that extracellular polymeric substances secreted by fungi are beneficial to the formation of aerobic granular sludge. It is worth noting that the research on heterotrophic nitrifying-aerobic denitrifying fungi that can be isolated from the environment and can function in acidic wastewater is still relatively scarce. Therefore, isolating more acid-tolerant fungi with heterotrophic nitrifying-aerobic denitrifying functions is beneficial to expanding the application fields of this type of microorganism. Summary of the Invention

[0004] The present invention provides a Scopulariopsis ( Sarocladium sp. ) FT1 with the function of simultaneous denitrification and carbon removal from acidic high-concentration organic wastewater and its application. Under aerobic and heterotrophic conditions, this strain can exert its denitrification function under acidic conditions, and there is basically no accumulation of nitrite nitrogen during the denitrification process. This strain is isolated from environmental protection enzyme of orange peel fermented anaerobically for one year, overcoming the defect that the denitrification ability of existing microorganisms weakens under low pH conditions, and can exert its denitrification and carbon removal functions under acidic conditions.

[0005] The present invention is realized by the following technical solutions: A strain of Sarocladium FT1 with the function of simultaneous denitrification and carbon removal from acidic high-concentration organic wastewater. Sarocladium sp. ) FT1, the strain Sarocladium Sarocladium sp. ) FT1 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (CGMCC) on December 11, 2024. The deposit number is CGMCC NO. 41716; the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postcode: 100101.

[0006] The above-mentioned Sarocladium sp. ) FT1 grows on a basic medium plate. The formula of the basic medium is: 8.10 g of sodium citrate, 0.472 g of (NH4)2SO4, 0.75 g of K2HPO4, 0.25 g of NaH2PO4, 0.10 g of NaCl, 0.01 g of MnSO4·H2O, 0.05 g of MgSO4·7H2O, 0.01 g of FeSO4·7H2O, 1000 mL of H2O, pH 5.0, and 18 - 20 g of agar.

[0007] The present invention also provides a method for the Sarocladium Sarocladium sp. ) FT1 with the function of simultaneous denitrification and carbon removal from acidic high-concentration organic wastewater to produce mycelial pellets. The specific method is as follows: (1) Subculture: Inoculate on the basic solid medium by the three-point method and culture at 25 - 35 °C for 4 - 5 d to obtain a plate full of Sarocladium FT1 mycelia. (2) Preparation of spore suspension: Repeatedly blow and suck 10 - 20 mL of sterile water on the plate covered with mycelia, then pour the sterile water containing spores into a sterilized bottle, seal it, and shake it at 100 - 150 rpm for 2 - 4 h for homogenization. (3) Mycelial pellet culture: Absorb the spore suspension obtained in step (2) and inject it into the mycelial pellet liquid medium, and culture at 25 - 35 °C and 100 - 150 rpm. The growing mycelia self-wind around the spores to obtain milky white spherical or ellipsoidal mycelial pellets of Sarocladium FT1 with a rough and porous surface.

[0008] The present invention also provides the application of the above-mentioned Sarocladium Sarocladium sp. ) FT1 or the mycelial pellets obtained by the above method in acidic wastewater. The method is to inoculate Sarocladium Sarocladium sp. ) FT1 or its mycelial pellets into acidic synthetic wastewater with any one or several of ammonia nitrogen and nitrate nitrogen as nitrogen sources, and achieve simultaneous denitrification and carbon removal under the culture conditions. The culture conditions are as follows: the carbon source is sodium citrate; any one of glucose or starch, C / N = 10 - 40, pH = 3 - 7, treatment temperature 25 - 35 °C, rotation speed 100 - 150 rpm.

[0009] Furthermore, the culture conditions for simultaneous denitrification and carbon removal are: the carbon source is sodium citrate, inoculating mycelial pellets into synthetic wastewater, C / N is 20, pH = 5; the temperature is 30 °C, and the rotation speed is 120 rpm.

