Recombinant strain for synthesizing HMB and application thereof

Abstract

The invention provides a plurality of recombinant strains for synthesizing HMB and application thereof, and a method for performing whole-cell catalytic synthesis of HMB by using the strains. According to the recombinant strain, genes such as ldhA, dld, lldD, poxB and pflB are knocked out, and leuDH, bkd, ivd, eck and paaI are enhanced or inserted, or leuDH and kicd genes are enhanced or inserted, so that various strains with higher HMB production capacity are obtained. The various strains have the prospect of green, efficient and industrial production of HMB by utilizing the capability of synthesizing HMB.

Description

Technical Field

[0001] The present invention relates to the technical fields of gene editing, genetically recombined edited microbial strains, synthetic biology, and microbial whole-cell catalysis. Specifically, it relates to a recombinant strain for generating HMB and a preparation method thereof. Background Art

[0002] β-Hydroxy-β-methylbutyric acid (HMB) is an important metabolite of L-leucine in mammals, which can change the balance of protein metabolism during the growth of new muscle tissue and has an anti-catabolic effect. HMB has been widely used as an animal feed additive, a human sports nutrition supplement, and a dietary food, and is expected to play an important role in cancer treatment. It can also be used for clinical treatment of muscle wasting diseases such as tumors and AIDS. The traditional method for producing HMB is chemical synthesis, but this method has problems of toxic organic substances and multi-stage reactions, which does not conform to the concept of sustainable development.

[0003] In the prior art, a biological production process using β-methylbutyric acid (MBA) as a substrate and Galactomyces reessii as a cell factory has been developed, but this method has disadvantages such as high raw material and energy consumption, high cost, and complex operation.

[0004] Therefore, there is an urgent need in the prior art to develop a green biosynthesis pathway for HMB with high production efficiency. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a stable genetically recombined strain, which can prepare β-hydroxy-β-methylbutyric acid (HMB) with high conversion rate, low cost, and few side reactions through whole-cell catalysis.

[0006] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid HMB, which comprises deletion, knockout, or inhibitory expression of the following gene clusters: NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld, L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, pyruvate formate-lyase 1 gene pflB, branched-chain amino acid aminotransferase gene ilvE, pyruvate formate-lyase 4 gene tdcE, and fumarate reductase flavoprotein A subunit gene frdA;

[0007] And enhanced or exogenous insertion of the following gene clusters: leucine dehydrogenase gene leuDH, α-ketoisocaproate dehydrogenase complex bkd genes, isovaleryl-CoA dehydrogenase gene ivd gene, enoyl-CoA hydratase gene ech, acyl-CoA thioesterase gene paaI, ketoacid reductoisomerase gene ilvC, dihydroxyacid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase genes ilvBN, glucose transport system IIBC subunit gene ptsG, glucose-6-phosphate dehydrogenase gene zwf, xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, phosphoacetyltransferase gene pta.

[0008] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising deletion, knockout or inhibitory expression of the following gene clusters: NADH-dependent D-lactate dehydrogenase gene ldhA gene, quinone-dependent D-lactate dehydrogenase gene dld gene, L-lactate dehydrogenase gene lldD gene, pyruvate oxidase gene poxB, pyruvate formate-lyase gene pflB, branched-chain amino acid aminotransferase gene ilvE, pyruvate formate-lyase 4 gene tdcE, fumarate reductase flavoprotein A subunit gene frdA;

[0009] And enhanced or exogenous insertion of the following gene clusters: leucine dehydrogenase gene leuDH, α-ketoisocaproate dioxygenase gene kicd, ketoacid reductoisomerase gene ilvC, dihydroxyacid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase genes ilvBN, glucose transport system IIBC subunit gene ptsG, glucose-6-phosphate dehydrogenase gene zwf, xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, phosphoacetyltransferase gene pta.

[0010] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Pseudomonas putida for synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising enhanced expression or exogenous insertion of the following gene clusters: leucine dehydrogenase leuDH gene, α-ketoisocaproate dehydrogenase complex bkd gene, isovaleryl-CoA dehydrogenase ivd gene, enoyl-CoA hydratase ech gene, acyl-CoA thioesterase PaaI gene;

[0011] And deletion, knockout or inhibitory expression of the lactose operon repressor gene lacI gene and the 2-oxoisovalerate dehydrogenase regulatory protein bkdR gene.

[0012] Optionally or alternatively, the recombinant Pseudomonas putida further comprises:

[0013] Deletion, knockout or inhibitory expression of the branched-chain amino acid aminotransferase gene ilvE, acetyl-CoA synthetase gene acs, and Pp2213 gene; and

[0014] Enhancement or exogenous insertion of the following gene cluster: 2-isopropylmalate synthase gene leuA, keto acid reductoisomerase gene ilvC, acetolactate synthase gene ilvBN, dihydroxyacid dehydratase gene ilvD, xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, phosphoacetyltransferase gene pta.

[0015] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Pseudomonas aeruginosa for synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising the following modifications:

[0016] Enhancing the expression of the leucine dehydrogenase PaleuDH gene;

[0017] Knocking out, deleting or inhibiting the expression of the 2-oxoisovalerate dehydrogenase regulatory protein bkdR gene, and enhancing the expression of the α-ketoisocaproate dehydrogenase complex bkd gene;

[0018] Enhancing the expression of the isovaleryl-CoA dehydrogenase ivd gene;

[0019] Enhancing the expression of the enoyl-CoA hydratase ech gene; and

[0020] Knocking out, deleting or inhibiting the expression of the lactose operon repressor lacI gene, and exogenously inserting the acyl-CoA thioesterase PaaI gene.

[0021] Optionally or alternatively, the recombinant Pseudomonas aeruginosa further comprises:

[0022] Enhancing the expression of the 2-isopropylmalate synthase leuA gene;

[0023] Enhancing the expression of the branched-chain amino acid aminotransferase ilvE gene;

[0024] Enhancing the expression of the acetolactate synthase ilvBN gene;

[0025] Enhancing the expression of the dihydroxyacid dehydratase ilvD gene;

[0026] Knocking out, deleting or inhibiting the expression of the acetyl-CoA synthetase A gene acsA, and exogenously inserting the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase fxpk gene;

[0027] Knocking out, deleting or inhibiting the expression of the acetyl-CoA synthetase B gene acsB, and exogenously inserting the phosphoacetyltransferase pta gene.

[0028] According to an exemplary embodiment of the present disclosure, the present disclosure provides a recombinant Corynebacterium glutamicum for synthesizing β-hydroxy-β-methylbutyric acid (HMB), comprising:

[0029] Enhancing or exogenously inserting the leucine dehydrogenase leuDH gene;

[0030] Knocking out, deleting or inhibiting the expression of the NADH-dependent D-lactate dehydrogenase gene ldhA, and exogenously inserting the α-ketoisocaproic acid dehydrogenase complex bkd gene;

[0031] Knocking out, deleting or inhibiting the expression of the quinone-dependent D-lactate dehydrogenase gene dld, and exogenously inserting the isovaleryl-CoA dehydrogenase ivd gene;

[0032] Knocking out, deleting or inhibiting the expression of the pyruvate oxidase gene poxB, and exogenously inserting the enoyl-CoA hydratase ech gene; and

[0033] Knocking out, deleting or inhibiting the expression of the acyl phosphatase cg2266 gene, and exogenously inserting the acyl-CoA thioesterase PaaI gene.

[0034] Optionally or alternatively, the recombinant Corynebacterium glutamicum comprises:

[0035] Enhancing the expression of the 2-isopropylmalate synthase gene leuA;

[0036] Knocking out, deleting or inhibiting the expression of the branched-chain amino acid aminotransferase ilvE gene, and enhancing the expression of the keto acid reductoisomerase ilvC gene;

[0037] Enhancing the expression of the acetolactate synthase ilvBN gene;

[0038] Enhancing the expression of the dihydroxy acid dehydratase ilvD gene;

[0039] Knocking out, deleting or inhibiting the expression of the alcohol dehydrogenase adhA gene, and exogenously inserting the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase fxpk gene; and

[0040] Knocking out, deleting or inhibiting the expression of the alcohol dehydrogenase cg0273 gene, and enhancing or inserting the phosphotransacetylase pta gene.

[0041] According to another aspect of the present disclosure, there is provided the use of the strain described in any one of the foregoing in the production of β-hydroxy-β-methylbutyric acid (HMB).

[0042] The beneficial technical effects achieved by the present invention are as follows:

[0043] The present invention has developed a brand-new novel HMB production route based on the microbial fermentation method. This method can use inexpensive glucose and the like as substrates, and through microbial fermentation, directly synthesize high-purity HMB from scratch, with high conversion rate, low cost, and few side reactions. Detailed implementation manners

[0044] Definitions

[0045] Unless otherwise defined or clearly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0046] Throughout this specification and the appended claims, the words "comprising" and "including" and variations thereof shall be construed inclusively. That is, where the context allows, these words are intended to convey that other elements or integers may be included that are not specifically recited.

[0047] The article "a / an" is used herein to refer to one or more than one (i.e., one or at least one of the grammatical objects of the article). For example, "an element" can mean one element or more than one element. When a noun (such as a compound, additive, etc.) is mentioned in the singular form, the plural form is intended to be included. Thus, when referring to a particular part (such as "a gene"), unless otherwise specified, this means "at least one" of the gene, for example, "at least one gene".

[0048] Unless otherwise explicitly indicated, the various embodiments of the present invention described herein can be combined crosswise.

[0049] The term "carbon source" refers to a source of carbon, preferably a carbon-containing compound or molecule, including sugars, glycerol, fatty acids, and the like.

[0050] The term "cell" refers to a eukaryotic organism or a prokaryotic organism, preferably existing as a single cell. In the present invention, the cell can be recombinant Escherichia coli. That is, the recombinant cell is selected from the group of cells of the genus Escherichia coli.

[0051] As used herein, the terms "recombinant" / "engineered" (e.g., when referring to "recombinant Escherichia coli", "recombinant cell", "recombinant microorganism", and / or "recombinant strain") can refer to a cell, microorganism, or strain that contains nucleic acids as a result of one or more genetic modifications. Simply put, the cell, microorganism, or strain contains a different combination of nucleic acids from one or more of its parents (any of which). To construct a recombinant cell, microorganism, or strain, one or more recombinant DNA techniques and / or one or more additional mutagenesis techniques can be used. For example, recombinant Escherichia coli and / or recombinant Escherichia coli cells can contain nucleic acids that are not present in the corresponding wild - type Escherichia coli and / or cells, and this nucleic acid has been introduced into the Escherichia coli or Escherichia coli cells using recombinant DNA techniques (i.e., transgenic Escherichia coli and / or cells), or the nucleic acid that is not present in the wild - type Escherichia coli and / or cells is the result of one or more mutations (e.g., using recombinant DNA techniques or another mutagenesis technique such as UV irradiation) in a nucleic acid sequence (such as a gene encoding a wild - type polypeptide) that is present in the wild - type Escherichia coli and / or Escherichia coli cells. In addition, the term "recombinant" can appropriately refer to, for example, a cell, microorganism, or strain from which a nucleic acid sequence has been removed using recombinant DNA techniques.

[0052] In this article, a recombinant Escherichia coli that contains or has a certain activity is understood to mean that the recombinant Escherichia coli can contain one or more nucleic acid sequences encoding a protein having this activity. Thus, it allows the recombinant Escherichia coli to functionally express this protein or enzyme.

[0053] The term "functionally express" means that there is functional transcription of the relevant nucleic acid sequence, allowing the nucleic acid sequence to actually be transcribed, for example, resulting in the synthesis of a protein.

[0054] As used herein, the term "transgenic" (e.g., when referring to "transgenic Escherichia coli" and / or "transgenic cells") refers respectively to such Escherichia coli and / or cells that contain nucleic acids that are not naturally present in the Escherichia coli and / or cells and have been introduced into the Escherichia coli and / or cells using, for example, recombinant DNA techniques, such as recombinant yeast and / or cells.

[0055] As used herein, the term "mutation" with respect to a protein or polypeptide means that at least one amino acid has been replaced with a different amino acid, inserted into the amino acid sequence, or deleted from the amino acid sequence as compared to the wild-type or naturally occurring protein or polypeptide sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis of the nucleic acids encoding these amino acids. Mutagenesis is a method well known in the art and includes, for example, site-directed mutagenesis by means of PCR or via oligonucleotide-mediated mutagenesis, as described in the following references: Sambrook et al., Molecular Cloning - A Laboratory Manual, 2nd Edition, Volumes 1-3 (1989), published by Cold Spring Harbor Publishing.

[0056] As used herein, the term "mutation" with respect to a gene means that at least one nucleotide in the nucleic acid sequence of the gene or its regulatory sequence has been replaced with a different nucleotide, inserted into the nucleic acid sequence, or deleted from the nucleic acid sequence as compared to the wild-type or naturally occurring nucleic acid sequence. The replacement, insertion, or deletion of amino acids can be achieved, for example, via mutagenesis, resulting in, for example, the transcription of a protein sequence with a qualitatively or quantitatively altered function or the knockout of the gene. In the context of the present invention, "altered gene" has the same meaning as "mutated gene".

[0057] As used herein, the term "gene" refers to a nucleic acid sequence that can be transcribed into mRNA and then translated into a protein. A gene encoding a particular protein refers to one or more nucleic acid sequences encoding this protein.

[0058] As used herein, the terms "nucleic acid" or "nucleotide" refer to monomeric units in a polymer of deoxyribonucleotides or ribonucleotides (i.e., polynucleotide) in single-stranded or double-stranded form, and unless otherwise restricted, encompass known analogs having the essential properties of natural nucleotides, since they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). For example, a certain enzyme defined by a nucleotide sequence encoding the enzyme includes (unless otherwise restricted) nucleotide sequences that hybridize to a reference nucleotide sequence encoding the enzyme. A polynucleotide can be the full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as its complementary sequence. Thus, DNA or RNA having a backbone modified for stability or other reasons is a polynucleotide as contemplated herein. In addition, DNA or RNA containing rare bases (such as inosine) or modified bases (such as tritylated bases) (to name just two examples) is a polynucleotide as used herein. It will be understood that a wide variety of modifications have been made to DNA and RNA for many useful purposes known to those of skill in the art. The term polynucleotide as used herein includes such chemically, enzymatically, or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells (especially including simple and complex cells).

[0059] The terms "nucleotide sequence" and "nucleic acid sequence" are used interchangeably herein. An example of a nucleic acid sequence is a DNA sequence.

[0060] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to, for example, a polymer of amino acid residues as displayed by an amino acid sequence. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The essential property of such analogs of naturally occurring amino acids is that when incorporated into a protein, the protein is specifically reactive with antibodies raised against the same protein consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide", and "protein" also include modifications, including but not limited to glycosylation, lipid attachment, sulfation, γ-carboxylation of glutamic acid residues, hydroxylation, and ADP-ribosylation.

[0061] The term "enzyme" as used herein refers to a protein having catalytic function. In cases where a protein catalyzes a biological reaction, the terms "protein" and "enzyme" may be used interchangeably herein. When an enzyme is referred to with reference to the Enzyme Commission (EC), the EC is such a classification where enzymes are classified or may be classified according to the enzyme nomenclature provided by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB), which can be found at http: / / www.chem.qmul.ac.uk / iubmb / enzyme / . It is intended to include other suitable enzymes that have not yet been classified in the designated class but can be so classified.

[0062] If a protein or nucleic acid sequence (such as a gene) is referred to herein by reference to an accession number, unless otherwise specified, the number is specifically used to refer to the protein or nucleic acid sequence (gene) having the sequence that can be found via www.ncbi.nlm.nih.gov / (available as of October 1, 2020).

[0063] Each nucleic acid sequence encoding a polypeptide herein also includes any conservatively modified variants thereof. By reference to the genetic code, this includes every possible silent variation of the nucleic acid. The term "conservatively modified variant" applies to both amino acid and nucleic acid sequences. With respect to a particular nucleic acid sequence, conservatively modified variants are those nucleic acids that, due to the degeneracy of the genetic code, encode the same amino acid sequence or a conservatively modified variant of the amino acid sequence. The term "degeneracy of the genetic code" refers to the fact that a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at each position where a codon specifies alanine, the codon can be changed to any of the corresponding codons described without changing the encoded polypeptide. Such nucleic acid variations are "silent variations" and represent one type of conservatively modified variation.

[0064] As used herein, a "functional homolog" (or simply "homolog") of a polypeptide and / or amino acid sequence having a specific sequence (e.g., "SEQ ID NO:X") or of a certain gene refers to a polypeptide and / or amino acid sequence that includes the said specific sequence, or to a nucleic acid sequence that includes the polypeptide and / or amino acid sequence encoding the said specific sequence, provided that one or more amino acids are mutated, substituted, deleted, added, and / or inserted, and the polypeptide has (qualitatively) the same enzyme function for substrate conversion.

[0065] As used herein, a "functional homolog" (or simply "homolog") of a polynucleotide and / or nucleic acid sequence having a specific sequence (e.g., "SEQ ID NO:X") refers to a polynucleotide and / or nucleic acid sequence that contains the said specific sequence, provided that one or more nucleic acids are mutated, substituted, deleted, added, and / or inserted, and the polynucleotide encodes a polypeptide sequence having (qualitatively) the same enzymatic function for substrate conversion. With respect to nucleic acid sequences, the term functional homolog is intended to include nucleic acid sequences that differ from another nucleic acid sequence due to the degeneracy of the genetic code and encode the same polypeptide sequence.

[0066] Sequence identity is defined herein as a relationship between two or more amino acid (polypeptide or protein) sequences or between two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Typically, sequence identity or similarity is compared over the entire length of the sequences being compared. In the art, "identity" also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by matches between strings of such sequences.

[0067] When exhibiting a certain level of similarity, amino acid or nucleotide sequences are said to be homologous. The fact that two sequences are homologous indicates a common evolutionary origin. Whether two homologous sequences are more closely related or more distantly related is indicated by the "percent identity" or "percent similarity", which are high or low, respectively. Although controversial, "level of homology" or "percent homology" are often used interchangeably to indicate "percent identity" or "percent similarity". The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using mathematical algorithms. Those skilled in the art will be aware of the fact that several different computer programs are available for aligning two sequences and determining the homology between the two sequences (Kruskal et al., "An overview of sequence comparison: Time warps, string edits, and macromolecules", ["Sequence comparison overview: Time warps, string edits, and macromolecules"], (1983), Society for Industrial and Applied Mathematics (SIAM) [Industrial and Applied Mathematics Society (SIAM)], Vol. 25, No. 2, pp. 201-237 and the handbook edited by D. Sankoff and J.B. Kruskal (editors), "Time warps, string edits and macromolecules: the theory and practice of sequence comparison", ["Time warps, string edits and macromolecules: the theory and practice of sequence comparison"], (1983), pp. 1-44, published by Addison-Wesley Publishing Company, Massachusetts USA [Addison-Wesley Publishing Company, Massachusetts, USA]).

[0068] The Needleman and Wunsch algorithm can be used to align two sequences to determine the percentage identity between two amino acid sequences. (Needleman et al., "A General Method Applicable to the Search for Similarities in the Amino Acid Sequence of Two Proteins" (1970) J. Mol. Biol. Vol. 48, pp. 443-453). This algorithm aligns amino acid sequences as well as nucleotide sequences. The Needleman-Wunsch algorithm has been implemented in the computer program NEEDLE. For the purposes of the present invention, the NEEDLE program from the EMBOSS package (version 2.8.0 or higher, see Rice et al., "EMBOSS: The European Molecular Biology Open Software Suite", (2000), Trends in Genetics Vol. 16, (6) pp. 276-277, http: / / emboss.bioinformatics.nl / ) is used. For protein sequences, EBLOSUM62 is used as the substitution matrix. For nucleotide sequences, EDNAFULL is used. Other matrices can be specified. Optional parameters for amino acid sequence alignment are a gap opening penalty of 10 and a gap extension penalty of 0.5. Those skilled in the art will understand that all these different parameters will produce slightly different results, but the overall percentage identity between the two sequences does not change significantly when different algorithms are used.)