[0010] Further, inoculate the mycelial pellets into synthetic wastewater with ammonia nitrogen and nitrate nitrogen as the sole nitrogen sources.

[0011] The Cladosporium cladosporioides Sarocladium sp. ) FT1 of the present invention is applied to acidic wastewater, which can effectively adapt to the acidic environment and remove carbon and nitrogen in the wastewater, achieving simultaneous denitrification and carbon removal in a low pH environment. This technology breaks through the limitation of the traditional biological denitrification process that requires separate treatment in anaerobic, anoxic, and aerobic environments, and has broad application prospects and good economic and social benefits.

[0012] Regarding the application of the present invention to the traditional biological denitrification process, its characteristic lies in that the nitrification process is not carried out under autotrophic conditions, but is achieved under heterotrophic conditions. At the same time, the denitrification process is carried out under aerobic conditions.

[0013] After the Cladosporium cladosporioides FT1 provided by the present invention is inoculated onto a solid medium and cultured for 4 - 7 days, the colony morphology in the petri dish is white, the surface is dry, the mycelia show white villous, and after continued culture for a period of time, the back of the colony shows light red.

[0014] This strain can use organic carbon source as the electron donor under aerobic conditions to assimilate ammonia nitrogen into intracellular organic nitrogen, and can also oxidize ammonia nitrogen to nitrate nitrogen through nitrification to achieve heterotrophic nitrification; it can also achieve simultaneous nitrification and denitrification process with ammonia nitrogen and nitrate nitrogen as the mixed nitrogen source under aerobic conditions. FT1 can achieve denitrification and carbon removal under the condition of pH = 3. During the treatment of acidic wastewater, there is no accumulation of nitrite, and at the same time, it can effectively remove carbon in acidic wastewater, having good application prospects.

[0015] The strain of the present invention: Cladosporium cladosporioides Sarocladium sp. ) FT1 was deposited on December 11, 2024 with the China General Microbiological Culture Collection Center CGMCC, and the deposit number is CGMCC NO. 41716; the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postcode: 100101. Description of the Drawings

[0016] Figure 1 For the Cladosporium cladosporioidesSarocladium sp. )Phylogenetic tree of FT1.

[0017] Figure 2 The Verticillium provided by the present invention ( Sarocladium sp. )Photograph of mycelial pellets of FT1; Figure 3 The Verticillium provided by the present invention ( Sarocladium sp. )Scanning electron micrograph of mycelial pellets of FT1 magnified 2000 times; Figure 4 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 at different pH values and changes in the final pH; Figure 5 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 with different carbon sources and changes in the final pH; Figure 6 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 at different C / N ratios and changes in the final pH; Figure 7 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 when NH4 + is the sole nitrogen source and changes in the final pH; Figure 8 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 when NO3 - is the sole nitrogen source and changes in the final pH; Figure 9 The Verticillium provided by the present invention ( Sarocladium sp. )Denitrification performance of FT1 when NH4 + and NO3 - are used as mixed nitrogen sources and changes in the final pH; Figure 10 The Verticillium provided by the present invention ( Sarocladium sp. )Changes in the composition and content of extracellular proteins of mycelial pellets of FT1 when NH4 + is the sole nitrogen source. Detailed implementation manners

[0018] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments; based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0019] Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents and patent applications cited herein, as well as the materials cited therein, are hereby incorporated by reference.

[0020] Equivalent techniques to the specific embodiments described that can be learned by those skilled in the art through routine experiments shall be included in this application.

[0021] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples are all obtained from conventional biochemical reagent stores.

[0022] The culture medium formula used in this invention is as follows: Basic medium: Sodium citrate (Na3C6H5O7·2H2O) 8.10 g, (NH4)2SO4 0.472 g, K2HPO4 0.75 g, NaH2PO4 0.25 g, NaCl 0.10 g, MnSO4·H2O 0.01 g, MgSO4·7H2O 0.05 g, FeSO4·7H2O 0.01 g, H2O 1000 mL.

[0023] Heterotrophic nitrification medium: Sodium citrate 8.10 g, (NH4)2SO4 0.472 g, K2HPO4 0.75 g, NaH2PO4 0.25 g, NaCl 0.10 g, MnSO4·H2O 0.01 g, MgSO4·7H2O 0.05 g, FeSO4·7H2O 0.01 g, H2O 1000 mL.

[0024] Aerobic denitrification medium I: Sodium citrate 8.10 g, KNO3 0.72 g, K2HPO4 0.75 g, NaH2PO4 0.25 g, NaCl 0.10 g, MnSO4·H2O 0.01 g, MgSO4·7H2O 0.05 g, FeSO4·7H2O 0.01 g, H2O 1000 mL.

[0025] Simultaneous nitrification and denitrification medium I: Sodium citrate 8.10 g, KNO3 0.361 g, ammonium sulfate 0.236 g, K2HPO4 0.75 g, NaH2PO4 0.25 g, NaCl 0.10 g, MnSO4·H2O 0.01 g, MgSO4·7H2O 0.05 g, FeSO4·7H2O 0.01 g, H2O 1000 mL I. Screening of strains: Use the environmental protection enzyme made from orange peel fermented for one year as the strain source.

[0026] Take 2 - 5 mL of the fermentation broth from the environmental protection enzyme made from orange peel fermented for one year and add it to a conical flask containing sterilized heterotrophic nitrification medium. Place the conical flask in a shaker and culture it at 100 - 150 rpm and 25 - 35 °C for 48 h for enrichment culture. Take 1 mL of the enriched cell suspension and inoculate it into 100 mL of sterilized heterotrophic nitrification medium, and continue to acclimatize under the same conditions. After at least three consecutive acclimatization cultures, perform gradient dilution (10 −4 、10 −5 、10 −6 、10 −7 ) of the suspension. Pipette 100 - 200 μL of the diluted suspension and evenly spread it on the sterilized solid heterotrophic nitrification medium. Invert the petri dish and culture it in a biochemical incubator at 25 - 35 °C until colonies visible to the naked eye are formed. Pick single colonies with different morphologies and streak culture them on a solid agar plate, repeating three times continuously to obtain purified strains. The purified strains are stored at -80 °C in a 25% glycerol solution for subsequent research.

[0027] Inoculate the multiple strains obtained by screening into the heterotrophic nitrification medium with an ammonia nitrogen concentration of 100 mg / L and a pH of 3 respectively. After 120 h of culture, it is found that strain FT1 can survive under the condition of pH 3, remove ammonia nitrogen, and the removal efficiency can reach 84.12%. Subsequently, after extracting the DNA of strain FT1, amplify the ITS sequence by PCR and perform agarose gel electrophoresis. The ITS sequence is amplified by PCR, with a length of 500 - 600 bp. The specific sequencing results are shown in SEQ ID NO.1 in the sequence listing as follows: CCTGCGGAGGGATCATTACCAGAGTGCCTTTTGGCTCTCCAACCCACTGTGAACATACCTACGTTTCCCTCGGCGGGCTCAGCGCGTTGCGGTTCTGCCGCCTCGCGTCCGCCGGGGGCACCCAAACTCGAATTTATATCGTGTATCTCTGAGGGGCGAAAGCCCGTAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGCACTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGGGCCCACCCCTCGCGGGGAACGGGCCCGGCGTTGGGGACCGGAGGCCGCCCCGGCGGCACCCGCCCCCTAAATTCAGTGGCGGTCGCGCCGCAGCCTCCCCTGCGTAGTAGCACACCTCGCACCGGAGAGCGGCACGGCCACGCCTCGAAACCCCCCAATTTTTCAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATAT The sequence length of the ITS fragment of the obtained strain FT1 was 561 bp. The sequence was submitted to the NCBI website, and a phylogenetic tree was constructed using MAGE X software. Through BLAST homology analysis, the results showed that strain FT1 had a high similarity with multiple Sarocladiumsp. strains. According to the ITS gene sequences of strain FT1 and the strains related to the evolution of strain FT1 and other related strains, a phylogenetic tree of strain FT1 was constructed, and the results were as Figure 1 shown. The results of the phylogenetic tree further confirmed that FT1 belonged to Sarocladium genus.