[0069] Homology or identity is the percentage of identical matches over the total alignment region between two complete sequences including any gaps or extensions. Homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment that show the same amino acid in both sequences divided by the total length of the alignment including gaps. Identity as defined herein can be obtained from NEEDLE and is labeled "IDENTITY" in the output of the program.)

[0070] The homology or identity between two aligned sequences is calculated as follows: the number of corresponding positions in the alignment that show the same amino acid in the two sequences is divided by the total length of the alignment after subtracting the total number of gaps in the alignment. Identity as defined herein can be obtained from NEEDLE using the NOBRIEF option and is labeled as "longest-identity" in the output of the program.

[0071] Variants of the nucleotide or amino acid sequences disclosed herein can also be defined as nucleotide or amino acid sequences that have one or more mutations, substitutions, insertions, and / or deletions as compared to the nucleotide or amino acid sequences specifically disclosed herein (e.g., in the sequence listing).

[0072] Optionally, when determining the degree of amino acid similarity, one of ordinary skill in the art can also consider so-called "conservative" amino acid substitutions, which will be clear to one of ordinary skill in the art. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, a group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids with aliphatic-hydroxy side chains is serine and threonine; a group of amino acids with amide-containing side chains is asparagine and glutamine; a group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids with basic side chains is lysine, arginine, and histidine; and a group of amino acids with sulfur-containing side chains is cysteine and methionine. In one embodiment, the group of conservative amino acid substitutions is: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitution variants of the amino acid sequences disclosed herein are variants in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. In one embodiment, the conservative substitutions for each naturally occurring amino acid are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0073] The nucleotide sequences of the present invention can also be defined by their ability to hybridize, under moderate hybridization conditions or preferably under stringent hybridization conditions, to portions of the specific nucleotide sequences disclosed herein. Stringent hybridization conditions are defined herein as conditions that allow nucleic acid sequences of at least about 25 nucleotides, preferably about 50, 75, or 100 nucleotides, and most preferably about 200 or more nucleotides to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with comparable ionic strength) at a temperature of about 65°C, and to be washed in a solution containing about 0.1 M or less salt (preferably 0.2x SSC or any other solution with comparable ionic strength) at 65°C. Preferably, the hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, the washing is carried out for at least one hour, with the washing solution being replaced at least twice. These conditions will generally allow specific hybridization of sequences having about 90% or higher sequence identity. Moderate conditions are defined herein as conditions that allow nucleic acid sequences of at least 50 nucleotides, preferably about 200 or more nucleotides, to hybridize in a solution containing about 1 M salt (preferably 6x SSC or any other solution with comparable ionic strength) at a temperature of about 45°C, and to be washed in a solution containing about 1 M salt (preferably 6x SSC or any other solution with comparable ionic strength) at room temperature. Preferably, the hybridization is carried out overnight, i.e., for at least 10 hours; and preferably, the washing is carried out for at least one hour, with the washing solution being replaced at least twice. These conditions will generally allow specific hybridization of sequences having up to 50% sequence identity. Those skilled in the art will be able to modify these hybridization conditions in order to specifically identify sequences with identities varying between 50% and 90%.

[0074] "Expression" refers to the transcription of a gene into structural RNA (rRNA, tRNA) or messenger RNA (mRNA), followed by translation into a protein.

[0075] "Overexpression" refers to the expression of a gene (correspondingly a nucleic acid sequence) in a recombinant cell that exceeds its expression in the corresponding wild-type cell. Such overexpression can be arranged, for example, by increasing the transcription frequency of one or more nucleic acid sequences, e.g., by operably linking the nucleic acid sequence to a promoter functional in the recombinant cell; and / or by increasing the copy number of a certain nucleic acid sequence.

[0076] The term "upregulation" and its variants refer to the process by which a cell increases the amount of a cellular component such as RNA or protein. Such upregulation can be in response to or caused by genetic modification.

[0077] In this context, the term "pathway" or "metabolic pathway" is understood to mean a series of chemical reactions in a cell for building and breaking down molecules.

[0078] A nucleic acid sequence (i.e., polynucleotide) or a protein (i.e., polypeptide) can be native or heterologous to the genome of a host cell.

[0079] "Native," "homologous," or "endogenous" with respect to a host cell means that a nucleic acid sequence is indeed naturally present in the genome of the host cell, or that a protein is naturally produced by that cell. The terms "native," "homologous," and "endogenous" are used interchangeably herein.

[0080] As used herein, "heterologous" or "exogenous" can refer to a nucleic acid sequence or a protein. For example, with respect to a host cell, "heterologous" can refer to a polynucleotide that does not naturally exist in the genome of the host cell in that manner, or a polypeptide or protein that is not naturally produced by that cell in that manner. A heterologous nucleic acid sequence is a nucleic acid derived from a foreign species, or if from the same species, has been substantially modified in composition and / or genomic locus relative to its natural form by deliberate human intervention. For example, a promoter operably linked to a native structural gene is from a species different from the species from which the structural gene is derived, or if from the same species, one or both have been substantially modified relative to their original forms. A heterologous protein can be derived from a foreign species, or if from the same species, has been substantially modified relative to its original form by deliberate human intervention. That is, heterologous protein expression involves the expression of a protein that is not naturally expressed in that manner in a host cell. The term "heterologous expression" refers to the expression of a heterologous nucleic acid in a host cell. The expression of heterologous proteins in eukaryotic host cell systems such as E. coli is well known to those skilled in the art. A polynucleotide comprising a nucleic acid sequence encoding a certain protein or enzyme having a specific activity can be expressed in such a eukaryotic system. In some embodiments, transformed / transfected cells can be used as an expression system for expressing an enzyme. The expression of heterologous proteins in E. coli is well known. Published by Cold Spring Harbor Laboratory is a recognized work that describes various methods that can be used to express proteins in E. coli.

[0081] As used herein, a "promoter" is a DNA sequence that directs the transcription of a (structural) gene or other (partial) nucleic acid sequence. Appropriately, the promoter is located in the 5' region of the gene, near the transcription start site of the (structural) gene. The promoter sequence can be constitutive, inducible, or repressible. In one embodiment, no (external) inducer is required.

[0082] As used herein, the term "vector" includes references to both autosomal expression vectors and integration vectors for integration into a chromosome.

[0083] The term "expression vector" refers to a linear or circular DNA molecule that contains a segment encoding a polypeptide of interest, which is under the control (i.e., operably linked) of additional nucleic acid segments that provide for its transcription. Such additional segments can include promoter and terminator sequences and can optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, etc. Expression vectors are usually derived from plasmid or viral DNA or can contain elements of both.

[0084] "Plasmid" refers to an extrachromosomal DNA that replicates autonomously, does not integrate into the genome of a microorganism, and is usually circular in nature.

[0085] As used herein, "host cell" is understood to mean a cell (such as an Escherichia coli cell) that will be transformed with one or more nucleic acid sequences encoding one or more heterologous proteins to create a transformed cell (also referred to as a recombinant cell). For example, the transformed cell can contain a vector and can support the replication and / or expression of the vector.

[0086] As used herein, "transformation" refers to the insertion of an exogenous polynucleotide into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The exogenous polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid) or alternatively can integrate into the host cell genome. As used herein, "transformation" refers to the insertion of an exogenous polynucleotide (i.e., an exogenous nucleic acid sequence) into a host cell, regardless of the method used for insertion, such as direct uptake, transduction, f-conjugation, or electroporation. The exogenous polynucleotide can be maintained as a non-integrating vector (e.g., a plasmid) or alternatively can integrate into the host cell genome.

[0087] The present disclosure will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present disclosure and not for limiting the scope of the present disclosure. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can all be obtained from commercial sources unless otherwise specified.

[0088] In the following embodiments, the strain Escherichia coli BW25113 was purchased from the Escherichia coli Genetic Stock Center CGSC at Yale University, USA. The strains Pseudomonas putida KT2440, Pseudomonas aeruginosa PAO1, and Corynebacterium glutamicum ATCC 13032 were purchased from ATCC.

[0089] In the present invention, the D-lactate dehydrogenase ldhA gene is as shown by eco:b1380 in the KEGG database (https: / / www.genome.jp / kegg / ).

[0090] In the present invention, the leucine dehydrogenase PpleuDH gene is as shown by ppu:PP_4617 in the KEGG database.

[0091] In the present invention, the quinone-dependent D-lactate dehydrogenase dld gene is as shown by eco:b1380 in the KEGG database.

[0092] In the present invention, the 2-ketoisocaproate dehydrogenase Ppbkd complex is composed of the gene expressions of ppu:PP_4401, ppu:PP_4402, ppu:PP_4403, and ppu:PP_4404 in the KEGG database shown as a complex.

[0093] In the present invention, the L-lactate dehydrogenase lldD gene is as shown by eco:b3605 in the KEGG database.

[0094] In the present invention, the isovaleryl-CoA dehydrogenase Ppivd gene is as shown by ppu:PP_4064 in the KEGG database.

[0095] In the present invention, the pyruvate oxidase poxB gene is as shown by eco:b1380 in the KEGG database.

[0096] In the present invention, the enoyl-CoA hydratase Ppech gene is as shown by ppu:PP_2136 in the KEGG database.

[0097] In the present invention, the pyruvate formate-lyase pflB gene is as shown by eco:b0903 in the KEGG database.

[0098] In the present invention, the acyl-CoA thioesterase EcpaaI gene is as shown by eco:b1396 in the KEGG database.

[0099] In the present invention, the 2-isopropylmalate synthase leuA gene is as shown by eco:b0074 in the KEGG database.

[0100] In the present invention, the branched-chain amino acid aminotransferase ilvE gene is as shown by eco:b3770 in the KEGG database.

[0101] In the present invention, the keto acid reductoisomerase ilvC gene is as shown by eco:b3774 in the KEGG database.

[0102] In the present invention, the acetolactate synthase ilvBN gene is as shown by eco: b3670 and eco:b3671 in the KEGG database.

[0103] In the present invention, the dihydroxyacid dehydratase ilvD gene is as shown by eco:b3771 in the KEGG database.

[0104] In the present invention, the pyruvate formate-lyase 4 tdcE gene is as shown by eco:b3114 in the KEGG database.

[0105] In the present invention, the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase Bafxpk gene is as shown by badl:BADO_0732 in the KEGG database.

[0106] In the present invention, the fumarate reductase flavoprotein subunit frdA gene is as shown by eco:b4154 in the KEGG database.

[0107] In the present invention, the phosphoacetyltransferase pta gene is as shown by eco:b2297 in the KEGG database.

[0108] In the present invention, the nucleotide sequence of the phosphotransferases subunit G (ptsG) gene is as shown by Gene ID: 947341 in Gene Bank, and the amino acid sequence of the phosphotransferases subunit G encoded by this gene is as shown by the reference sequence number NP_415619 in NCBI.

[0109] In the present invention, the glucose-6-phosphate dehydrogenase zwf gene is as shown by eco:b1852 in the KEGG database.

[0110] Those skilled in the art can understand that the genes or their functional homologs of the present disclosure include nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% sequence identity with the exemplified sequences, or amino acid sequences having one or more mutations, substitutions, insertions and / or deletions when compared with the amino acid sequences they encode.

[0111] Preferably, compared to the amino acid sequence encoded by a certain gene, the amino acid sequence encoded by any functional homolog of that gene has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 amino acid mutations, substitutions, insertions, and / or deletions.

[0112] Exemplary but not limiting, functional homologs of the PpleuDH gene shown in SEQ ID NO.5 include nucleic acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with any of those nucleic acid sequences, or their functional homologs include nucleic acid sequences having one or more mutations, substitutions, insertions, and / or deletions when compared to any of those nucleic acid sequences; preferably, compared to such nucleic acid sequences, the nucleic acid sequence of any such functional homolog has no more than 300, no more than 250, no more than 200, no more than 150, no more than 100, no more than 75, no more than 50, no more than 40, no more than 30, no more than 20, no more than 10, or no more than 5 nucleic acid mutations, substitutions, insertions, and / or deletions. More preferably, functional homologs of phosphoglucomutase include amino acid sequences having at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the polypeptide shown by SEQ ID NO.8.

[0113] Those skilled in the art can understand that other sequences include the above situations.

[0114] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0115] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0116] Unless otherwise specified herein, the nouns or terms used herein shall be understood according to the general knowledge and usage of those of ordinary skill in the art. Unless otherwise stated, the specific operating methods adopted in this application (including: preparation processes, experimental procedures, detection means, etc.) adopt conventional biochemical experiments, cell biology experiments, molecular biology experiments, gene editing (for example, recombinant DNA technology), zoological experiments and conventional technologies in related fields in the technical field. These technologies have been well described in the existing literature. For details, see Molecular Cloning: a Laboratory Manual, 4th Edition by Sam brook et al., Cold Spring Harbor Laboratory Press, 2012; Current Protocols in Molecular Biology by Ausubel et al., Wiley Online Publishing, updated irregularly; Embryonic Stem Cell Protocols, 3rd Edition by Kursad Turksen et al., Springer-Verlag, 2016; Essentials of Laboratory Animal Science: Principles and Practices by P. Nagarajan et al., Springer-Verlag, 2021; and Handbook of Laboratory Animal Science: Essential Principles and Practices, 4th Edition by Jann Hau et al., CRC Press, 2021.

[0117] Example 1. Construction of recombinant Escherichia coli strains EHM01-09, EHM11-17, and EHM21-27.

[0118] The preparation methods of the relevant strains were obtained according to the following steps (1)-(2):

[0119] (1) Starting from Escherichia coli BW25113, the expression cassette of the leucine dehydrogenase gene PpleuDH of Pseudomonas putida (Pp represents the abbreviation of Pseudomonas putida, the same below) was used to replace the NADH-dependent D-lactate dehydrogenase gene ldhA in this strain to obtain strain EHM01.

[0120] The specific steps are as follows:

[0121] (1-a) Preparation of the targeting fragment L-LeuDH

[0122] The DNA fragment for gene synthesis (GenScript) is as follows: from 5' to 3', it consists of the following in sequence: ldhAup (fragment 21), FRT-Kan-FRT (fragment 1), P119 promoter (fragment 2), PpleuDH (fragment 11), TrrnB terminator (fragment 3), and ldhAdown (fragment 22). ldhA-1 / ldhA-2 are used as primers, and the DNA fragment synthesized by gene is used as a template for PCR amplification to obtain the targeting fragment L-LeuDH.

[0123] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0124] The pKD46 plasmid (derived from the E. coli Genetic Stock Center CGSC at Yale University, USA) is transformed into E. coli BW25113 by the calcium chloride transformation method. After overnight culture at 30 °C on an LB plate containing ampicillin, clones are selected to obtain the recombinant E. coli BW25113 / pKD46 containing the plasmid pKD46. After induction with arabinose, BW25113 / pKD46 expresses three recombinant proteins of λ phage, and the host bacteria acquire the ability of homologous recombination. Then, competent cells of BW25113 / pKD46 are prepared by washing with 10% glycerol.

[0125] (1-c) Homologous recombination

[0126] The targeting fragment L-LeuDH prepared in (1-a) is electrotransformed into the competent cells of BW25113 / pKD46 prepared in (1-b), and cultured overnight at 37 °C on an LB plate containing kanamycin (concentration: 50 μg / ml). Clones are selected and genomic DNA is extracted. PCR amplification identification is performed using ldhA-3 / Kan-R as primers. An amplified target band of approximately 1000 bp is positive, and the positive clone is named EHM01-kan. The sequencing analysis results show that the genome of EHM01-kan contains the L-LeuDH fragment. EHM01-kan is cultured overnight at 42 °C to eliminate the temperature-sensitive plasmid pKD46.

[0127] (1-d) Elimination of resistance

[0128] The pCP20 plasmid (derived from the E. coli Genetic Stock Center CGSC at Yale University, USA) is transformed into EHM01-kan by the calcium chloride transformation method. After overnight culture at 30 °C on an LB plate containing ampicillin, the kanamycin resistance fragment is eliminated using the FLP recombinase on the pCP20 plasmid. After overnight culture at 42 °C, the temperature-sensitive plasmid pCP20 is eliminated.

[0129] (2) Obtaining of EHM02-09, EHM11-17, and EHM21-27 strains

[0130] The construction process of each strain in this step adopts exactly the same method as that in Example 1(1).

[0131] It includes the following strain modifications:

[0132] Starting from strain EHM01, the expression cassette of the quinone-dependent D-lactate dehydrogenase gene dld in this strain was replaced with the expression cassette of the Pseudomonas putida α-ketoisocaproate dehydrogenase complex gene Ppbkd (including four genes: PpbkdAA, PpbkdAB, PpbkdB, and PplpdV) to obtain strain EHM02.

[0133] Starting from strain EHM02, the expression cassette of the L-lactate dehydrogenase gene lldD in this strain was replaced with the expression cassette of the Pseudomonas putida isovaleryl-CoA dehydrogenase gene Ppivd to obtain strain EHM03.

[0134] Starting from strain EHM03, the pyruvate oxidase gene poxB in this strain was replaced with the expression cassette of the Pseudomonas putida enoyl-CoA hydratase gene Ppech to obtain strain EHM04.

[0135] Starting from strain EHM04, the pyruvate formate-lyase 1 gene pflB in this strain was replaced with the expression cassette of the Escherichia coli acyl-CoA thioesterase gene EcpaaI to obtain strain EHM05.

[0136] Starting from strain EHM01, the expression cassette of the quinone-dependent D-lactate dehydrogenase gene dld in this strain was replaced with the expression cassette of the mouse α-ketoisocaproate dioxygenase gene Mmkicd to obtain strain EHM06.

[0137] Starting from strain EHM06, the L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, and pyruvate formate-lyase gene pflB in this strain were knocked out in sequence to obtain strains EHM07, EHM08, and EHM09 in sequence.

[0138] Starting from strain EHM05, the branched-chain amino acid aminotransferase gene ilvE in this strain was replaced with the expression cassette of the Escherichia coli ketoacid reductoisomerase gene EcilvC (Ec represents the abbreviation of Escherichia coli E. coli, the same below), and at the same time, the promoter of its downstream dihydroxyacid dehydratase gene ilvD was replaced with the P119 promoter to obtain strain EHM11.

[0139] Starting from strain EHM11, the promoters of the 2-isopropylmalate synthase gene leuA, the acetolactate synthase genes ilvBN, the glucose transport system IIBC subunit gene ptsG, and the glucose-6-phosphate dehydrogenase gene zwf in this strain were successively replaced with the P119 promoter to obtain strains EHM12, EHM13, EHM14, and EHM15 in sequence.

[0140] Starting from strain EHM15, the pyruvate formate-lyase 4 gene tdcE in this strain was replaced with the expression cassette of the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene Bafxpk of Bifidobacterium adolescentis to obtain strain EHM16.

[0141] Starting from strain EHM16, the fumarate reductase flavoprotein A subunit gene frdA in this strain was replaced with the expression cassette of the Escherichia coli phosphoacetyltransferase gene Ecpta to obtain strain EHM17.

[0142] On the other hand, starting from strain EHM09, the branched-chain amino acid aminotransferase gene ilvE in this strain was replaced with the expression cassette of the Escherichia coli ketoacid reductoisomerase gene EcilvC, and at the same time, the promoter of the downstream dihydroxyacid dehydratase gene ilvD was replaced with the P119 promoter to obtain strain EHM21.