[0028] In the present invention, the sizes of the mycelial pellets of FT1 ( Sarocladium sp. ), were different, and the diameters were mostly 1 - 4 mm. The shapes were mostly ellipsoidal or spherical, with rough surfaces. The spherical pellets were obtained by the entanglement of hyphae, and the surfaces of the pellets had hyphae extending outward. The mycelial pellets of FT1 prepared by inoculating and culturing a spore suspension and the scanning electron microscope images are shown in Sarocladium sp. and Figure 2 , Figure 3 . They were milky white round or oval small balls, and the diameters were mostly 1 - 4 mm.

[0029] 2. Application of strains in acidic wastewater: the method is to use the fungus ( Sarocladium sp. ) FT1 or its mycelium pellets are inoculated into acidic synthetic wastewater containing any one or more nitrogen sources of ammonia nitrogen and nitrate nitrogen, and denitrification and carbon removal are achieved simultaneously under culture conditions; The specific wastewater conditions are: C / N=10-40, NH4 + -N 100-105 mg / L, pH=3-7.

[0030] The strain preserved in -80°C glycerol (deposited in the General Microbiology Center of China Microorganism Culture Collection Administration Committee CGMCC on December 11, 2024, with the deposit number CGMCC NO.41716) was inoculated into a sterilized solid culture medium, and placed in a constant temperature incubator at 25-35°C for 2-3 days. When the mycelium covers the plate, continue to culture for 3-4 days. After the spores grow out, pour 10-20 mL of sterile water into the culture dish in an ultra-clean workbench, blow and suck the spores with a pipette, rinse with sterile water 3-4 times, pour into a sterilized conical flask filled with physiological saline, and shake at 25-35°C and 100-150 rpm for 2-4 h. At this time, the spores and mycelium are evenly mixed to obtain a spore suspension. Inoculate 2-5 mL of spore suspension into the sterilized heterotrophic nitrification medium and culture at 25-35°C and 100-150 rpm for 3-4 days to obtain FT1 mycelial balls with a diameter of about 1-2 mm. The mycelial balls are reserved for subsequent inoculation.

[0031] Adjust the pH of three conical flasks containing 100 mL of liquid basal culture medium to 3, 5, and 7, respectively, and then inoculate 40-50 mycelial balls into them, respectively, and culture them in a constant temperature shaker at 25-35℃ and 100-250 rpm. After sampling at 0 h and 120 h, directly measure the pH value of the solution, and then centrifuge at 10000 rpm for 10 min to measure the NH4 in the supernatant. + -N concentration (the same below). The results are as follows Figure 4 As shown, when pH=3, the ammonia nitrogen removal rate of the strain exceeded 84% and the final pH rose to about 7, when pH=5, the ammonia nitrogen removal rate of the strain exceeded 95% and the final pH rose to nearly 9, and when pH=7, the ammonia nitrogen removal rate of the strain was as high as 72% and the final pH rose to 9. Therefore, the pH at which the bacteria exerts the best denitrification ability is 5.

[0032] Similarly, at pH = 5, 8.10 g sodium citrate (Na3C6H5O7·2H2O), 5.51 g glucose (C6H 12O6·H2O), 4.52 g soluble starch, 5.50 g sodium carboxymethyl cellulose (CMC-Na), and 6.88 g sodium acetate served as carbon sources, and the culture and test conditions were the same as above. Figure 5 As shown in the figure, when the carbon sources are sodium citrate and glucose, the ammonia nitrogen removal rate of the strain is as high as 98.00% and 98.66% respectively. However, the final pH changes under the two carbon sources are different. When sodium citrate is used as a carbon source, the final pH rises to nearly 9; when glucose is used as a carbon source, the final pH drops to about 2.5. After comprehensive consideration, sodium citrate is selected as the best carbon source.