[0143] Starting from strain EHM21, the promoters of the 2-isopropylmalate synthase gene leuA, the acetolactate synthase genes ilvBN, the glucose transport system IIBC subunit gene ptsG, and the glucose-6-phosphate dehydrogenase gene zwf in this strain were successively replaced with the P119 promoter to obtain strains EHM22, EHM23, EHM24, and EHM25 in sequence.

[0144] Starting from strain EHM25, the pyruvate formate-lyase 4 gene tdcE in this strain was replaced with the expression cassette of the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene Bafxpk of Bifidobacterium adolescentis to obtain strain EHM26.

[0145] Starting from strain EHM26, the fumarate reductase flavoprotein A subunit gene frdA in this strain was replaced with the expression cassette of the Escherichia coli phosphoacetyltransferase gene Ecpta to obtain strain EHM27.

[0146] The difference in the construction process of each strain from that in Example 1 (1) is that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the strain information obtained are shown in Table 1.

[0147] Table 1. Construction process of EHM02-09, EHM11-17, EHM21-27

[0148]

[0149]

[0150]

[0151] Table 2. Gene editing fragments and sequences of Example 1

[0152] Serial number Fragment number Fragment name Sequence (5’-3’) SEQ ID NO. 1 Fragment 1 FRT-Kan-FRT aaatgggaaatttactgagccaatcccattccggggatccgtcgacctgcagttcgaagttcctattctctagaaagtataggaacttcagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttgaagttcctattccgaagttcctattctctagaaagtataggaacttcgaagcagctccagcctacaaaacatgaatgtcatgaaaatggtccc SEQ ID NO. 2 Fragment 2 P119 promoter atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQ ID NO. 3 Fragment 3 TrrnB terminator tattgagaattagaaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQ ID NO. 4 Fragment 4 RBS aggaggaattaacc SEQ ID NO. 5 Fragment 5 PpleuDH atgttcgcgctgatgcaaagcacccgtacccagtcactgcacctgttcaatgacccgcctacgggcctgaaagccgttgtggcaatccacagtgagcatttgggcccggccatgggggggtgccgctacctgccttacgccgatgacgaaagcgccatgaccgacgcgattcgcctggcccagggcatgagctacaaggcagcactggccggcttgccgatggggggtggcaaggcggtaatcatgcgcaacccgcatgtggaaaaccgcgcagcgctgttcgaggcctttggccgcttcatcgataccttgcatgggcgcttcatcatcgccgtggacagtggcacctcgaccttggacatggactgcattgcccacagcacgccctacgtgaccagcaccactgcatcgggcgacccatcgccacatgcggcgatgggggtgttcgcgggcatacgtgccacaacctcgttccggctgggcagcgatgacctgagaggcttgcgggtagcggtccaggggttgggcaatgttggttatgccctggcggagcaattgcatgcggtgggcgcggagctgctggtcagcgacttggacccggggcgggtgcggctggcgatggagcagttcgatgccaaaccggtgaccaacgatgcgttgatcagtaccccttgcgatatctttgcaccctgcggcgtgggcccggtactgaacgggcagagcgtgatgcaactgcgttgtgcggcagtggcgggggcggccaacaaccagctgactaccttgcaggtggcagaccagctggagtcgcgcggcatattgtatgcacctgactacgtgatcaatgccggtgggctgatctatgtggcactcacccaccgtggcgaagaccagcgcaccattactgcgcacctggcgcgaatcccttcacggctgaccgaagtgtttggccatgcgcaggcggagaagcgttcgccggcaagggtggcgcagatgttggcggagcggttgttgtatggctga SEQ ID NO. 6 Fragment 6 PpbkdAA atgaacgagtacgcccccctgcgtttgcatgtgcccgagcccaccggccggccaggctgccagaccgatttttcctacctgcgcctcaacgatgcaggtcaagcccgtaaacccgcgatcgatgtcgatgctgccgacactgccgacctgtcctacagcctggtccgcgtgctcgacgagcaaggcgatgcgcaaggcccctgggccgaagacatcgacccgcagatcctccgtcaaggcatgcgcgccatgctcaagacgcggatcttcgacagccgcatggtggttgcccagcgccagaagaagatgtccttctacatgcaaagcctgggcgaagaagccatcggcagcggccaggcgctggcgctgaaccgcaccgacatgtgcttcccgacctaccgccagcaaagcatcctgatggcccgcgacgtgtcgctggtcgagatgatctgccaactgctgtccaacgagcgcgaccccctcaagggccgccagttgccgatcatgtattcggtgcgcgaagccggcttcttcaccatcagcggcaacctggcgacccagttcgtgcaggcggtcggctgggccatggcatcggcgatcaagggcgataccaagatcgcctcggcatggatcggtgacggcgctactgccgagtcggacttccacaccgcccttacctttgcccacgtataccgcgccccggtcatcctcaacgtggtcaacaaccaatgggccatttccaccttccaggccatcgccggtggcgagtcgaccacctttgccggccgtggcgtgggttgcggtattgcttcgctgcgggttgacggcaacgacttcgtcgccgtgtacgctgcctcgcgctgggcggccgagcgcgcccgccgcggcctgggcccaagcctgatcgagtgggtcacctaccgtgccggcccgcactcgacgtcggacgacccctccaagtaccgccctgccgacgactggagccacttcccgctgggtgacccgatcgcccgcctgaagcagcacctgatcaagatcggccactggtccgaggaagaacaccaggccgtcacggccgagctcgaagctgcggtgattgccgcacagaaagaagccgagcagtacggcaccctggccaacgggcacatcccgagcgccgcctcgatgttcgaggatgtgtacaaggaaatgcccgaccacctgcgccgtcaacgccaggaactgggggtttga SEQ ID NO. 7 Fragment 7 PpbkdAB atggccaccactaccatgaccatgatccaggccctgcgctcggccatggatgtcatgcttgagcgcgacgacaatgtggtggtgtacggccaggacgtcggttacttcggcggcgtgttccgctgcaccgaaggcctgcagaacaagtacggcaaatcgcgcgtgttcgacgcgcccatctccgagagcggcatcgtcggtaccgccgtgggcatgggtgcctatggcctgcgcccggtggtggagatccagttcgccgactacttctacccggcctccgaccagatcgtctccgagctggcccgcctgcgttaccgttcggccggcgagttcattgccccgctgaccctgcgcatgccttgcggcggcggcatctatggcggccagactcacagccagagcccggaagcgatgttcacccaggtgtgcggcctgcgcaccgtgatgccgtccaacccttatgacgccaaaggcctgttgattgcctcgatcgaatgcgacgacccggtaatcttcctggagcccaaacgcctgtacaacggcccgttcgatggccaccacgaccgccctgtaaccccgtggtcgaagcacccgcacagcgccgtgcccgacggttattacaccgtaccgctggacaaggccgccattacccgccctggcaatgacgtgaccgtgctgacctacggcaccacggtgtacgtggcccaggtggccgccgaagaaagcggcgtcgatgccgaagtgatcgacctgcgcagcctgtggccgctggacctggacactatcgtcgagtcggtgaaaaagaccggccgttgcgtggtggtgcacgaggccacccgcacctgcggcttcggtgccgagctggtgtcgctggtgcaggagcactgcttccaccacctggaggcgccgatcgaacgcgtcaccggctgggacaccccctaccctcacgcacaggaatgggcttacttcccaggcccttcgcgggtaggtgcggcactgaaaaaggtcatggaggtctga SEQ ID NO. 8 Fragment 8 PpbkdB atgggcacgcacgtcatcaagatgccggacattggcgaaggcatcgcgcaggtcgagttggtggaatggttcgtcaaggtcggcgacatcatcgccgaggaccaggtggtggccgacgtcatgaccgacaaggccaccgtggaaatcccctcgccggtcagcggcaaggtgttggccctgggtggccagcccggggaagtgatggcggtcggtagcgaactgatccgcatcgaagtggaaggcagcggcaaccatgtggatgtgcctcagccaaaaccggtagaggccccggctgcccccattgcagccaagccggaaccgcagaaagacgtaaaacccgccgtgtaccaggcgcccgccaaccacgaagctgcgcccatcgtgccgcgccagccgggcgacaagccgctggcctcgcctgccgtgcgcaaacgcgccctggacgccggtatcgaactgcgttatgtgcatggtagcggcccggccgggcgtattctgcacgaagacctcgatgccttcatgagcaagccgcaaagcaatgccgggcaagcacctgatggttatgccaagcgcaccgacagcgagcaggtgccagtgatcggcctgcgccgcaagattgcccagcgcatgcaggacgccaaacgccgggtcgcgcacttcagttatgtcgaggaaatcgacgtcaccgccctggaggccctgcgccagcaactcaacagcaagcacggcgacagccggggcaagctgaccttgctgccattcctggtacgcgccctggtcgtggcgctgcgtgacttcccgcagatcaacgcgacctacgatgacgaagcgcagatcatcacccgccatggcgcggtgcatgtgggcattgccacccaaggtgacaacggcctgatggtgcccgtgctgcgccacgccgaagcgggcagcctgtgggccaatgccggcgagatttcgcgcctggccaacgctgcacgtaacaacaaggccagccgtgaagagctgtccggctcgaccatcaccctgaccagccttggcgccctgggtggcattgtcagcacgccggtggtcaacaccccggaagtggcaatcgtcggggtcaaccgcatggtcgaacggccagtggtgatcgacggccagatcgtcgtgcgcaagatgatgaacctgtccagctcgttcgaccaccgcgtggtcgatggcatggatgccgccctgttcatccaggccgtacgtggcctgctcgaacaacccgcctgcctgttcgtggagtga SEQ ID NO. 9 Fragment 9 PplpdV atgcaacagattatccagactaccctgttgatcatcggcggcggccctggcggctatgtagcagccatccgcgccgggcaactgggcattcctaccgtactggtggaaggccaggcactgggcggcacctgcctgaacatcggctgcatcccgtccaaggcgctgatccacgtggccgagcagtttcaccaggcctcgcgctttaccgaaccctcgccgctgggcatcagcgtggcttcgccgcgcctggacatcggccagagcgtcacctggaaggacggcattgtcgaccgcctgaccacaggtgttgccgccctgctgaaaaagcacggggtgaaagtggtgcatggttgggccaaggtactggacggcaagcaggtcgaggtcgatggccagcgtatccagtgcgagcatctgttgctggcgaccggttccagcagtgtcgaactgcctatgctgccgctgggtggcccggtgatttcctcgaccgaagccctggcgccgaaaaccctgccgcaacacctggtggtggtcggcggtggctatatcggcctggagctgggcattgcctatcgcaagctgggtgcacaggtgagtgtggtggaagcgcgggagcgcatcctgccgacctacgacagcgaattgaccgccccggtggccgagtcgctgaagaaactgggcatagcgttgcacctgggccacagcgtcgagggctacgaaaatggctgcctgctggccagcgacggcaagggtgggcaactgcgccttgaggccgaccaggtactggtggccgtgggacgccggccacgcaccaagggcttcaacctggaatgcctggacctgaagatgaacggcgccgccattgccatcgacgagcgctgtcacaccagcatgcacaacgtctgggccatcggcgacgtcgctggcgaaccgatgctggcgcaccgggccatggcccagggcgagatggtcgccgaaatcatcgccggcaaggcccgacgctttgaaccgacagcgattgccgccgtgtgctttaccgacccggaagtggtggtggtcggcaagaccccggaacaagccagccagcagggcctggactgcatcgtcgcgcagttcccgtttgccgccaatggccgggccatgagcctggaatcgaaaagcggtttcgtgcgggtggtggcgcgccgtgacaaccacctgatcgtgggttggcaggcggttggcgtggcggtctccgagctatccaccgcgtttgcccaatcgctggagatgggcgcgtgcctggaagatgtggccggtaccattcatgcccacccaacgctcggtgaagcggtacaggaagccgcactgcgcgccctgggccacgccttgcatatctga SEQ ID NO.10 Fragment 10 Ppivd atgcattacccctccctgaacttcgccctgggcgagaccatcgacatgctccgcgaccaggtgcgcaccttcgtcgccgctgaactggccccaagggccgcgcagatcgaccacgacaacctgttccccgccgacatgtggcgcaagttcggtgacatgggcctgctgggcatcaccgtaccggaagagtacggcggcgctggcctgggctacctggcccatgtggtgtcgatggaagagatcagccgtggctccgcctcggtggcgctgtcctacggcgcccattccaacctgtgcgtcaaccagatcaaccgcaacggcacccacgagcagaagctcaagtacctgcccaagctgatcagcggcgagcacatcggcgccttggccatgagcgagcccaatgccggttccgacgtggtgtcgatgaagctgcgcgcagaaaaacgcggcgatcactacgtgctcaacggcagcaagacctggatcaccaacggtcccgacgccaacacctacgtgatttacgccaagaccgacctggacaagggtgcgcacggcatcaccgcgttcatcgtcgagcgcgactggaaaggcttcagccgcagcaacaagttcgacaagctgggcatgcgcgggtccaacacctgcgagttgttcttcgatggcgtggaagtgccggcagagaacattctgggccagctcaacggcggcgtgcgcgtccttatgagcggcctggactacgaacgtgtggtgctgtccggcggcccgaccggcatcatgcaaagctgcatggacctggtggtgccgtatatccacgaccgcaagcaattcggccagagcatcggcgagttccagctgatccagggcaagattgccgacatgtacacccagctcaatgccagccgcgcctacctgtatgccgtggctcaggcgtgcgaccgtggcgaaaccacccgcaaggacgctgccggcgtgatcctgtacaccgccgagcgtgccacgcaaatggccctggaggcgatccagattcttggcggcaacggctatatcaacgaattcccggctggccgcctgttgcgcgacgccaagctgtacgaaatcggtgccggcaccagtgaaatccgccggatgctgatcggccgcgaactgttcaacgaaacccgctga SEQ ID NO.11 Fragment 11 Ppech atgatttacgaaggtaaagccatcacggttaaggctcttgaaagtggcatcgtcgagctcaagttcgacctcaagggtgagtccgtcaacaagttcaaccgccttaccctgaacgagctgcgccaggccgtcgatgccatccgggccgatgcttcggtcaagggcgtgatcgtcaggagtggcaaggacgtgttcatcgtcggcgccgacatcaccgagttcgtcgacaacttcaagctgcctgaggccgaactggtcgctggcaacctggaagccaatcgcatcttcaacgcgttcgaagacctcgaagtgccgaccgttgccgccatcaacggcatcgcgctgggcggcggcctggaaatgtgcctggcggccgactaccgggtcatgtccaccagcgccaggatcggcctgccggaagtcaagctgggtatctacccgggctttggcggtaccgtgcgcctgccgcgcctgatcggctcggacaacgccatcgagtggatcgccgccggcaaggaaaaccgtgccgaagatgccctgaaagtgggggccgtcgacgccgtggtcgcccctgagctgctgctggccggtgccctcgacctgatcaagcgtgccatcagtggcgagctggactacaaggccaagcgccagccgaagctggaaaagctcaagctcaatgccatcgagcagatgatggccttcgagactgccaagggcttcgtcgctggccaggccggcccgaactacccggccccggtcgaagcgatcaagagcatccagaaagccgccaacttcggtcgcgacaaggccctggaagtcgaagccgcaggctttgccaagctggccaagacctctgtcgccgagagcctgatcggcttgttcctcaacgatcaggaactcaagcgcaaggccaaggcgcatgacgagatcgcccacgacgtgaagcaggccgccgtgctcggcgccggcatcatgggcggcggtatcgcctaccagtcggcggtcaaaggtacgccgatcctgatgaaggacatccgcgaggaagccattcagctgggtctgaacgaggcctccaagttgcttggcaaccgcgtcgagaagggccgcctgaccccggccaagatggccgaggccctcaacgccattcgcccgaccctgtcctatggcgatttcgccaatgtcgacatcgtcgtcgaggctgtggtcgagaacccgaaggtcaagcaagcggtactggcggaagtggaaggccaggtgaaggacgatgcgatcctcgcttccaacacctctaccatctccatcaacctgctggccaaggcgctcaagcgcccggaaaacttcgtcggcatgcacttcttcaacccggtgcacatgatgccgctggttgaagtgatccgtggcgagaagtccagtgacgtggcggtcgccaccaccgtggcctacgccaagaaaatgggcaagaacccgatcgtggtcaacgactgcccgggctttttggtcaaccgcgtgctgttcccgtactttggcggttttgccaagctggtcagcgccggtgtcgacttcgtgcgcatcgacaaggtcatggagaagttcggctggccgatgggcccagcctacttgatggacgtggtcggcatcgacaccggccaccacggccgtgacgtcatggccgaaggcttcccggatcgcatgaaggacgagcgccgctcggcagtcgacgcgttgtacgaggccaaccgcctgggccagaagaacggtaagggcttctacgcctacgaaaccgacaagcgcggcaagccgaagaaggtcttcgatgccaccgtgctcgacgtgctcaaaccgatcgtgttcgagcagcgtgaagtcactgacgaagacatcatcaactggatgatggtcccgctgtgccttgagaccgtgcgttgcctggaagacggcatcgtcgaaaccgctgccgaagccgacatgggcctggtctacggcattggtttccctcccttccgcggtggtgcgctgcgttacatcgactcgatcggtgtggccgaattcgtcgccctggccgatcagtatgccgacctggggccgctgtaccacccgaccgccaagctgcgtgaaatggccaagaacggccagcgcttcttcaactga SEQ ID NO.12 Fragment 12 EcpaaI atgagtcataaggcctggcaaaatgcccatgcaatgtatgagaacgatgcctgcgccaaagcgcttggcatcgacattatctcaatggatgaaggctttgctgtagtgaccatgaccgtcactgcacaaatgcttaacggtcatcaaagttgccacggcgggcagctattttcactggctgatactgcctttgcctacgcctgcaatagccaggggctggcagccgtcgcttctgcctgcacgattgattttttgcgtccaggctttgccggagacaccttaactgctactgcgcaggtacgtcatcagggcaagcaaaccggtgtttacgacatcgaaattgttaaccaacaacaaaaaacggttgcgctgtttcgcggtaaatctcaccgcatcggcggcaccattacaggagaagcctga SEQ ID NO.13 Fragment 13 Mmkicd atgacaacctacaacaacaaaggaccaaagcctgagagaggccggttcctccatttccactcggtgaccttctgggttggcaatgccaagcaggctgcttccttctactgcaacaagatgggctttgaacctctggcctacaggggcctagagactggctcccgggaggtagtcagccacgtcatcaagcgagggaaaattgtgtttgttctctgctctgctctcaatccctggaacaaagagatgggcgaccacttggtgaagcatggcgacggggtgaaagacatcgcattcgaggtggaagactgcgaccacattgtgcagaaagctcgagaacggggcgccaaaattgtgcgggagccatgggtggagcaagacaaatttgggaaggtgaagtttgctgtgctgcagacgtatggagataccacacacaccctggtggagaagatcaactacactggccgtttcttacctggattcgaggccccaacatacaaggataccctgcttccaaaactacccagatgtaaccttgagatcattgaccacattgtaggcaaccaacccgaccaagaaatgcagtctgcctcagaatggtacctgaaaaacctgcagttccaccggttctggtccgtggacgacacgcaggtgcacacggagtacagctctctgcgctccattgtggtgaccaactacgaggaatccatcaaaatgcccatcaacgagccagctccgggcaggaagaagtctcagatccaggaatatgtggactataatgggggtgctggggtccagcacatcgctctcaagacggaagacatcatcacagcaatccgccacttgagggagcgaggcacggagttcttggcagccccatcttcttactacaaactgcttcgggagaatctcaagtcagccaagatccaggtgaaagagagcatggacgtcctggaggagctgcatatcctagtcgactatgacgagaaaggctacctcctacagatcttcaccaagcccatgcaggaccggcccacactcttcctggaagtcattcaacgtcacaaccaccagggctttggagcgggcaacttcaactctctgttcaaggcgttcgaggaggagcaagccctacggggcaacctcactgacctggagcccaatggtgtgaggtctggaatgtaa SEQ ID NO.14 Fragment 14 EcilvC atggctaactacttcaatacactgaatctgcgccagcagctggcacagctgggcaaatgtcgctttatgggccgcgatgaattcgccgatggcgcgagctaccttcagggtaaaaaagtagtcatcgtcggctgtggcgcacagggtctgaaccagggcctgaacatgcgtgattctggtctcgatatctcctacgctctgcgtaaagaagcgattgccgagaagcgcgcgtcctggcgtaaagcgaccgaaaatggttttaaagtgggtacttacgaagaactgatcccacaggcggatctggtgattaacctgacgccggacaagcagcactctgatgtagtgcgcaccgtacagccactgatgaaagacggcgcggcgctgggctactcgcacggtttcaacatcgtcgaagtgggcgagcagatccgtaaagatatcaccgtagtgatggttgcgccgaaatgcccaggcaccgaagtgcgtgaagagtacaaacgtgggttcggcgtaccgacgctgattgccgttcacccggaaaacgatccgaaaggcgaaggcatggcgattgccaaagcctgggcggctgcaaccggtggtcaccgtgcgggtgtgctggaatcgtccttcgttgcggaagtgaaatctgacctgatgggcgagcaaaccatcctgtgcggtatgttgcaggctggctctctgctgtgcttcgacaagctggtggaagaaggtaccgatccagcatacgcagaaaaactgattcagttcggttgggaaaccatcaccgaagcactgaaacagggcggcatcaccctgatgatggaccgtctctctaacccggcgaaactgcgtgcttatgcgctttctgaacagctgaaagagatcatggcacccctgttccagaaacatatggacgacatcatctccggcgaattctcttccggtatgatggcggactgggccaacgatgataagaaactgctgacctggcgtgaagagaccggcaaaaccgcgtttgaaaccgcgccgcagtatgaaggcaaaatcggcgagcaggagtacttcgataaaggcgtactgatgattgcgatggtgaaagcgggcgttgaactggcgttcgaaaccatggtcgattccggcatcattgaagagtctgcatattatgaatcactgcacgagctgccgctgattgccaacaccatcgcccgtaagcgtctgtacgaaatgaacgtggttatctctgataccgctgagtacggtaactatctgttctcttacgcttgtgtgccgttgctgaaaccgtttatggcagagctgcaaccgggcgacctgggtaaagctattccggaaggcgcggtagataacgggcaactgcgtgatgtgaacgaagcgattcgcagccatgcgattgagcaggtaggtaagaaactgcgcggctatatgacagatatgaaacgtattgctgttgcgggttaa SEQ ID NO.15 Fragment 15 Bafxpk atgacgagtcctgttattggcaccccttggaagaagctgaacgctccggtttccgaggaagctatcgaaggcgtggataagtactggcgcgcagccaactacctctccatcggccagatctatctgcgtagcaacccgctgatgaaggagcctttcacccgcgaagacgtcaagcaccgtctggtcggtcactggggcaccaccccgggcctgaacttcctcatcggccacatcaaccgtctcattgctgatcaccagcagaacactgtgatcatcatgggcccgggccacggcggcccggctggtaccgctcagtcctacctggacggcacctacaccgagtacttcccgaacatcaccaaggatgaggctggcctgcagaagttcttccgccagttctcctacccgggtggcatcccgtcccactacgctccggaaaccccgggctccatccacgaaggcggcgagctgggttacgccctgtcccacgcctacggcgctgtgatgaacaacccgagcctgttcgtcccggccatcgtcggcgacggcgaagctgagaccggcccgctggccaccggctggcagtccaacaagctcatcaacccgcgcaccgacggtatcgtgctgccgatcctgcacctcaacggctacaagatcgccaacccgaccatcctgtcccgcatctccgacgaagagctccacgagttcttccacggcatgggctatgagccgtacgagttcgtcgctggcttcgacaacgaggatcacctgtcgatccaccgtcgtttcgccgagctgttcgagaccgtcttcgacgagatctgcgacatcaaggccgccgctcagaccgacgacatgactcgtccgttctacccgatgatcatcttccgtaccccgaagggctggacctgcccgaagttcatcgacggcaagaagaccgagggctcctggcgttcccaccaggtgccgctggcttccgcccgcgataccgaggcccacttcgaggtcctcaagaactggctcgagtcctacaagccggaagagctgttcgacgagaacggcgccgtgaagccggaagtcaccgccttcatgccgaccggcgaactgcgcatcggtgagaacccgaacgccaacggtggccgcatccgcgaagagctgaagctgccgaagctggaagactacgaggtcaaggaagtcgccgagtacggccacggctggggccagctcgaggccacccgtcgtctgggcgtctacacccgcgacatcatcaagaacaacccggactccttccgtatcttcggaccggatgagaccgcttccaaccgtctgcaggccgcttacgacgtcaccaacaagcagtgggacgccggctacctgtccgctcaggtcgacgagcacatggctgtcaccggccaggtcaccgagcagctttccgagcaccagatggaaggcttcctcgagggctacctgctgaccggccgtcacggcatctggagctcctatgagtccttcgtgcacgtgatcgactccatgctgaaccagcacgccaagtggctcgaggctaccgtccgcgagattccgtggcgcaagccgatctcctccatgaacctgctcgtctcctcccacgtgtggcgtcaggatcacaacggcttctcccaccaggatccgggtgtcacctccgtcctgctgaacaagtgcttcaacaacgatcacgtgatcggcatctacttcccggtggattccaacatgctgctcgctgtggctgagaagtgctacaagtccaccaacaagatcaacgccatcatcgccggcaagcagccggccgccacctggctgaccctggacgaagctcgcgccgagctcgagaagggtgctgccgagtggaagtgggcttccaacgtgaagtccaacgatgaggctcagatcgtgctcgccgccaccggtgatgttccgactcaggaaatcatggccgctgccgacaagctggacgccatgggcatcaagttcaaggtcgtcaacgtggttgacctggtcaagctgcagtccgccaaggagaacaacgaggccctctccgatgaggagttcgctgagctgttcaccgaggacaagccggtcctgttcgcttaccactcctatgcccgcgacgtgcgtggtctgatctacgatcgcccgaaccacgacaacttcaacgttcacggctatgaggagcagggctccaccaccaccccgtacgacatggttcgcgtgaacaacatcgatcgctacgagctccaggctgaagctctgcgcatgatcgacgctgacaagtacgccgacaagatcaacgagctcgaggccttccgtcaggaagccttccagttcgctgtcgacaacggctacgatcacccggattacaccgactgggtctactccggtgtcaacaccaacaagcagggtgctatctccgctaccgccgcaaccgctggcgataacgagtga SEQ ID NO.16 Fragment 16 Ecpta gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtctgaccagcgtcagccttggcgtgatccgtgcaatggaacgcaaaggcgttcgtctgagcgttttcaaacctatcgctcagccgcgtaccggtggcgatgcgcccgatcagactacgactatcgtgcgtgcgaactcttccaccacgacggccgctgaaccgctgaaaatgagctacgttgaaggtctgctttccagcaatcagaaagatgtgctgatggaagagatcgtcgcaaactaccacgctaacaccaaagacgctgaagtcgttctggttgaaggtctggtcccgacacgtaagcaccagtttgcccagtctctgaactacgaaatcgctaaaacgctgaatgcggaaatcgtcttcgttatgtctcagggcactgacaccccggaacagctgaaagagcgtatcgaactgacccgcaacagcttcggcggtgccaaaaacaccaacatcaccggcgttatcgttaacaaactgaacgcaccggttgatgaacagggtcgtactcgcccggatctgtccgagattttcgacgactcttccaaagctaaagtaaacaatgttgatccggcgaagctgcaagaatccagcccgctgccggttctcggcgctgtgccgtggagctttgacctgatcgcgactcgtgcgatcgatatggctcgccacctgaatgcgaccatcatcaacgaaggcgacatcaatactcgccgcgttaaatccgtcactttctgcgcacgcagcattccgcacatgctggagcacttccgtgccggttctctgctggtgacttccgcagaccgtcctgacgtgctggtggccgcttgcctggcagccatgaacggcgtagaaatcggtgccctgctgctgactggcggttacgaaatggacgcgcgcatttctaaactgtgcgaacgtgctttcgctaccggcctgccggtatttatggtgaacaccaacacctggcagacctctctgagcctgcagagcttcaacctggaagttccggttgacgatcacgaacgtatcgagaaagttcaggaatacgttgctaactacatcaacgctgactggatcgaatctctgactgccacttctgagcgcagccgtcgtctgtctccgcctgcgttccgttatcagctgactgaacttgcgcgcaaagcgggcaaacgtatcgtactgccggaaggtgacgaaccgcgtaccgttaaagcagccgctatctgtgctgaacgtggtatcgcaacttgcgtactgctgggtaatccggcagagatcaaccgtgttgcagcgtctcagggtgtagaactgggtgcagggattgaaatcgttgatccagaagtggttcgcgaaagctatgttggtcgtctggtcgaactgcgtaagaacaaaggcatgaccgaaaccgttgcccgcgaacagctggaagacaacgtggtgctcggtacgctgatgctggaacaggatgaagttgatggtctggtttccggtgctgttcacactaccgcaaacaccatccgtccgccgctgcagctgatcaaaactgcaccgggcagctccctggtatcttccgtgttcttcatgctgctgccggaacaggtttacgtttacggtgactgtgcgatcaacccggatccgaccgctgaacagctggcagaaatcgcgattcagtccgctgattccgctgcggccttcggtatcgaaccgcgcgttgctatgctctcctactccaccggtacttctggtgcaggtagcgacgtagaaaaagttcgcgaagcaactcgtctggcgcaggaaaaacgtcctgacctgatgatcgacggtccgctgcagtacgacgctgcggtaatggctgacgttgcgaaatccaaagcgccgaactctccggttgcaggtcgcgctaccgtgttcatcttcccggatctgaacaccggtaacaccacctacaaagcggtacagcgttctgccgacctgatctccatcgggccgatgctgcagggtatgcgcaagccggttaacgacctgtcccgtggcgcactggttgacgatatcgtctacaccatcgcgctgactgcgattcagtctgcacagcagcagtaa SEQ ID NO.17 Fragment 21 ldhAup attaaatttgaaattttgtaaaatatttttagtagcttaaatgtgattcaacatcactggagaaagtctt SEQ ID NO.18 Fragment 22 ldhAdown agaatagaggatgaaaggtcattggggattatctgaatcagctcccctggaatgcaggggagcggcaaga SEQ ID NO.19 Fragment 23 dldup actcgctgaattgttatacaaggcgctattctagtttgtgatattttttcgccaccacaaggagtggaaa SEQ ID NO.20 Fragment 24 dlddown gcggcggcggggcagacggcacagaacgattaagtgaattcggatggcgatactctgccatccgtaattt SEQ ID NO.21 Fragment 25 lldDup ggctcgccacgcacggattacccgcctgcccggtgagcataatgagcattcgagggagaaaaacgcatga SEQ ID NO.22 Fragment 26 lldDdown gggagtacatacagcgccgaacggtcccctctccctgagggagagggttagggtgagggggcgcaaacga SEQ ID NO.23 Fragment 27 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQ ID NO.24 Fragment 28 poxBdown gtcgggtaacggtatcactgcgtaaatcaatcatggcatgtccttattatgacgggaaatgccacccttt SEQ ID NO.25 Fragment 29 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQ ID NO.26 Fragment 30 pflBdown ctaaaaaaggccccactttcgtggagcctttattgtacgctttttactgtacgatttcagtcaaatctaa SEQ ID NO.27 Fragment 31 ilvEup cacgttgccatctgccagagcacaaccacatcacaacaaatccgcgcctgagcgcaaaaggaatataaaa SEQ ID NO.28 Fragment 32 ilvEdown cgcgccacagcgcacgagcacccgccatattacgaccatgagtggtggtggcggaacggtacttaggcat SEQ ID NO.29 Fragment 33 leuAup agcggcatccagcattaagccagcacgcagtcaaacaaaaaacccgcgccattgcgcgggtttttttatg SEQ ID NO.30 Fragment 34 leuAdown tcaagcttgcctgtaacgcctgttcaccgtcgcgcaatgtggtatcgaaaataatgacttgctggctcat SEQ ID NO.31 Fragment 35 ilvBNup tggtggtcgtcggcaatgcgccgtagggactggaacaacacacgattccaaaaccccgccggcgcaaacc SEQ ID NO.32 Fragment 36 ilvBNdown ccaggaaatgaacgataaattctgcgccggtaaagcgcttacgcgtcgatgttgtgcccgaacttgccat SEQ ID NO.33 Fragment 39 ptsGup gcgaggctctccccccttgccacgcgtgagaacgtaaaaaaagcacccatactcaggagcactctcaatt SEQ ID NO.34 Fragment 40 ptsGdown atcaattctgaataacacctgtaaaaaaggcagccatctggctgccttagtctccccaacgtcttacgga SEQ ID NO.35 Fragment 41 zwfup agtgcaccgtaagaaaattacaagtataccctggcttaagtaccgggttagttaacttaaggagaatgac SEQ ID NO.36 Fragment 42 zwfdpwn taaaaattgttctacaatctgcgcaagatcatgttaccggtaaaataaccataaaggataagcgcagata SEQ ID NO.37 Fragment 43 tdcEup tttaggcaaagttaacgcgcccgcagaatttgcataatttagttgaagtattgtagagagattatttttc SEQ ID NO.38 Fragment 44 tdcEdown ctgaacataagggccgattgcgcctggggcacgttgcgtttcgataatctttttcatacatcctccggcg SEQ ID NO.39 Fragment 45 frdAup cagaccgtaactttcaggtacttaccctgaagtacgtggctgtgggataaaaacaatctggaggaatgtc SEQ ID NO.40 Fragment 46 frdAdown gaatgcgctatgcggtgcggtatcgacttccgggttatagcgcaccacctcaattttcaggtttttcatc

[0153] Table 3. Primers of Example 1

[0154] Primer Sequence (5'-3') ldhA-1 attaaatttgaaattttgtaaaata ldhA-2 agaatagaggatgaaaggtcattgg ldhA-3 atgaatttttcaatatcgccatagctttca dld-1 actcgctgaattgttatacaaggcg dld-2 gcggcggcggggcagacggcacaga dld-3 cagtttattgtctgaattttcaaaatattc lldD-1 ggctcgccacgcacggattacccgc lldD-2 gggagtacatacagcgccgaacggt lldD-3 caccaccatgaaacgattcgatgaagatca poxB-1 tcccatcccttccccctccgtcaga poxB-2 gtcgggtaacggtatcactgcgtaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcg pflB-2 ctaaaaaaggccccactttcgtgga pflB-3 gttgacatactgggtcatttacctgcgtga ilvE-1 cacgttgccatctgccagagcacaa ilvE-2 cgcgccacagcgcacgagcacccgc ilvE-3 agtcagttaaataaactggtggacgtcgca leuA-1 agcggcatccagcattaagccagca leuA-2 tcaagcttgcctgtaacgcctgttc leuA-3 aacgcatcttctttgcgcggtagacgagtg ilvB-1 tggtggtcgtcggcaatgcgccgta ilvB-2 ccaggaaatgaacgataaattctgc ilvB-3 catccgccgcagtggtcgtcgtgcgtgtgg ptsG-1 gcgaggctctccccccttgccacgc ptsG-2 atcaattctgaataacacctgtaaa ptsG-3 aataaagggcgcttagatgccctgtacacg zwf-1 agtgcaccgtaagaaaattacaagt zwf-2 taaaaattgttctacaatctgcgca zwf-3 acagttttcgcaagctcgtaaaagcagtac tdcE-1 tttaggcaaagttaacgcgcccgca tdcE-2 ctgaacataagggccgattgcgcct tdcE-3 agaaaaaatgattgctttggatgccattca frdA-1 cagaccgtaactttcaggtacttac frdA-2 gaatgcgctatgcggtgcggtatcg frdA-3 acctataaaggagcagtggaatagcgttcg Kan-R tcgtcaagaaggcgatagaa

[0155] Example 2. Preparation of recombinant Pseudomonas putida producing HMB

[0156] In Example 2, Pseudomonas putida KT2440 was used as the starting strain, and through gene editing, recombinant strains HM705 and HM806 for synthesizing HMB were prepared. The genotypes of the recombinant strains are shown in Table 4.

[0157] The preparation methods of the related strains were obtained according to the following steps (1)-(2):

[0158] (1) Enhance the expression of the Pseudomonas putida leucine dehydrogenase gene (hereinafter referred to as PpleuDH) by promoter replacement

[0159] Starting from Pseudomonas putida KT2440, the promoter of the leucine dehydrogenase PpleuDH gene in this strain was replaced with the constitutive promoter P 119 , to obtain recombinant Pseudomonas putida HM701. The specific steps are as follows:

[0160] (1-a) Construction of the plasmid required for promoter replacement:

[0161] Using pK18mobSacB (Zhuangmeng Biotech, ZK1642) as a template, the pK18 fragment was amplified with primers pK18-F and pK18-R; using the genomic DNA of Pseudomonas putida KT2440 as a template, the PpleuDHup fragment was amplified with primers PpleuDHup-(pK18)-F and PpleuDHup-(p119)-R; using the genomic DNA of Pseudomonas putida KT2440 as a template, the PpLeuDHdw fragment was amplified with primers PpLeuDHdw-(p119)-F and PpLeuDHdw-(pK18)-R; the fragments pK18, PpleuDHup and PpLeuDHdw were ligated using a Gibson assembly kit (Novoprotein, C117-01), and then transformed into competent Escherichia coli DH5α to obtain the plasmid pK18-ΔPPpleuDH::P119 (ΔP indicates the deletion of the original promoter, and ::P119 indicates the insertion of the P119 promoter).

[0162] (1-b) Transformation of Pseudomonas putida and completion of single crossover:

[0163] The plasmid pK18-ΔPPpleuDH::P119 was transformed into Escherichia coli S17-1 strain (Zhuangmeng Biotech, ZC1035), and then transformed into Pseudomonas putida KT2440 by conjugation transduction (method reference: Bio-production of high-purity propionate by engineering l-threonine degradation pathway in Pseudomonas putida). Colonies with single crossover were screened by plates supplemented with chlorophenol and kanamycin.

[0164] (1-c) Screening of positive clones:

[0165] The colonies that had completed single crossover were streaked on an LB plate containing 15% sucrose and chlorophenol. The growing colonies were those that had completed two homologous crossovers. 30 colonies were picked, and colony PCR verification was performed using primers P119-F and PpleuDHdw-R to obtain the strain HM701.

[0166] (2) Obtaining of strains HM702 to HM806

[0167] The construction process of each strain in this step used exactly the same method as in Example 2(1).

[0168] Including the following strain modifications:

[0169] Starting from the strain HM701, the PpbkdR gene in this strain was replaced with the P119 promoter to obtain the strain HM702.

[0170] Starting from strain HM702, the promoter of the Ppivd gene in this strain was replaced with the P119 promoter to obtain strain HM703.

[0171] Starting from strain HM703, the promoter of the Ppech gene in this strain was replaced with the P119 promoter to obtain strain HM704.

[0172] Starting from strain HM704, the PplacI gene in this strain was replaced with the PaaI gene expression cassette containing the P119 promoter to obtain strain HM705.

[0173] Starting from strain HM705, the promoter of the PpleuA gene in this strain was replaced with the P119 promoter to obtain strain HM801.

[0174] Starting from strain HM801, the PpilvE gene in this strain was replaced with the PpilvC gene expression cassette containing the P119 promoter to obtain strain HM802.

[0175] Starting from strain HM802, the promoter of the PpilvBN gene in this strain was replaced with the P119 promoter to obtain strain HM803.