[0033] Similarly, sodium citrate was used as the carbon source, pH = 5, and the C / N ratio of the basal medium was adjusted to 10, 10, and 40, respectively. The culture and sample testing conditions were the same as above. Figure 6 As shown, the strain can grow and denitrify at a C / N condition of 20-40. When C / N=20, the ammonia nitrogen removal rate exceeds 95%, and when C / N=40, the ammonia nitrogen removal rate exceeds 98%. Taking all factors into consideration, C / N=20 is selected as the optimal C / N condition.

[0034] In summary, the optimal denitrification conditions for Trichoderma FT1 are: pH = 5, carbon source = sodium citrate, C / N = 20, temperature = 30℃, rotation speed = 120 rpm.

[0035] Cladosporium Sarocladium sp. )The growth and denitrification ability of FT1 when ammonia nitrogen was the only nitrogen source.

[0036] Inoculate 40-50 mycelial pellets into 100 mL of liquid culture medium and then incubate in a shaker at 25-35°C and 100-150 rpm for 120 h. Measure NH4 every 24 h. + -N, TN, pH, NO3 - -N, NO2 - -N concentration.

[0037] Under acidic conditions (pH = 5), high concentrations of ammonia nitrogen were used as substrates (containing 100 mg / L NH4 + -N) in the denitrification process ( Figure 7 ), the mycelial pellets began to rapidly denitrify 24 hours after inoculation. The mycelial pellets degraded NH4 + -N, the maximum ammonia nitrogen removal efficiency is 96%, and there is almost no NO2 in the process of ammonia nitrogen degradation - -N accumulated and the pH value rose from 5 at the beginning to 9, and the culture environment changed from acidic to weakly alkaline.

[0038] Cladosporium Sarocladium sp. )The growth and denitrification ability of FT1 when nitrate-N was the sole nitrogen source.

[0039] Inoculate 40 - 50 mycelial pellets into 100 mL of liquid medium, and then culture them in a shaker at 25 - 35 °C and 100 - 150 rpm for 120 h. Measure the concentrations of NH4 + -N, TN, pH, NO3 - -N, NO2 - -N every 24 h.

[0040] During the denitrification process with high - concentration nitrate nitrogen as the substrate (containing 100 mg / L of NO3 - -N) under acidic conditions (pH = 5) ( Figure 8 ), denitrification starts 24 h after inoculation of the mycelial pellets. While growing, the mycelial pellets degrade NO3 - -N, and the maximum nitrate nitrogen removal efficiency exceeds 82%. In addition, almost no NO2 - -N accumulates during the nitrate nitrogen degradation process, and the pH value rises from 5 to about 9, changing the culture environment from acidic to weakly alkaline.

[0041] Growth and denitrification properties of Scopulariopsis brevicaulis FT1 using ammonia nitrogen and nitrate nitrogen as mixed nitrogen sources.

[0042] Inoculate 40 - 50 mycelial pellets into 100 mL of liquid medium, and then culture them in a shaker at 25 - 35 °C and 100 - 150 rpm for 120 h. Measure the concentrations of NH4 + -N, TN, pH, NO3 - -N, NO2 - -N every 24 h.

[0043] During the denitrification process with high - concentration ammonia nitrogen (50 mg / L) and nitrate nitrogen (50 mg / L) as substrates under acidic conditions (pH = 5) ( Figure 9 ). In the medium with a mixed nitrogen source of nitrate nitrogen and ammonia nitrogen, the ammonia nitrogen in the medium drops sharply within 24 h - 72 h, the nitrate content hardly changes in the first 24 h, and rises within 24 h - 48 h, indicating that part of the ammonia nitrogen is converted into nitrate nitrogen, resulting in an increase in the nitrate nitrogen content. The final removal rate is up to 88% at most.