[0176] Starting from strain HM803, the promoter of the PpilvD gene in this strain was replaced with the P119 promoter to obtain strain HM804.

[0177] Starting from strain HM803, the Ppacs gene in this strain was replaced with the Bafxpk gene expression cassette containing the P119 promoter to obtain strain HM805.

[0178] Starting from strain HM801, the Pp2213 gene in this strain was replaced with the Ecpta gene expression cassette containing the P119 promoter to obtain strain HM806.

[0179] The difference in the construction process of each strain from Example 2 (1) is that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the information of the obtained strains are shown in Tables 4, 5, and 6.

[0180] Table 4. Genotypes of each strain in Example 2

[0181] Strain Name Starting Strain Genotype Remarks KT2440 HM701 KT2440 KT2440, ΔPPpleuDH::P119 Replace the promoter of PpleuDH with P119 HM702 HM701 HM701, ΔPpbkdR::P119 Replace the PpbkdR gene with P119 HM703 HM702 HM702, ΔPPpivd::P119 Replace the promoter of Ppivd with P119 HM704 HM703 HM703, ΔPPpech::P119 Replace the promoter of Ppech with P119 HM705 HM704 HM704, ΔPplacI::P119-PaaI Knock out PplacI and insert P119-enhanced PaaI HM801 HM705 HM705, ΔPPpleuA::P119 Replace the promoter of PpleuA with P119 HM802 HM801 HM801, ΔPpilvE::P119-PpilvC Knock out PpilvE and insert P119-enhanced PpilvC HM803 HM802 HM802, ΔPPpilvBN::P119 Replace the promoter of PpilvBN with P119 HM804 HM803 HM803, ΔPPpilvD::P119 Replace the promoter of PpilvD with P119 HM805 HM804 HM804, ΔPpacs::P119-Bafxpk Knock out Ppacs and insert P119-enhanced Bafxpk HM806 HM805 HM805, ΔPp2213::P119-Ecpta Knock out Pp2213 and insert P119-enhanced Ecpta

[0182] Table 5. Gene editing fragments and sequences in Example 2

[0183] Sequence Number Fragment Name Sequence (5’-3’) SEQ IDNO. 41 PpleuDHup GGATACAGGCGCCGGCCGCCGCAGGGATCGAGCAGGTGGTCGGCACCCGGTACGCGCAGCAGGAAATGGCCAGGGAAGCCCACACCCTCCAGCGGTATGGACAGCCGCCTGGCCAGTTCCAAAGCGAGGATGGCCAGGGTCAGTGGTTGGCCGCGGCGGCGCTGCAGTACCTTGTCCATCATCGCCGCATGGGGGCGCAAGGGGTGATATTCATCCTGCTGAAAGCCCAGCGCATTCAGCTGGCGCAGCAGTGGCTGGGCCAGTTCGCATAGTGGAAGCATCGGCAGGTTGGCGCTTATCTCGCGCTGCAGGTCGTGCAGCGCAGCAAGGCTGGCAGCGGGCTCGACACCAGGGTCGTGCTCGGCAGCAATCCACAGTGCGGCTTCCAGCAGGTCGACAGGCTCGCGTTCCAGGCAGGCCAGGCAGGCTTGACGTGGCTTCATGGGGTATCTCCACACACGTTTGAGTATTAGCCGTGGCGCGTGGTTTCGTCCAGTGGT SEQ ID NO.42 PpleuDHdown GAGCACCTCGTAGGGGAGCCGGTCGATGTTCGCGCTGATGCAAAGCACCCGTACCCAGTCACTGCACCTGTTCAATGACCCGCCTACGGGCCTGAAAGCCGTTGTGGCAATCCACAGTGAGCATTTGGGCCCGGCCATGGGGGGGTGCCGCTACCTGCCTTACGCCGATGACGAAAGCGCCATGACCGACGCGATTCGCCTGGCCCAGGGCATGAGCTACAAGGCAGCACTGGCCGGCTTGCCGATGGGGGGTGGCAAGGCGGTAATCATGCGCAACCCGCATGTGGAAAACCGCGCAGCGCTGTTCGAGGCCTTTGGCCGCTTCATCGATACCTTGCATGGGCGCTTCATCATCGCCGTGGACAGTGGCACCTCGACCTTGGACATGGACTGCATTGCCCACAGCACGCCCTACGTGACCAGCACCACTGCATCGGGCGACCCATCGCCACATGCGGCGATGGGGGTGTTCGCGGGCATACGTGCCACAACCTCGTTCCG SEQ ID NO.43 PpbkdRup GGGGTCGCGCTCGTTGGACAGCAGTTGGCAGATCATCTCGACCAGCGACACGTCGCGGGCCATCAGGATGCTTTGCTGGCGGTAGGTCGGGAAGCACATGTCGGTGCGGTTCAGCGCCAGCGCCTGGCCGCTGCCGATGGCTTCTTCGCCCAGGCTTTGCATGTAGAAGGACATCTTCTTCTGGCGCTGGGCAACCACCATGCGGCTGTCGAAGATCCGCGTCTTGAGCATGGCGCGCATGCCTTGACGGAGGATCTGCGGGTCGATGTCTTCGGCCCAGGGGCCTTGCGCATCGCCTTGCTCGTCGAGCACGCGGACCAGGCTGTAGGACAGGTCGGCAGTGTCGGCAGCATCGACATCGATCGCGGGTTTACGGGCTTGACCTGCATCGTTGAGGCGCAGGTAGGAAAAATCGGTCTGGCAGCCTGGCCGGCCGGTGGGCTCGGGCACATGCAAACGCAGGGGGGCGTACTCGTTCATGCTTTTTACGCTCGCTCGGG SEQ IDNO.44 PpbkdRdw CCTGTAGGCGCGGGTTCACCCGCGAAGAGGCCGGCACAGCCACCCAATAGGCTGCTTGATATTTTGAACACCCGCAGCCTATGTTGTTGTCAGCCTACAACAACAAGGACAAGCGTCATGAGCACTGCTCAGCTCCAGGGCATCGACGAAATCGAATGCGTCACCCCCGACCTCAACGGCGTTCCGCGCGGCAAGGTGATGACCGCCGAAGGCTTCCTCGAAGGCCGTCGTCTGCAGATGGCCCGGGGCGTGCTGCTGCAATGCATCATGGGCGGTTATCCACCAGCGAAATTCTACGGCAGTGACGACGGCGACCTGGCACTGGTGGCCGAACCCAGTCAGGTCCACCGCCTGCCCTGGAGCGATGACGGCCGCGCCTTGGCCATCTGTGATGCCAACGAGCTGGATGGCCGGCCCTCGGCACTGTCCACACGGGGCCAGCTGAAGGCCGTGATAGCCCGCTATGCGGCACTGGGCCTGGCGCCGGTAGTGGCAACCGAG SEQ IDNO.45 Ppivdup GACCTTGGCACTGGCCAGCTGCAAGATGCACCACTGGGCGCAGTTGGGCGACCAGATGCCAACACGGTCGCCGGTGTTCACGCCCAGTGCGATCAGGGCGCGGGCGTATATTTCGACCTGTTCGGCCAACTGCCGCCAGCTGTAACGCAGGCCCTGGTGGCGGGACACCAGGGCCTCGCTGTCGCAACAGCGGGCCACGGTGGCATCGAAGGCCTGGCCGATGGTCTGGGTCAGCAAGGGTCGGTCCTGGCGACCGCGGGTATAGCTCGGTTGACTCATGGGTGTCCCTTCTTGTGGTTGTTTTGGGCACGGCTGAAGCAAGCGGGAATACTCTGGCGCAGATTTACGTTTACGTAAAGGTGACGAGTGGATTGACAGTGACCCTCATGCAGGTTTACGTTAACGTAAAGGTGATGAACGACACCCACTTGAGGCGCCACGCCGCCCTCTGTGGGAGCGGGCTTGCCCGCGAATGCGACCAATCAGGTAATGACGGTGAC SEQ IDNO.46 Ppivddw GAACAAGAAGGTGCCCCAGCATGCATTACCCCTCCCTGAACTTCGCCCTGGGCGAGACCATCGACATGCTCCGCGACCAGGTGCGCACCTTCGTCGCCGCTGAACTGGCCCCAAGGGCCGCGCAGATCGACCACGACAACCTGTTCCCCGCCGACATGTGGCGCAAGTTCGGTGACATGGGCCTGCTGGGCATCACCGTACCGGAAGAGTACGGCGGCGCTGGCCTGGGCTACCTGGCCCATGTGGTGTCGATGGAAGAGATCAGCCGTGGCTCCGCCTCGGTGGCGCTGTCCTACGGCGCCCATTCCAACCTGTGCGTCAACCAGATCAACCGCAACGGCACCCACGAGCAGAAGCTCAAGTACCTGCCCAAGCTGATCAGCGGCGAGCACATCGGCGCCTTGGCCATGAGCGAGCCCAATGCCGGTTCCGACGTGGTGTCGATGAAGCTGCGCGCAGAAAAACGCGGCGATCACTACGTGCTCAACGGCAGCAAGACC SEQ ID NO.47 Ppechup CCAAACTGACGGGCAGTATCCAATGCTGGGGAGAAATTCTCTGGCACGCTGACTCGTACCTCGAGGTTGCTGAGAGAGGCCGATGGCGTTTTTACTGAAAATTTGCCTCCGGCCATAGAATCTCCTACGGGGGCATCCAGGCTGGTCAATCTGTTCTGTAACGACAAAGCGGCGGCTCGGCATAACCCTGAAGGGGTGGGGTGCCAAGTCGCCGCTTTGCGTTCTGCTGCGCAGAAAAGGCCAGGCAGGCCGGGTTATTCATTCAAGCAAGTGCCAGTGTAGTCGCCTTGGCTCTTCGCGCAAGCGCAAAGCAATAAGCCGATGCTTGTGGTCAATCGCTGACATGAATGACCGGCGATCACTGTCATCATGTTTTGTACCCGGACGATAGAAAATGACTGGAAAGTCGCGTTTTCGCCGTGCTCGTGAGCATTTGACAACGCCCATCTTTTCGGAGAATGTGTGCACACCCAAATCAAACGGGCGTATGAATTGAGCGT SEQ ID NO.48 Ppechdw CATATCGTGGAGATCAGTTGATGATTTACGAAGGTAAAGCCATCACGGTTAAGGCTCTTGAAAGTGGCATCGTCGAGCTCAAGTTCGACCTCAAGGGTGAGTCCGTCAACAAGTTCAACCGCCTTACCCTGAACGAGCTGCGCCAGGCCGTCGATGCCATCCGGGCCGATGCTTCGGTCAAGGGCGTGATCGTCAGGAGTGGCAAGGACGTGTTCATCGTCGGCGCCGACATCACCGAGTTCGTCGACAACTTCAAGCTGCCTGAGGCCGAACTGGTCGCTGGCAACCTGGAAGCCAATCGCATCTTCAACGCGTTCGAAGACCTCGAAGTGCCGACCGTTGCCGCCATCAACGGCATCGCGCTGGGCGGCGGCCTGGAAATGTGCCTGGCGGCCGACTACCGGGTCATGTCCACCAGCGCCAGGATCGGCCTGCCGGAAGTCAAGCTGGGTATCTACCCGGGCTTTGGCGGTACCGTGCGCCTGCCGCGCCTGATCGGC SEQ IDNO.49 PplacIup GTGTTTCGCCAGCGTTCATCATCGCCTTGCTGGTGATCGTGCTCGCCCAGTTGGTACTGACGCGCACGGTGTTCGGCCGTTACCTGATCGGTATCGGCACCAACGAAGAGGCCGTGCGCCTGGCCGGTATCGATCCGCGCCCTTACAAAGTGCTGGTGTTCGCCCTGATGGGCCTGCTCGCCGGCCTGGCCGCACTGTTCCAGATCTCGCGGCTGGAAGCCGCCGACCCCAATGCCGGCTCTGGCCTGGAGCTGCAGGTCATTGCCGCCGTCGTGATCGGCGGCACCAGCCTGATGGGTGGGCGTGGCTCGGTCATCAGCACCTTCTTTGGCGTACTGATCATTTCCGTATTGGCCGCCGGGCTGGCGCAGATCGGTGCCAGCGAGCCGACCAAACGCATCATCACCGGGGCGGTGATCGTCATCGCCGTGGTGCTCGACACTTACCGTAGCCGGCGCGCAGGCCGGCGGAACTGACAACATGGCAACCATCAAAGACGT SEQ IDNO.50 EcpaaI ATGAGTCATAAGGCCTGGCAAAATGCCCATGCAATGTATGAGAACGATGCCTGCGCCAAAGCGCTTGGCATCGACATTATCTCAATGGATGAAGGCTTTGCTGTAGTGACCATGACCGTCACTGCACAAATGCTTAACGGTCATCAAAGTTGCCACGGCGGGCAGCTATTTTCACTGGCTGATACTGCCTTTGCCTACGCCTGCAATAGCCAGGGGCTGGCAGCCGTCGCTTCTGCCTGCACGATTGATTTTTTGCGTCCAGGCTTTGCCGGAGACACCTTAACTGCTACTGCGCAGGTACGTCATCAGGGCAAGCAAACCGGTGTTTACGACATCGAAATTGTTAACCAACAACAAAAAACGGTTGCGCTGTTTCGCGGTAAATCTCACCGCATCGGCGGCACCATTACAGGAGAAGCCTGA SEQ IDNO.51 PplacIdw TGTTCAATGATTACCGCTAACGCTAAGGAAACGTCATGAATGCCAAGGTTGTGGTGGTTGGCAGCCTCAACATGGACCTGGTGGTCCGCGCCCAGCGCCTGCCGCGGGCCGGCGAAACACTCCCCGGCGATAGCTTTTTCACGGTGCCGGGCGGCAAGGGTGCCAACCAGGCGGTGGCAGTGGCGCGGCTGGGCGGCAGCGTGGCTATGATCGGCAATGTGGGGGATGACGACTACGGGCGGCAACTGCACCGGGCCTTGTATGTCGAGGGGATCGACTGTCAGGGCGTCAGCACCTGTCCAGCCATGTCCAGCGGTGTGGCGCTGATCACGGTGGATGCTGCCAGCCAGAACTGTATTGTCATCATTCCCGGCGCCAACGGCCTGCTGACGCCGCAGTCGGTGCGGCGCTTCGATGCGTTGCTGCAGGCTGCCGAGGTAATCATCTGCCAGTTGGAAGTGCCAGCCAGCACCGTGGCCTGGACACTGGCCAGAGGGCAC SEQ ID NO.52 PpleuAup CCCGCCAATGGCAAAGTGATTCTGGTGGGGGATTATTTCTTCAACGGCCGCACGGTGTTCGTCGACCATGGGCAGGGCTTTATCAGCATGTTCTGCCACATGTCGAAAATCGATGTGCAGGTCGGCCAGCAACTGCGTCGTGGCGAGGTGGTCGGGCGCGTGGGCTCGACCGGGCGGGCAACCGGGCCGCACATGCACTGGAACGTCAGCCTGAACGATGCGCGGGTGGACCCGGCGATTTTCATTGGCGCGTTCCAGCCCTGAAACTGCGGCGCCTGCTTCGCGGGCACGCCCGCTCCCACAGGTACAGCGAAGCCTTCAGACACAGCACAATACTTGTGGGAGCGGGCATGCCCGCGAAGAGGCCAGCACAGTCGACAGCAGTTCAACTGTGTTGCGCCATCGAAAAATACTGCGCAAACATCAATAAGCGCCTAGCAGATCCAAGCCATAAAATCTCGCCTAATGGCTTTTTTTAAGCATTCCTCTCAATTTTTCCC SEQ ID NO.53 PpleuAdw CACACAAAAGGATTGCTTCCATGACCATGCTCAAAGACCCTTCGAAGAAATACCGCGCTTTCCCGACCATCGACCTGCCTGACCGTACCTGGCCGTCGAAGACCATCACCCAGGCACCTATCTGGTGCAGTTCCGACCTGCGTGACGGCAACCAGTCGCTGATAGAGCCGATGGACTCGGAGAAGAAACTGCGCTTCTGGAAGACCTTGGTGCAGGTTGGCGTGAAGGAGATCGAAGCCTCGTTCCCGTCTGCCTCGCAAACCGATTTCGACTTCGTGCGCACCCTGATCGAGGACGGCCACATCCCGGATGACACCACCATCCAGGTGCTCACCCAGGCACGTGAAGACCTGATTGCCCGTACCTTCGAATCACTGCGCGGTGCGAAGAAGGCCATCGTCCACCTGTACAACGCCACCAGCCCGTCGTTCCGCCGCATCGTCTTCAATCAGGACAAGCAAGGCGTGAAGGACATCGCGGTGAACGCGGCCAAGCTGTTC SEQ ID NO.54 PpilvEup AGCGCCTGGATTGGGGCCTGCAGATGCAGGTGTGGGACCCGTTCGGCAACCGCCTGCGCTTTTGCCAGCAGATCGATGACGAGGCCAACCCGTGAAGGCATTGGGCAAACGCGAAATGGGCCGCCTGGAGCGGGAGTTGGTCGCGTGCCTGACCGACGCCTGCGAAACCGCCAAGGCGGAGATTGTCGGCTTCAGTTGGCTTACCCATCGCCTCGACCCCGAGGACTTTCCGGGCAGCCTGCGTATTACCTGGGTATTCGAGCAAGAGGCCGATAAAGCCGCTGCAGTGGCGGGCGACGCAAAGGCACGTATGCTGGCACTGACCTGCCAGGCATTGGACCACGCCGGAATACAGCTGGACCATCCCGCTTGGCATGTACGCTATGACAGCGAAGAGGCCTGTGCACGGGTGCATGGCGGGGACTGGGGAAAACGCCTGCAGGGGCATTGACCCTGCGGTTTGACGATAGTATCGCTTCGCACCCTATCAATTCGTGACT SEQ IDNO.55 PpilvC ATGAAAGTTTTCTACGATAAAGACTGCGACCTTTCCATCATCCAGGGTAAGAAAGTCGCCATCATCGGTTACGGCTCCCAGGGCCACGCTCAGGCGTGCAACCTGAAAGACTCCGGTGTAGACGTTACCGTCGGTCTGCGTAAAGGTTCGGCTACCGTTGCCAAGGCTGAAGCCCACGGCCTGAAAGTTGCCGACGTTGCTACCGCTGTCGCTGCGGCTGACCTGGTCATGATCCTGACCCCGGACGAGTTCCAGGGCGCTCTGTACAAGAACGAAATCGAGCCGAACATCAAGAAGGGCGCTACCCTGGCCTTCTCTCACGGCTTCTCGATCCACTACAACCAGGTTGTTCCGCGTGCCGACCTCGACGTGATCATGATCGCGCCGAAAGCCCCGGGCCACACCGTTCGCTCCGAGTTCGTCAAAGGCGGCGGCATCCCTGACCTGATCGCTATCTACCAGGACGCTTCCGGCAACGCCAAGAACGTCGCACTGTCCTATGCTTCGGGCGTAGGTGGTGGCCGTACCGGTATCATCGAAACCACCTTCAAGGACGAAACCGAAACCGACCTGTTCGGTGAGCAGGCTGTTCTGTGTGGCGGTACCGTCGAGCTGGTCAAAGCCGGTTTCGAAACCCTGGTCGAAGCTGGCTACGCGCCGGAAATGGCCTACTTCGAGTGCCTGCACGAGCTGAAGCTGATCGTAGACCTCATGTACGAAGGCGGCATCGCCAACATGAACTACTCGATCTCCAACAACGCCGAATACGGTGAGTACGTCACTGGCCCGGAAGTCATCAACGAAGAATCCCGCAAGGCCATGCGCAATGCTCTGAAGCGCATCCAGGACGGCGAGTACGCGAAGATGTTCATCTCCGAAGGTGCTACCAACTACCCATCGATGACCGCCAAGCGCCGCAACAACGCCGCTCACGGCATCGAGATCATCGGCGAGCAGCTGCGCTCGATGATGCCGTGGATCTCGGCTAACAAAATCGTCGACAAGACCAAGAACTAA SEQ IDNO.56 PpilvEdw AACGCATCAGCTGTATGAAAACGGGGCATGCCAGCAATGGCATGCCCCGTTTTTTCATGTGTTTACACGGCCCCCTCGTAGGAGCGGGTTTACCCGCGAATAGGCCACACCCGCCAGCCAATAATGCCTGGGAGATCACCGTTGTCAGTGCAGCCGCATTAGCGGGCAAGCCCGCGCCGGGTGACAGAATCATGCCACACGCCGCTGCACCAGCAGGTGCCGGGCTTTGTCGAACGCCCAGTTGTAGACCACGGTGTAGGGCAGGATGATCACGAAGAAGCCCAGCTCCACCATGAATGCCTGCAGCAGCGAAATCTCCAGCATCCAAGCCGCCACCGGCAGGCACCACACCACCAGGCCGGCTTCGAAGCCAAGACCGTGCACGAAACGCGTACTGGCCTTCCAGTTGATGCGTTCGGTTTGCACCCAGCGATCGACCAGTACGTTGTAGACCATGTTCCACAGCATGGCGATCACCGACAGGGTCACCGCCAGCGTGC SEQ ID NO.57 PpilvIHup GCCCAGGCCCGTGAAAAGCAGGGTGACAGCGCTGGGGCTGCGCTGGCCCGGCAAAAGGCGCGGGTCAATTCGTGATGATCGAGCAACGCGTGCTGGATATTGCCGACCACCTGCTCTTGATCGAGCGCGAGCTGCAGGTGCAAGGTTGGTGGGATGACGAGCCGCCAAGCGACGAGGCACTGGCCAGTACGGTGCCGTTCGCCGTGGATACCCTCAGTTTTGAGCAGTGGCTGCAATGGATCTTCCTGCCCCGCATGAAGATCATCATCGAGCTGGGGCACCCGCTGCCCAATGCATCGAGCATCCTTGTCATGGCCGAAACCGTGTTTACCGACCGGCCGGAGCAAAGTCGTGAGCTACGCCGCCTGTTGGCAGCTTTTGATCAATTGATCGCTCCTTCCGCCTGATTTCTTCAGTTTTTCCGTCAAGGGCCGCAGATTGTGGCCCTTTTTTTTGGAAATCTTCTTAATTCTGCTGCTGAAGCGATTTTTAGTGGTGGC SEQ IDNO.58 PpilvIHdw GCGTTTTAGAGGTGAACAACGTGGAGCTTTTATCTGGCGCTGAGATGGTCGTCCGCTTCTTGCGTGACGAAGGCGTTAAGCACATCTACGGGTACCCTGGTGGTGCTCTCCTGCATGTTTACGACGCACTGTTCAAAGAACCGGAAGTGGAACACATCCTGGTTCGTCACGAGCAGGCGGCCACCCATATGGCGGACGGCTACGCTCGCGCCACCGGCAAGGCCGGTGTGGTGCTGGTAACCTCCGGTCCTGGCGCGACCAATGCCATTACCGGTATTGCCACCGCCTACATGGACTCGATTCCGATGGTCATCCTGTCCGGCCAGGTGCCTAGCACCATGGTGGGCACCGATGCCTTCCAGGAAACCGACATGATTGGTATCTCGCGGCCGATCGTGAAGCACAGCTTCATGATCAAGAATCCGACCGAGATCCCTGAAGTTCTGAAAAAAGCTTTCTACCTGGCGCAATCCGGTCGTCCAGGTCCAGTCGTGGTCGAC SEQ ID NO.59 PpilvDup TGCCCTGGACGGCGTGGAGCGTAACGCTGCACTGAACGGCATCAGCGAGAAGCTGACCTGCATCGAAGGCGACGTGTTCGAAGCCCTGCGAGAGCTCAAGGCGGCCGAAGAACGCTTCGACGTGATCATTGCCGACCCACCTGCCTTCATCAAGCGCAAGAAGGACCTGAAAAACGGCGAAGCGGCCTACCGCCGCCTGAACGAACAGGCCATGCGCATGTTGAACAAAGACGGCATCCTCGTCAGCGCCTCGTGCTCGATGCACCTGCCCGAGGACGACCTGAACAACATCCTGCTGACCAGTGCCCGCCACCTGGACCGCAACATGCAGCTGCTCGAGCGAGGCGGTCAGGGCCCGGATCACCCGGTACACCCGGCCATCGCCGAAACCCGCTACATCAAAAGCATCACCTGCCGGTTACTGCCAAACAGCTGATATCTGCCAAAAAGGGCCGCCCAGCGGCCCTTTCCTGCCGCAATCCCCCCGCCAACCATCCACA SEQ IDNO.60 PpilvDdw TAAGCCGCCAGGAGTGTTTCATGCCTGATTATCGTTCCAAGACTTCCACCCAAGGCCGCAACATGGCCGGCGCCCGTGCCCTGTGGCGCGCCACCGGGATGAAGGACGAAGACTTCAAGAAACCGATCATCGCCATCGCCAACTCGTTCACCCAGTTCGTACCGGGCCATGTGCACCTGAAGGACCTGGGCCAGCTGGTGGCTCGCGAAATCGAACGCGCCGGTGGCGTGGCCAAGGAATTCAACACCATCGCGGTCGATGACGGCATCGCCATGGGCCACGACGGCATGCTGTACTCGCTGCCAAGCCGCGAAATCATTGCCGACGCCGTGGAATACATGGTCAATGCGCACTGCGCCGACGCCATCGTCTGTATCTCCAACTGCGACAAGATCACCCCCGGCATGCTGATGGCCGCCCTGCGCCTGAACATCCCGGTGATCTTCGTTTCCGGCGGCCCGATGGAAGCCGGCAAGACCAAGCTGGCCAGCCACGGCCTG SEQ ID NO.61 Ppacsup AGCGGCCTTGTGTCGCGATAGGGGCCCGCAGGGCCCCCGATTCCAAGGTATCAGCCGTTGGAGCAGCCGTTCCCCATCACGCGGTATTCGAGAATGTGCTTCTGGCCCTGGGAGTCCTCGTAGGTCATGCGGGCCGGCACGACTTCGCACACATTGGGCACTTCGCTCATGGAAATAACGCGGGCAATGTCCAGGTGCTGCGAGTAACTGTACTGTTCAACCGGAATCTGCTCGGCATCTTTGGCTTCGCCGGCCATTGCCGCGCCGCAAAGACTGCCAAGTACCAATACCAGTAAAGCTTTCATTTTCTATTTACCTGTCTAAGGTCGTGAGGGGGCACGCGGCGCTTATGGCGCCGCGAGTATTGCTAGTTTTAACTATCGGGATTAGATGGAGATTAACGCTTGCCTTCGTGGGGGCTGTTACCAGTTGTTAATCGCCTTGCCGTTGCTGGCGAGGTGAATTTTATGGCGCTGGCCAAGGCCGAAACAGTGGGTGTT SEQ ID NO.62 BaFxpk atgacgagtcctgttattggcaccccttggaagaagctgaacgctccggtttccgaggaagctatcgaaggcgtggataagtactggcgcgcagccaactacctctccatcggccagatctatctgcgtagcaacccgctgatgaaggagcctttcacccgcgaagacgtcaagcaccgtctggtcggtcactggggcaccaccccgggcctgaacttcctcatcggccacatcaaccgtctcattgctgatcaccagcagaacactgtgatcatcatgggcccgggccacggcggcccggctggtaccgctcagtcctacctggacggcacctacaccgagtacttcccgaacatcaccaaggatgaggctggcctgcagaagttcttccgccagttctcctacccgggtggcatcccgtcccactacgctccggagaccccgggctccatccacgaaggcggcgagctgggttacgccctgtcccacgcctacggcgctgtgatgaacaacccgagcctgttcgtcccggccatcgtcggcgacggtgaagctgagaccggcccgctggccaccggctggcagtccaacaagctcatcaacccgcgcaccgacggtatcgtgctgccgatcctgcacctcaacggctacaagatcgccaacccgaccatcctgtcccgcatctccgacgaagagctccacgagttcttccacggcatgggctatgagccgtacgagttcgtcgctggcttcgacaacgaggatcacctgtcgatccaccgtcgtttcgccgagctgttcgagaccgtcttcgacgagatctgcgacatcaaggccgccgctcagaccgacgacatgactcgtccgttctacccgatgatcatcttccgtaccccgaagggctggacctgcccgaagttcatcgacggcaagaagaccgagggctcctggcgttcccaccaggtgccgctggcttccgcccgcgataccgaggcccacttcgaggtcctcaagaactggctcgagtcctacaagccggaagagctgttcgacgagaacggcgccgtgaagccggaagtcaccgccttcatgccgaccggcgaactgcgcatcggtgagaacccgaacgccaacggtggccgcatccgcgaagagctgaagctgccgaagctggaagactacgaggtcaaggaagtcgccgagtacggccacggctggggccagctcgaggccacccgtcgtctgggcgtctacacccgcgacatcatcaagaacaacccggactccttccgtatcttcggaccggatgagaccgcttccaaccgtctgcaggccgcttacgacgtcaccaacaagcagtgggacgccggctacctgtccgctcaggtcgacgagcacatggctgtcaccggccaggtcaccgagcagctttccgagcaccagatggaaggcttcctcgagggctacctgctgaccggccgtcacggcatctggagctcctatgagtccttcgtgcacgtgatcgactccatgctgaaccagcacgccaagtggctcgaggctaccgtccgcgagattccgtggcgcaagccgatctcctccatgaacctgctcgtctcctcccacgtgtggcgtcaggatcacaacggcttctcccaccaggatccgggtgtcacctccgtcctgctgaacaagtgcttcaacaacgatcacgtgatcggcatctacttcccggtggattccaacatgctgctcgctgtggctgagaagtgctacaagtccaccaacaagatcaacgccatcatcgccggcaagcagccggccgccacctggctgaccctggacgaagctcgcgccgagctcgagaagggtgctgccgagtggaagtgggcttccaacgtgaagtccaacgatgaggctcagatcgtgctcgccgccaccggtgatgttccgactcaggaaatcatggccgctgccgacaagctggacgccatgggcatcaagttcaaggtcgtcaacgtggttgacctggtcaagctgcagtccgccaaggagaacaacgaggccctctccgatgaggagttcgctgagctgttcaccgaggacaagccggtcctgttcgcttaccactcctatgcccgcgatgtgcgtggtctgatctacgatcgcccgaaccacgacaacttcaacgttcacggctacgaggagcagggctccaccaccaccccgtacgacatggttcgcgtgaacaacatcgatcgctacgagctccaggctgaagctctgcgcatgattgacgctgacaagtacgccgacaagatcaacgagctcgaggccttccgtcaggaagccttccagttcgctgtcgacaacggctacgatcacccggattacaccgactgggtctactccggtgtcaacaccaacaagcagggtgctatctccgctaccgccgcaaccgctggcgataacgagtga SEQ ID NO.63 Ppacsdw ACCCTTCCCGGCAATACCCCCTGCAGGAGCGGGCTTGCCCGCGAATGCGTCAGTTCAGGCTAAGCTGTCCCCTGACCTCACGCATTCGCGGGCAAGCCCGCTTTTGCATTGTTACCCGACAATCATCGGTTACTGTTCTGTCACCGGCCCCGCACAGGTTCGGGGCGCCAGGAAACAATTCCGGCCCGTTTCGGTGCATCGGAGTCAGCATTTTGTGCATCAAGGCACGCTGCACTTGCCGTCGTACAAGGCTTTGCCAATAATAGGCCCAGGAATTGCTAGGTCTATAGGTTCTATTTCTTGCGCCATTGCATATTCTGCACTGGCTGTCAACATCGCCCGCGGCGGTTTCAGGCGCTTCTATAAGTAGTTGTCGCTTTGAAGAAATATCGACTACCGGGCTGTCGTTAAAATGCCACTCACTCGCTCGTGGTATGCGGCCTTGGTCGAACCCTGCGCGGCTCGCGTTGTACTCATTCGCATATCGGGCAGCTGTTACC SEQ ID NO.64 Pp2213up GACCAGTTGGCATTGGGGCTGGCTTACAGGGTGCAACTTCGTAGCCGTTTGCGGTTGCCCAACCAGCCGTATGCCATGCGCTATCCCGATGCTGTCGCGCTGACACAGGCCCAGGTAGAGGATGCATTTCTGCGGGTTACGCGCGCGCAGACCATCGAGGGCCTGACCGATAGCCTGAGCCAGCGCGCGTTCTGGCGCCGTTACCTGCGCCAGCAACATGACCAAATGTTCGATGCCCTCAGTGCGGATTACACTCGGCGCACGCTTGAGCTGCAGGCTCAACGTCCTGTCTTGGCGCCGGCGGCCTTCGAGCAGCAACTACGCCGGCTACAGGAACAGCAGGACCTCGATATCGAGCGCCTGGTCGCAGGGCTCACCCAGTCCTACCTGCGTGCAGCCGAGCGCGCAGAGGGGTGATTAGCGGCGGCCAAACCAGTCATCCAGATTGACAGCTTTGGCCATTGCCGCCGCGCATGAGCGGCGCGAACATCGTCGGACCG SEQ ID NO.65 Ecpta ATGTCCCGTATTATTATGCTGATCCCTACCGGAACCAGCGTCGGTCTGACCAGCGTCAGCCTTGGCGTGATCCGTGCAATGGAACGCAAAGGCGTTCGTCTGAGCGTTTTCAAACCTATCGCTCAGCCGCGTACCGGTGGCGATGCGCCCGATCAGACTACGACTATCGTGCGTGCGAACTCTTCCACCACGACGGCCGCTGAACCGCTGAAAATGAGCTACGTTGAAGGTCTGCTTTCCAGCAATCAGAAAGATGTGCTGATGGAAGAGATCGTCGCAAACTACCACGCTAACACCAAAGACGCTGAAGTCGTTCTGGTTGAAGGTCTGGTCCCGACACGTAAGCACCAGTTTGCCCAGTCTCTGAACTACGAAATCGCTAAAACGCTGAATGCGGAAATCGTCTTCGTTATGTCTCAGGGCACTGACACCCCGGAACAGCTGAAAGAGCGTATCGAACTGACCCGCAACAGCTTCGGCGGTGCCAAAAACACCAACATCACCGGCGTTATCGTTAACAAACTGAACGCACCGGTTGATGAACAGGGTCGTACTCGCCCGGATCTGTCCGAGATTTTCGACGACTCTTCCAAAGCTAAAGTAAACAATGTTGATCCGGCGAAGCTGCAAGAATCCAGCCCGCTGCCGGTTCTCGGCGCTGTGCCGTGGAGCTTTGACCTGATCGCGACTCGTGCGATCGATATGGCTCGCCACCTGAATGCGACCATCATCAACGAAGGCGACATCAATACTCGCCGCGTTAAATCCGTCACTTTCTGCGCACGCAGCATTCCGCACATGCTGGAGCACTTCCGTGCCGGTTCTCTGCTGGTGACTTCCGCAGACCGTCCTGACGTGCTGGTGGCCGCTTGCCTGGCAGCCATGAACGGCGTAGAAATCGGTGCCCTGCTGCTGACTGGCGGTTACGAAATGGACGCGCGCATTTCTAAACTGTGCGAACGTGCTTTCGCTACCGGCCTGCCGGTATTTATGGTGAACACCAACACCTGGCAGACCTCTCTGAGCCTGCAGAGCTTCAACCTGGAAGTTCCGGTTGACGATCACGAACGTATCGAGAAAGTTCAGGAATACGTTGCTAACTACATCAACGCTGACTGGATCGAATCTCTGACTGCCACTTCTGAGCGCAGCCGTCGTCTGTCTCCGCCTGCGTTCCGTTATCAGCTGACTGAACTTGCGCGCAAAGCGGGCAAACGTATCGTACTGCCGGAAGGTGACGAACCGCGTACCGTTAAAGCAGCCGCTATCTGTGCTGAACGTGGTATCGCAACTTGCGTACTGCTGGGTAATCCGGCAGAGATCAACCGTGTTGCAGCGTCTCAGGGTGTAGAACTGGGTGCAGGGATTGAAATCGTTGATCCAGAAGTGGTTCGCGAAAGCTATGTTGGTCGTCTGGTCGAACTGCGTAAGAACAAAGGCATGACCGAAACCGTTGCCCGCGAACAGCTGGAAGACAACGTGGTGCTCGGTACGCTGATGCTGGAACAGGATGAAGTTGATGGTCTGGTTTCCGGTGCTGTTCACACTACCGCAAACACCATCCGTCCGCCGCTGCAGCTGATCAAAACTGCACCGGGCAGCTCCCTGGTATCTTCCGTGTTCTTCATGCTGCTGCCGGAACAGGTTTACGTTTACGGTGACTGTGCGATCAACCCGGATCCGACCGCTGAACAGCTGGCAGAAATCGCGATTCAGTCCGCTGATTCCGCTGCGGCCTTCGGTATCGAACCGCGCGTTGCTATGCTCTCCTACTCCACCGGTACTTCTGGTGCAGGTAGCGACGTAGAAAAAGTTCGCGAAGCAACTCGTCTGGCGCAGGAAAAACGTCCTGACCTGATGATCGACGGTCCGCTGCAGTACGACGCTGCGGTAATGGCTGACGTTGCGAAATCCAAAGCGCCGAACTCTCCGGTTGCAGGTCGCGCTACCGTGTTCATCTTCCCGGATCTGAACACCGGTAACACCACCTACAAAGCGGTACAGCGTTCTGCCGACCTGATCTCCATCGGGCCGATGCTGCAGGGTATGCGCAAGCCGGTTAACGACCTGTCCCGTGGCGCACTGGTTGACGATATCGTCTACACCATCGCGCTGACTGCGATTCAGTCTGCACAGCAGCAGTAA SEQ ID NO.66 Pp2213dw AAGGAAAGTACTCATGCACATAGCCAATAAACATTTCATCGTCAGCGGCGCCGCTTCCGGGCTGGGTGCCGCGACTGCACAGATGCTGGTCGAGGCTGGCGCCAAGGTCATGCTGGTCGACCTCAATGCCCAGGCTGTCGAAGCCAAGGCCCGCGAACTGGGCGACAATGCCCGTTTCGCCGTGGCTGATATCAGTGACGAGCAGGCGGCCCAGTCGGCTGTCGATGCAGCTGTCAGCGCCTTTGGCAGCTTGCATGGGTTGGTCAATTGTGCCGGCATCGTCGGTGCCGAGAAGGTGCTGGGCAAGCAGGGCCCGCATGGCCTGGCCAGCTTCGCCAAGGTCATCAACGTCAACCTGATCGGCAGCTTCAACCTGTTGCGTCTGGCTGCGGCGGCCATGGCCGAAGGGGCTGCCGATGAGAGCGGCGAGCGTGGGGTCATCATCAACACGGCCTCCATTGCCGCCTATGACGGCCAGATTGGCCAGGCCGCCTACGCCG