[0044] During the denitrification process with high - concentration ammonia nitrogen as the substrate (containing 100 mg / L of NH4 + -N) under acidic conditions (pH = 5), analyze in detail the composition and content changes of extracellular proteins of the mycelial pellets over time ( Figure 10), after the mycelial pellets enter the denitrification stage, the composition of their extracellular proteins is mainly dominated by tightly bound extracellular proteins (TB-EPS), and the proportion of tightly bound extracellular proteins increases with time. By 96 h, it accounts for 94% of the extracellular proteins, reaching 37.63 mg / L, and by 120 h, it accounts for 77%, reaching 23.34 mg / L.

[0045] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Cladosporium cladosporioides ([ Sarocladium sp. ]) FT1 with the function of simultaneously removing nitrogen and carbon from acidic high-concentration organic wastewater, characterized in that: Sarocladium sp. ) The strain Scytalidium viride( Sarocladiumsp. ) FT1 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on December 11, 2024, with the deposit number CGMCC NO. 41716; the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101, China.

2. A strain of Cladosporium having the function of simultaneous denitrification and decarbonization of acidic high-concentration organic wastewater according to claim 1 ( Sarocladium sp. )FT1, characterized in that: The Sarocladium sp. ) FT1 grows on the basal medium plate. The formulation of the basal medium is as follows: 8.10 g of sodium citrate, 0.472 g of (NH4)2SO4, 0.75 g of K2HPO4, 0.25 g of NaH2PO4, 0.10 g of NaCl, 0.01 g of MnSO4·H2O, 0.05 g of MgSO4·7H2O, 0.01 g of FeSO4·7H2O, 1000 mL of H2O, pH 5.0, and 18 - 20 g of agar.

3. Method for producing mycelial pellets by the penicillium claviforme ([ Sarocladium sp. Sarocladium sp. ) FT1 with the function of simultaneous nitrogen and carbon removal from acidic high-concentration organic wastewater as claimed in claim 1, characterized in that: The specific method is as follows: (1) Amplification culture: Inoculate by the three-point method on the basic solid medium, and culture at 25 - 35 °C for 4 - 5 d to obtain the mycelium of Sarocladium sp. FT1 covering the plate; (2) Spore suspension preparation: Repeatedly blow and suck 10 - 20 mL of sterile water on the plate covered with mycelium, then pour the sterile water containing spores into a sterilized bottle, seal it, and homogenize it by shaking at 100 - 150 rpm for 2 - 4 h; (3) Pellet culture: Aspirate the spore suspension obtained in step (2) and inject it into the pellet liquid medium, culture at 25 - 35 °C and 100 - 150 rpm, and the growing mycelium self-winds around the spores to obtain the pellets of Sarocladium sp. FT1 that are milky white, spherical or ellipsoidal, and have a rough and porous surface.

4. The fungus having the function of simultaneous denitrification and decarbonization of acidic high-concentration organic wastewater according to claim 1 ( Sarocladium sp. )FT1 or the use of mycelial pellets obtained by the method of claim 3 in acidic wastewater, characterized in that: The method is to use the fungus ( Sarocladium sp. ) FT1 or its mycelium pellets are inoculated into acidic synthetic wastewater containing any one or more nitrogen sources of ammonia nitrogen and nitrate nitrogen, and denitrification and carbon removal are achieved simultaneously under culture conditions; The culture conditions are as follows: the carbon source is sodium citrate; any one of glucose or starch, C / N = 10 - 40, NH4 + -N 100 - 105 mg / L; pH = 3 - 7, the temperature is 25 - 35 °C, and the rotation speed is 100 - 150 rpm.

5. The application according to claim 4, characterized in that: The culture conditions for simultaneous denitrification and carbon removal are as follows: The carbon source is sodium citrate, inoculate the pellets into the synthetic wastewater, C / N is 20, pH = 5; the temperature is 30 °C, and the rotation speed is 120 rpm.

6. The application according to claim 4, characterized in that: Inoculate the pellets into the synthetic wastewater with ammonia nitrogen or nitrate nitrogen as the sole nitrogen source.

Images