[0184] Table 6 Primers used in Example 2

[0185] Primer Sequence (5'-3') pK18-F caggcatgcaagcttggcac pK18-R accgagctcgaattcgtaat PpleuDHup-(pK18)-F attacgaattcgagctcggtGGATACAGGCGCCGGCCGCCGCA PpleuDHup-(p119)-R agcattatacctaggactgagctagctgtcaaACCACTGGACGAAACCACGC PpLeuDHdw-(p119)-F cagtcctaggtataatgctagcGAGCACCTCGTAGGGGAGCCG PpLeuDHdw-(pK18)-R gtgccaagcttgcatgcctgCGGAACGAGGTTGTGGCACG P119-F cagctagctcagtcctaggtata PpleuDHdw-R CCCAACCCCTGGACCGCTAC PpbkdRup-(pK18)-F attacgaattcgagctcggtGGGGTCGCGCTCGTTGGAC PpbkdRup-(p119)-R CCCATTTAATTTCTAATTCTCAATAttgacagctagctcagtcctaggtataatgctagcCCCGAGCGAGCGTAAAAAG PpbkdRdw-(p119)-F AGAATTAGAAATTAAATGGGAAATTTACTGAGCCAATCCCCCTGTAGGCGCGGGTTCAC PpbkdRdw-(pK18)-R gtgccaagcttgcatgcctgCTCGGTTGCCACTACCGGC PpbkdRup-R CCGAATACATGATCGGCAAC Ppivdup-(pK18)-F attacgaattcgagctcggtGACCTTGGCACTGGCCAG Ppivdup-(p119)-R aggactgagctagctgtcaaAATTTCTAATTCTCAATAGTCACCGTCATTACCTGATTG Ppivddw-(p119)-F ttgacagctagctcagtcctaggtataatgctagcGAACAAGAAGGTGCCCCAGC Ppivddw-(pK18)-R gtgccaagcttgcatgcctgGGTCTTGCTGCCGTTGAGC Ppivddw-R CGTAGGTGTTGGCGTCGGG Ppechup-(pK18)-F attacgaattcgagctcggtCCAAACTGACGGGCAGTAT Ppechup-(p119)-R cctaggactgagctagctgtcaaAATTTCTAATTCTCAATAACGCTCAATTCATACGCCC Ppechdw-(p119)-F acagctagctcagtcctaggtataatgctagcCATATCGTGGAGATCAGTTG Ppechdw-(pK18)-R tgccaagcttgcatgcctgGCCGATCAGGCGCGGCAGG Ppechdw-R GTTTTCCTTGCCGGCGGC PplacIup-(pK18)-F attacgaattcgagctcggtGTGTTTCGCCAGCGTTCATC PplacIup-(P119)-R attatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATAACGTCTTTGATGGTTGCCATG EcpaaI-(p119)-F agctcagtcctaggtataatgctagcGGCGCTTCTGGAGAGCGGTTATG EcpaaI-(dw)-R GGCTCAGTAAATTTCCCATTTTCAGGCTTCTCCTGTAATGG PplacIdw-(ppaI)-F AATGGGAAATTTACTGAGCCAATCCCTGTTCAATGATTAC PplacIdw-(pK18)-R gtgccaagcttgcatgcctgGTGCCCTCTGGCCAGTGTCC PplacIdw-R GGTAGCGGGTGCTGGGTTC PpleuAup-(pK18)-F attacgaattcgagctcggtCCCGCCAATGGCAAAGTG PpleuAup-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATAGGGAAAAATTGAGAGGAATGC PpleuAdw-(p119)-F ctagctcagtcctaggtataatgctagcCACACAAAAGGATTGCTTCC PpleuAdw-(pK18)-R gtgccaagcttgcatgcctgGAACAGCTTGGCCGCGTTC PpleuAdw-R GGCGAGTACTGGAAGGTCCAC PpilvEup-(pK18)-F attacgaattcgagctcggtAGCGCCTGGATTGGGGCC PpilvEup-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATAAGTCACGAATTGATAGGGTG PpilvC-(p119)-F ctagctcagtcctaggtataatgctagcATATAACCAGGGGTATTTTC PpilvC-(ilvEdw)-R GGATTGGCTCAGTAAATTTCCCATTTTTAGTTCTTGGTCTTGTCGACG PpilvEdw-(ilvC)-F GAAATTTACTGAGCCAATCCCAACGCATCAGCTGTATGAAAAC PpilvEdw-(pK18)-R gtgccaagcttgcatgcctgGCACGCTGGCGGTGACCC PpilvEdw-R GCTGCTGTCCTGGATCATGG PpilvIHup-(pK18)-F attacgaattcgagctcggtGCCCAGGCCCGTGAAAAGC PpilvIHup-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATAGCCACCACTAAAAATCGC PpilvIHdw-(p119)-F ctagctcagtcctaggtataatgctagcGCGTTTTAGAGGTGAACAAC PpilvIHdw-(pK18)-R gtgccaagcttgcatgcctgGTCGACCACGACTGGACC PpilvIHdw-R GACGTATTCGAACTTCTCAGC PpilvDup-(pK18)-F attacgaattcgagctcggtTGCCCTGGACGGCGTGGAG PpilvDup-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATATGTGGATGGTTGGCGGGG PpilvDdw-(p119)-F ctagctcagtcctaggtataatgctagcTAAGCCGCCAGGAGTGTTTC PpilvDdw-(pK18)-R gtgccaagcttgcatgcctgCAGGCCGTGGCTGGCCAG PpilvDdw-R GTGGAGTCGGCCGCGATG Ppacsup-(pK18)-F attacgaattcgagctcggtAGCGGCCTTGTGTCGCGATAG Ppacsup-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATAAACACCCACTGTTTCGGCC BaFxpk-(p119)-F ctagctcagtcctaggtataatgctagcATATAACCAGGGGTATTTTCatgacgagtcctgttattg BaFxpk-(Ppacsdw)-R TTGGCTCAGTAAATTTCCCATTTtcactcgttatcgccagcggttg Ppacsdw-(BaFxpk)-F TGGGAAATTTACTGAGCCAATCCCACCCTTCCCGGCAATACCCCC Ppacsdw-(pK18)-R gtgccaagcttgcatgcctgGGTAACAGCTGCCCGATATG Ppacsdw-R GCTTCTTCATCAGGTAACTC Pp2213up-(pK18)-F attacgaattcgagctcggtGACCAGTTGGCATTGGGGC Pp2213up-(p119)-R tatacctaggactgagctagctgtcaaAATTTCTAATTCTCAATACGGTCCGACGATGTTCGC Ecpta-(p119)-F ctagctcagtcctaggtataatgctagcGTAACGAAAGAGGATAAACCATGTCCCGTATTATTATGCTG Ecpta-(Pp2213dw)-R GATTGGCTCAGTAAATTTCCCATTTTTACTGCTGCTGTGCAGACTGAATCGC Pp2213dw-(Ecpta)-F GGAAATTTACTGAGCCAATCCCAAGGAAAGTACTCATGCACATAG Pp2213dw-(pK18)-R gtgccaagcttgcatgcctgCGGCGTAGGCGGCCTGG Pp2213dw-R GGCAAGGTCAGGCTGGC

[0186] Example 3. Preparation of recombinant Pseudomonas aeruginosa producing HMB

[0187] In Example 3, using Pseudomonas aeruginosa PAO1 as the starting strain, recombinant strains HM145 and HM156 for synthesizing HMB were prepared, and the preparation method of this strain referred to Example 2. The genotypes of the recombinant strains are shown in Table 7.

[0188] The preparation method of the relevant strains was obtained according to the following steps (1)-(2):

[0189] (1) Enhance the expression of the Pseudomonas aeruginosa leucine dehydrogenase gene (hereinafter referred to as PaleuDH, where Pa represents the abbreviation of Pseudomonas aeruginosa) by promoter replacement

[0190] Starting from Pseudomonas aeruginosa PAO1 (purchased from China General Microbiological Culture Collection Center, CGMCC), replace the promoter of the leucine dehydrogenase PaleuDH gene in this strain with the constitutive promoter P tac , to obtain recombinant Pseudomonas putida HM141. The specific steps are as follows (reference: CN 109777760 B):

[0191] (1-a) Construction of the plasmid required for promoter replacement:

[0192] Using pK18mobSacB (Zhuangmeng Biotech, ZK1642) as the template, amplify the pK18 fragment with primers pK18-F and pK18-R; using the Pseudomonas aeruginosa PAO1 genomic DNA as the template, amplify the PaleuDHup fragment with primers PaleuDHup-(pK18)-F and PaleuDHup-(ptac)-R; using the Pseudomonas aeruginosa PAO1 genomic DNA as the template, amplify the PaLeuDHdw fragment with primers PaLeuDHdw-(ptac)-F and PaLeuDHdw-(pK18)-R; use the Gibson assembly kit (Novoprotein, C117-01) to ligate the fragments pK18, PaleuDHup and PaLeuDHdw, and then transform Escherichia coli DH5α competent cells to obtain the plasmid pK18-ΔPPaleuDH::Ptac.

[0193] (1-b) Transform Pseudomonas putida and complete single crossover:

[0194] The plasmid pK18-ΔPPaleuDH::Ptac was electrotransformed into Pseudomonas aeruginosa PAO1, and colonies with single crossover were screened by plates supplemented with kanamycin.

[0195] (1-c)Positive clone screening:

[0196] The colonies that had completed single crossover were streaked on LB plates containing 15% sucrose. The grown colonies were those that had completed two homologous crossovers. 30 colonies were picked and verified by colony PCR using primers Ptac-F and PaleuDHdw-R to obtain strain HM141. (2) Obtaining of strains HM142 to HM156

[0197] The construction process of each strain in this step adopted exactly the same method as in Example 3(1).

[0198] It included the following strain modifications:

[0199] Starting from strain HM141, the 2-oxoisovalerate dehydrogenase regulatory protein gene in this strain was replaced with the tac promoter to obtain strain HM142.

[0200] Starting from strain HM142, the promoter of the isovaleryl-CoA dehydrogenase gene in this strain was replaced with the tac promoter to obtain strain HM143.

[0201] Starting from strain HM143, the promoter of the enoyl-CoA hydratase gene in this strain was replaced with the tac promoter to obtain strain HM144.

[0202] Starting from strain HM144, the lactose operon repressor protein gene in this strain was replaced with a gene expression cassette containing the tac promoter and Escherichia coli thioesterase to obtain strain HM145.

[0203] Starting from strain HM145, the promoter of the 2-isopropylmalate synthase gene in this strain was replaced with the tac promoter to obtain strain HM151.

[0204] Starting from strain HM151, the branched-chain amino acid aminotransferase gene in this strain was replaced with a gene expression cassette containing the tac promoter and Pseudomonas aeruginosa branched-chain amino acid aminotransferase to obtain strain HM152.

[0205] Starting from strain HM152, the promoter of the acetolactate synthase gene in this strain was replaced with the tac promoter to obtain strain HM153.

[0206] Starting from strain HM153, the promoter of the dihydroxyacid dehydratase gene in this strain was replaced with the tac promoter to obtain strain HM154.

[0207] Starting from strain HM154, the acetyl-CoA synthetase A gene in this strain was replaced with a gene expression cassette containing the tac promoter and xylulose-5-phosphate / fructose-6-phosphate phosphoketolase derived from Bifidobacterium adolescentis to obtain strain HM155.

[0208] Starting from strain HM155, the acetyl-CoA synthetase B gene in this strain was replaced with a gene expression cassette containing the tac promoter and phosphoacetyltransferase derived from Escherichia coli to obtain strain HM156.

[0209] In the construction process of each strain, the differences from Example 3(1) were that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the information of the obtained strains are shown in Tables 7, 8, and 9.

[0210] Table 7 Genotypes of Strains in Example 3

[0211] Strain name Starting strain Genotype HM141 Pseudomonas aeruginosa PAO1 KT2440, ΔPPaleuDH::Ptac HM142 HM141 HM141, ΔPabkdR::Ptac HM143 HM142 HM142, ΔPPaliuA::Ptac HM144 HM143 HM143, ΔPPaech::Ptac HM145 HM144 HM144, ΔPalacI::Ptac-PaaI HM151 HM145 HM145, ΔPPaleuA::Ptac HM152 HM151 HM151, ΔPailvE::Ptac-PailvC HM153 HM152 HM152, ΔPPailvIH::Ptac HM154 HM153 HM153, ΔPPailvD::Ptac HM155 HM154 HM154, ΔPaacsA::Ptac-Bafxpk HM156 HM155 HM155, ΔPaacsB::Ptac-Ecpta

[0212] Table 8 Gene Editing Fragments and Sequences in Example 3

[0213] Serial number Fragment name Sequence (5'-3') SEQ ID NO.67 PaleuDHup GGAATGTCCAGCCGCCGCGCCAGTTCCATGGCCACCAGCGCCAGCGACAACGGCTGTCCCTGGCGCCGCTGCAGCACCAGCGGGAGCAGGGCCGAGCGCGGTTGCAGGGGGAAGTCGTCGTCTTCGCAGAAACCCTGTTCGCTCATTCGCCGCAGCAACCCCTGGGCGCGCTCGCTGGCCGAGGCGCGGTCGTCCAGGCTGGCGCCGATCTGCCGGACGAGTTCGTCGAGCTCGCGCAGGGCGTGGGCGGGCGAATACGCCGGGAGGTGCTCCGCGGCGATCCACAGGGCCGCCTCGAACAGCGCTGGCGGTTCCTGGGCGAGACAATCGAGGCAGGCTTGACGCGGGTCCATGGCTTTCCTCCTGGTGCGCCTGGATCGCTGCGGACGGGCCGTTCGGAGCACGCCGGGGCCGGTTTCGAGCGGGCGGACCCCAAGGTTGTAACCGTCCGCCGAAGCTTCGTCCAGTACCCGGCTCGGCGAGCGCCGCCGCCTGGTCGT SEQ ID NO.68 Ptac ttgacaattaatcatcggctcgtataatg SEQ ID NO.69 PaleuDHdw GCAAGCAGGGGAGCCCCAGCATGTTCGACATGATGGACGCGGCCCGGCTCGAGGGTCTCCACCTCGCCCAAGACCCGGCCACGGGACTCAAGGCCATTATCGCCATCCACAGCACGCGACTCGGCCCGGCGCTGGGTGGTTGTCGCTACCTGCCTTACCCCAACGACGAAGCCGCCATCGGCGACGCCATCCGCCTGGCCCAGGGCATGAGCTACAAGGCGGCCCTGGCCGGGCTGGAGCAGGGCGGCGGCAAGGCGGTGATCATCCGCCCGCCGCACCTGGACAATCGCGGCGCGCTGTTCGAGGCCTTCGGGCGCTTCATCGAAAGCCTCGGCGGACGCTACATCACTGCGGTGGACAGCGGTACCTCCAGCGCCGACATGGACTGCATCGCCCAGCAGACCCGCCACGTCACCAGCACCACCCAGGCCGGCGACCCCTCGCCGCATACCGCCCTCGGCGTGTTCGCCGGGATTCGCGCCAGCGCCCAGGCGCGCCTC SEQ ID NO.70 PabkdRup CGGGTCGGCCTCGTTGGAGAGAAGCTGGCAGATCATGTCCACCAGCGGGTATTCGCGGGTGATCAGGATGCCTTGCTGGCGATAGGTCGGAAAGCACATGTCGCCGTCGCGCAGGGCCAGGGTGTGGGCGGTGGCGATGGCTTCCTCGCCGAGGCATTGCATATAGAAGGAAAGCTTTTTCTGCCGTTGCGCGGTGAGCATGCGCGCGTCGAACAGGCGGGTCTTGAGCATCGCCCGCATGCCGCGCAGCAGTTGTTCGTTGCTGAGCTGCGGATTCCAGGGACCGACGGCGTGGCCGTCGTCGTCGAGCACACGTACCAGGCTGTAGGCCAGGTCGCTGGTCTCGGCGGGCTCGACATCCACCGGCGGCTTGCGTACCTCGCCGGCGGGGGACAGGTGCAGATAGGAAAAGTCGGTCTTGCAGCCAGGACGCCCGGTGGGCTCCGGGACATGCAGACGCAACGGCTCGTAATCACTCATGACAGGCCTCCGGCCCGGTC SEQ ID NO.71 PabkdRdw GCATAGACCCTGTCTATCTGCGTAACGTTACGCTATTCTGATTGCGTAACGTTACGCAGATAGAGGCGTTCATGAAAGCCAGCAAACCCGGGCCCAAGCCGAGCGGCAAGGCCAAGTCGGCCGCCCAGCGGATGCGCGAATACCGCGCGCGCAAGGCCGAAGAGGCCCTCGGCGCCGAGCATTCCGACAAGGAGCGCGAGCGGCAGATCCGCCGTGAGGCGCGCGCCGAACTCGAACGCGTGAAGCTGGAGCAGCAGCGCCGCGAACACACCCTGCGCAAGGAACTGGAAGCCTGCCAGACCGAGATTGGCCGCCTGCTCGGCCTGCTGCGCCGGCACGGCATCGATCCGCACCCGGGCAACTGATCAGCCGGGCGTGTCGAGGAAGGCCAGCAGGGTCGCTTCCTCGGCACTCAGCCAGCGGCGCTTGCGGGCGCGCCTGAGCTGGCCCAGTTGCCCGGCCTGGTAGGCCTCGATGATCGCCGGGTGGATGTAGCATTG SEQ ID NO.72 PaliuAup CCAGGCGTTGACAGGATTTCGGCGCAGCTTTACGTTAACGTAAAGGTAAACAAGCAGGTGCCAGCGCATGTCCATCACCTACACCATCTCCGATCTCGCCCGCGAACTGGACATCACCACCCGCGCCATCCGCTTCTACGAGGAGCAAGGCCTGCTCTCCCCCGAGCGACGCGGCCAGGAACGCATCTATTCGCCGCGCGACAAGGTCAGCCTGAAGCTGATCCTGCGCGGCAAGCGCATCGGTTTTTCCCTCGCCGAATGCCGCGAACTGATCGAGCTCTACGACCCGGACCCGAGCAGCGGCAACCAGAAGCAGTTGAACACCATGCTGGAGAAGATCGCCGAGCGCCGCGCCCAGCTGGAACAACAGTTGCTGGACATCGAACAGATGCAGCTGGAACTGGATACTGCCGAGGAGCGCTGTCGAGCGGCGCTTATCAAAAGCTATAACAAACATACAGTTGAAACATAAACCTCATTCAAAGCTTTAAACCGGACAA SEQ ID NO.73 PaliuAdw GCACAATTACAGGTGAAAGCATGACCTATCCCAGCCTCAACTTCGCCCTCGGCGAAACCATCGACATGCTCCGCGACCAGGTGCGCGGCTTCGTCGCCGCCGAACTGCAGCCGCGCGCCGCGCAGATCGACCAGGACAATCAGTTCCCCATGGACATGTGGCGCAAGTTCGGCGAGATGGGCCTGCTCGGCATCACCGTCGACGAGGAGTACGGCGGTTCGGCGCTGGGCTACCTGGCCCACGCCGTGGTCATGGAAGAGATCAGCCGGGCCTCGGCTTCGGTGGCGCTCTCCTATGGCGCGCATTCCAACCTCTGCGTCAACCAGATCAAGCGCAACGGCAACGCCGAACAGAAGGCCCGCTACCTGCCGGCCCTGGTATCCGGCGAACACATCGGTGCGCTGGCGATGAGCGAACCCAACGCCGGCTCCGACGTGGTCTCGATGAAGCTGCGCGCGGACCGGGTCGGCGACCGCTTCGTTCTCAACGGCAGCAAGATG SEQ ID NO.74 Paechup TTTCTGCGTGGCGAGCCGCATCTGGTGCAGGGCGAGCAGGTCATCGGCGGTCCCTGCCGCGAAGACGGGGAGGCTCAGCAGGCCGAGCAGGGCCAGACAAAGAGTGAACGGACGGCAGATCATGGGTTCCATCTCCATGTGGCCCTGGAGGCCTTCTTGTTGTTCTTTTGTAACGGCCCGTGGCCGATCATGCATGGCGATCTGCGGCGACTCTAGCCTGCCTTTCCGCACCGGGACAAGCGCCCACGGCGCCGATCATCGAACATCTGAATGGTACGACAGAGGCTGGCTGAATGGCCCTGCGCAGAGGGCCTGGAGGAGGGCAGGTGTTTTCCGGATGGCTGATTGACAATTCCCGGCTTTTGCCGGAATGTGTGCGCACCCAAGTCAAACGGGCGTATGAATCGAGCGTTTGCCTCGCGCAGGCCTCGACAATAGAGACCCGGTTATCGCGTCGGCGGGTGTGCCGAAGGGTTTGGGACTATGCTCGGCGGTTGCCG SEQ ID NO.75 Paechdw AATAGCGTGGAGATCAGTTGATGATTTACCAAGGTAAAGCCATCACGGTTAAGCCTCTTGAGGGCGGCATCGTCGAGTTGAATTTCGATCTCAAGGGCGAGTCCGTCAACAAGTTCAACCGTCTCACCCTCAGTGAGTTGCGTGCGGCAGTCGATGCGATCAAGGCCGATGCATCGGTCAAGGGCGTGATCGTGACCAGCGGCAAGGACGTGTTCATCGTTGGTGCCGACATCACCGAGTTCGTTGACAACTTCCAGCTGCCCGACGAGGAACTGATGGCGGGCAACCTCGAAGCCAACAAGATCTTCAGCGACTTCGAAGACCTGGACGTACCCACCGTTGCCGCGATCAACGGCATCGCCCTCGGCGGCGGCCTGGAGATGTGCCTGGCCGCGGACTTCCGCGTGATGAGCGCGACCGCCAAGGTCGGCCTGCCGGAAGTCAAGCTGGGCATCTACCCGGGCTTCGGCGGCACCGTCCGCCTGCCGCGCCTGATCGGC SEQ ID NO.76 PalacIup ATGGACGTGGTGGTGCCGTACATCCATGACCGCCGCCAGTTCGGCCAGAGCATCGGCGAATTCCAGCTGGTCCAGGGCAAGGTGGCCGACATGTACACCGCCCTCAACGCCAGCCGCGCCTACCTGTACGCCGTGGCCGCCGCCTGCGACCGCGGCGAGACGACCCGCAAGGACGCCGCCGGGGTGATCCTCTACAGCGCCGAGCGCGCCACCCAGATGGCCCTGGACGCGATCCAGATCCTCGGCGGCAACGGCTACATCAACGAGTTTCCCACCGGCCGCCTGTTGCGCGACGCCAAGCTCTACGAGATCGGCGCCGGCACCAGCGAGATCCGCCGCATGCTGATCGGCCGCGAGCTGTTCAACGAAACCCGCTGAAGCCTCGCTCTTCCCGGCCCTTTTCCGCCAGGGAGAGGGCATTCCATTGCATCGACAGGCGCATCGCCAGGTCGGGAGCGGGCGCCAACCGCTTCCGCCCACCTCGACACGGAGCCACCGCC SEQ ID NO.77 PalacIdw CAGCCAAGACGAGGAACAGCATGAACCTGCCGAAGAAGGTCCGCCTGGTGGAGGTCGGTCCGCGCGACGGACTGCAGAACGAGAAACAGCCGATCGAGGTGGCCGACAAGATCCGCCTGGTCGATGACCTGAGCGCCGCCGGCCTGGACTACATCGAAGTGGGCAGCTTCGTCTCGCCCAAGTGGGTGCCGCAGATGGCCGGCTCGGCCGAGGTATTCGCCGGCATCCGCCAGCGTCCCGGCGTGACCTACGCGGCGCTGGCGCCGAACCTGAAAGGCTTCGAGGCGGCGCTGGAGTCGGGAGTGAAGGAAGTGGCGGTGTTCGCCGCCGCGTCGGAAGCCTTCTCCCAGCGCAACATCAACTGCTCGATCAAGGACAGCCTGGAGCGCTTCGTACCGGTGCTGGAGGCGGCGCGCCAGCACCAGGTGCGGGTGCGCGGCTACATTTCCTGCGTGCTCGGCTGTCCCTACGACGGCGATGTCGATCCGCGCCAGGTCGCC SEQ ID NO.78 PaleuAup CCATCCCCGGCATGCCGGCATGGACGACGGAGCGCTGGGCATCGGAACAGCCGGCATGGGCCATGTCGCCATGGTCCATGTTCTCGTGGGACATGCCTTCGTGGCCCATCCCCACGCCCATCGGCATCGGGTGGTCCATCGGCATCGACTGGGAGATCAGCGGCCCGACGAAGATCATCAGCATGGCGAACAGAGCCAGCCATGCACCGATGCCTTGTCGTTTCAGAGTGGTCGCCACCTGCGACTCCCGCCGTCTTGAATGAAGACCACCGCGTAGCGGGCCGGATGGCCGCTCGCGCCGGGTCATGCCGAAAAGAAGAATGCGCCTGTCGTTATACGCCCCAGGCACGGGGAACGAAATGATCGCACAAGGGCGGCTGGCTCTTCTGCGGCATGGGGCCGCAGAATTTTCCGTTGCGGAGAGCGTGCCGGCGGCGCAATCGAGGACAAGCTTTCACCGCAGAGAAAGAATAAAAACCCACAAAAGCCGCACAAATGGG SEQ ID NO.79 PaleuAdw CTCCGCCAACACGCCTGCCTGTGCCTGGTCAGCCCGCGACTGCGTGGCTGAGCGACGCTTCTCTTCATCTCGTCACTGCGTTCGCCTGGCCCCGCCGGCCCAGGAACCGACTCCAAAGGATTAGCCCCATGAGCATGTTGAAAGACCCTTCGCAGAAATACCGCCCATTCTCGGCCATCAATCTGCCCGACCGCACCTGGCCGTCGAAGACCATCACCGAGGTGCCGATCTGGTGCAGTTCCGACCTGCGCGACGGCAACCAGTCGCTGATCGAACCGATGGACGCGGCGAAGAAGATGCGATTCTTCAAGACCCTGGTGCAGGTCGGCCTGAAGCAGATCGAAGTGGCCTTCCCGTCGGCTTCCGATACCGACTTCAACTTCGTCCGCGAGTTGATCGAAGGCAACCACATCCCGGACGACGTCACCATCCAGGTGCTGACCCAGGCCCGCGAAGACCTGATCACCCGCACCTTCGAATCCCTGCGCGGGGCGAAGAAG SEQ ID NO.80 PailvEup GCTGGCGAGGCCGCGCGATCTCGACGCGTTGCGCACCGAAGTCAGCGAAATGCGCGCCAAGATGCGCGACAACCTGGGAACCCGCGCGACCGCCGCCGGTACCGCCTCGAATGCCTTCGAGGCCACGGCAGCCTTCGATCTCAAGCACGATGCCGGTGGTATCGTCGATATCGAATTTATGGTGCAATATGCGGTTCTAGCTTGGTCCGGAGAACACCCGGCGCTGCTCGAATTCACCGATAACATCCGCATTCTGGAAGGACTGGAACGGGCTGGCCTGATCGCCAGCGAGGACGTCCGTCTCCTGCAGGAGGCCTACAAGGCCTATCGCGCAGCCGCACACCGCCTGGCACTACAGAAGGAGGCCGGGGTCGTGAGCGGCGAGCACTTCCAGACGGAGCGGCGAGAAGTGATCAGGATCTGGCGCGAGCTGCGGCTCGGCTGATCCACTCAGGCACGTAACGCAAGTACGTAACGAATATCTGAAGGAGCTGGCAACT SEQ ID NO.81 PailvC ATGCGCGTTTTCTACGATAAAGACTGTGACCTCTCGATCATCCAGGGCAAGAAAGTTGCCATCATCGGCTACGGCTCCCAGGGCCACGCCCATGCCTGCAACCTGAAGGACTCCGGCGTCGACGTCACCGTGGGCCTGCGTAGCGGCTCCGCCACCGTGGCCAAGGCCGAAGCGCACGGTCTGAAGGTTGCCGACGTGAAGACCGCCGTCGCCGCAGCCGACGTGGTCATGATCCTCACCCCGGACGAGTTCCAGGGCCGCCTGTACAAGGAAGAGATCGAGCCGAACCTGAAGAAGGGCGCCACCCTGGCCTTCGCTCACGGCTTCTCCATCCACTACAACCAGGTCGTCCCGCGCGCCGACCTCGACGTGATCATGATCGCGCCGAAGGCACCGGGTCACACCGTGCGTTCCGAGTTCGTCAAGGGCGGTGGCATCCCTGACCTGATCGCCATCTACCAGGACGCTTCCGGCAACGCCAAGAACGTCGCCCTGTCCTACGCCTGCGGCGTCGGCGGCGGTCGTACCGGTATCATCGAAACCACCTTCAAGGACGAGACCGAAACCGACCTGTTCGGTGAGCAGGCCGTTCTCTGCGGTGGTTGCGTCGAGCTGGTCAAGGCCGGTTTCGAAACCCTGGTCGAAGCCGGTTACGCGCCGGAAATGGCCTACTTCGAGTGCCTGCACGAGCTGAAGCTGATCGTCGACCTGATGTACGAAGGCGGCATCGCCAACATGAACTACTCCATCTCCAACAATGCCGAATACGGTGAGTACGTAACCGGTCCGGAGGTGATCAACGCCGAGTCCCGTGCTGCCATGCGCAACGCCCTGAAGCGCATCCAGGACGGCGAGTACGCGAAAATGTTCATTACCGAAGGTGCGGCCAACTACCCGTCGATGACTGCCTACCGCCGCAACAACGCCGCTCACCCGATCGAGCAGATCGGCGAGAAGCTGCGCGCGATGATGCCGTGGATCGCAGCCAACAAGATCGTCGACAAGAGCAAGAACTAA SEQ ID NO.82 PailvEdw GCACCGAAGAAGGGTGTGACAGGGAGGCGAAAGCCTCCCTGATCATTTCCGGAGCCTGAATGAGAATTCTGATCGTAGGTCCCTCCTGGGTGGGGGACATGGTGATGGCGCAGACCCTGTTCCAGTGTCTGCGCCAGCGGCATCCCGAGTGCGTGATCGACGTGCTGGCGCCCGAGTGGAGCCGACCGATCCTCGAGCGCATGCCCGAGGTGCGCCAGGCCCTGAGCTTCCCGCTCGGCCACGGGGTGATGGACGTCGCCACACGGCGCCGGATCGGACGCGGCCTGCGCGGTCAGTACGAGCAGGCGATCCTGCTGCCCAACTCGCTGAAGTCGGCGCTGGTGCCCTGGTTCGCCGGAATACCGAAGCGTACCGGCTGGCGCGGCGAGATGCGCTACGGGCTGCTCAATGACATCCGCAAGCTCGACAAGCAGCGCTATCCGCTGATGATCGAACGCTTCATGGCCCTGGCCTTCGAGCCGGGCGTGGAGTTGCCGAAG SEQ ID NO.83 PailvIHup TGCGCTCGGCCTCTTCCTTCGCCACTTGCTGCTTCACCTTGTCGTCGATCGCCTTCTGCTCGGGATCGGCCGGTTTCTGCTGGATGGTCGGTGCCGGGGTCGAGGGGGGCAGGGGGAAGTTGTCCGGCGGCGGGGCGGTCTGGGTATTCACCGTGGTCGCTTGCGCACCTTGCGGCGGTTGTGCGCCGAAGTGGGTGACGCCCTCGGCGTCGACCCATTTGTAGATCGGGGCGGCCATGGCGAAAGAGGAGAGGGCGAGCAACAAGCTGGCCGGGAGGATCATGCGTCGCATGCGGAGTCCTTGGAATGCGCTAACTGCGGCTAACTATAACCAAATCCGCCAGCGCGGCATGCTGCACGGCATCACAACCGCCGCCGGAGACGGCCTCGCCGTGGCAAGTCCTCGCGGGAATCATGGGCATTTTGGAAAAGTTTGCTCTAAATCGGAATTTTCTAGCCATAAAATCTGTTTTTGGTCATTGATCAGCTTTTTTATGGAA SEQ ID NO.84 PailvIHdw AGCGTTCTAGAGGTGAAAACGTGGAGCTTTTATCTGGCGCTGAAATGGTCGTCCGCTCGTTGCGCGACGAAGGCGTTAAGTACATCTACGGGTACCCGGGTGGTGCCCTCCTGCATATCTACGACGCGCTCTTCAAGGAGCACGACGTGACCCACATCCTGGTGCGCCACGAACAGGCGGCTACCCATATGGCCGACGGCTACGCCCGCGCCACCGGCAAGCCCGGTGTCGTGCTGGTGACTTCCGGCCCGGGCGCGACCAACGCCATCACCGGTATCGCCACCGCATACATGGACTCCATCCCGATGGTGATCCTGTCGGGCCAGGTGCCGAGCAACATGGTCGGTACCGATGCGTTCCAGGAAACCGACATGGTCGGGATCTCCCGGCCGATCGTGAAGCACAGCTTCATCATCAAGCATCCCTCGGAAATTCCCGAGGTGATCAAGAAGGCCTTCTACCTGGCGCAGTCCGGTCGTCCGGGGCCGGTGGTCGTGGAT SEQ ID NO.85 PailvDup GGTCGCCTGCGTCGAGGGCGACGTGTTCGAGGCCCTGCGCGAGCTGAAGGCCGCCGACGAACGCTTCGACGTAGTGATCGCCGACCCGCCGGCCTTCATCAAGCGCAAGAAGGACCTGAAGAACGGCGAGGCCGCCTACCGCCGTCTCAACGAACAGGCCATGCGCCTGCTGAGCAAGGACGGCATCCTGGTCAGCGCCTCCTGCTCGATGCACCTGCCCGAGGACGACCTGCAGAACATCCTGATCGGCAGCGCCCGCCATCTCGACCGCAACATCCAGCTGCTCGAGCGCGGCGGCCAGGGCCCCGACCATCCGGTGCACCTGGCGATCGCGGAAACCCGCTACATCAAGAGCCTGACCTGCCGGCTGCTGCCCAACGGCTGAGCCCGTCCCGGCGGATGAGCGCCTGCGTTCATCCGCCCTACGGCCACCGCCTCTCGCGGCGCGACGGGCGGCGCAAGAGGCCAACCCTGGTCGCGACGCGCCGCTCCGCCGACCG SEQ ID NO.86 PailvDdw ATTAGCCGCAGGAAATCGTCATGCCCGATTACCGCTCGAAAACCTCCACCCACGGCCGCAACATGGCCGGCGCCCGCGCCCTCTGGCGCGCCACCGGGATGAAGGACGAAGACTTCAAGAAGCCGATCATCGCCATCGCCAACTCCTTCACCCAGTTCGTGCCCGGCCACGTGCACCTGAAGGACCTCGGCCAACTGGTCGCCCGCGAGATCGAGAAGGCCGGCGGCGTGGCCAAGGAATTCAACACCATCGCCGTCGACGACGGCATCGCCATGGGCCACGACGGCATGCTCTATTCGCTGCCGAGCCGGGAGATCATCGCCGACTCCGTGGAATACATGGTCAACGCCCACTGCGCCGACGCCATCGTCTGCATCTCCAACTGCGACAAGATCACCCCCGGCATGCTGATGGCCGCGCTGCGCCTGAACATCCCGGTAGTGTTCGTCTCCGGCGGGCCGATGGAAGCCGGCAAGACCAAGCTGGCCAGCCACGGCCTG SEQ ID NO.87 PaacsAup GCTGCTGGTCGCCGGCAGCTTCATGGAGCCCTCGGCGATCGTGCTGATCCTGGCGCCGATCTTCTTCCCCATCGCCATGAAGCTGGGCATCGACCCGATCCACCTGGGCATCGTCATGGTGGTGAACATGGAGATCGGCCTGGTACACCCGCCGGTCGGCCTCAACCTGTTCGTCACTTCGGCGGTCACCGGCATGCCGCTGGGGGCGACCATCCGCGCGGCGCTGCCGTGGCTGATGATCCTGCTGCTGTTCCTGATCCTGGTGACCTACGTGCCGTTGATCTCGCTGTGGCTGCCGGGCCTGCTGGGCATGAGCTGAGGTCGCGGCGGCGGGGCGCGGGACGCGCTCCGCCGCTGGCGCAAGGCTACGATCGGCGCGGCTTATAGCTACTATCGGCGCTGTCGCGCAGTGGTAAGACCATGGTCGTATGGTTCGTGGGGTGTGCGCTCGCTACAACTGGGCACAACAAAAACAACACTCACGTACCGAGGTTAAAGCC SEQ ID NO.88 PaacsAdw CTTCCGCCTGATCCGAAACGACCCCGCGCGGTGCGAGCCGCGCGGGGTCTTTCATTTGGCGCGGGCCGAGGAGGAGGGCGTTTCGAATGGGCTCGCGCCGGGAATGGGGCGGCGGTAACACTTCGGTGATGCGCGCCTGCGCATAATTGGGGCGAGAGGAAACGCCACGCACAGCCAAGGTGCGACACGGGGTAGCAGTCGAGGCGAGTCGTAGCGGGCAAGCCATTGAAGGAGAAGGAATTGGCAATTTATGGCTTGAGATTTGCTTTACTCATTGATTACACTTCGCGCTTTCCGGGCACAAATGTCGCTGCCTGTCAATATCGCCGAATGCCCTCTTCGGTGCTTTTATAATTAGTTGTCGCATTGAAGAAATAACCACTTTCGGCCTGTCGCTAGAATGCCGCTCACCCCAGCTGGCGCCCTGTCCACGAGAAGGCGCCATGCGCAAGAGCCGGTGATCACGCATATCCGTCGGCAGCCTGGGCAAGGTTCTATTT SEQ ID NO.89 PaacsBup GCCGGAAGCCGAAGTGCAGCGCCTGGCGCCGCACAAGGTGATTCCGGGCAACCGACCGAGCAACACCCTGGTGGTCGAGCGCATCAGCGCCCGCCGCCTCGGCGCGCTGATCGCCATGTACGAGCACAAGGTCTACGTACAGAGCATCCTCTGGGGCATCAACGCCTTCGACCAATGGGGCGTGGAGCTTGGCAAGGAACTCGGCAAGGGTGTCTATTCGCGCCTGGTCGGCAGCGAGGAAACCCCGGCCGAGGACGCCTCGACCCAAGGCCTGATCGACTTCTTCCGCGGCCGCCATCGCGGCTGATCCGCCTCTCCCCAAAGCCCGGCCCTAGGCCGGGCTTTTTCATTCCGTCCGGCGATTGACCCCGGCGCCTTCCCCGCTCGCGCCTTTGGCACTTGAACATGGCTCTCGCCTGGCCCACCCTTGGTCGAACCTGGAGAGGGGCCGCGTGCGGTCTCTCGACACCTTGCGGAGCAGAAAAACAAAGGAAACCGCC SEQ ID NO.90 PaacsBdw CCCGCGCAACCGTCCCGCCGCCCTGCGGCGCGGGACGGTTCCAGTCTCTCCGGCGCCTGGGTTAAGCTCGTGCCTGCCCTGTCGTAGCGAGCCCCCCATGGAAAGCGTCCGTCGCCATATCGAAAGCCAGGTGCTGAGCCTTACCGGGCTCGCCGTCGGCGGTGTCGACTTCGAGTCGCCGAAAGGCGATCCGGGCCTGTTCGGCCCCGATGCCGCCTGCTGGAAGGTCCACGGCGACTTCAGCAGCATGATGATCGGCGGCATCGGCGCGCTGCTCCTGCAGATGCTCCATCCGCTGGCCCTGGCGGGGGTGTGGGACCACTCCAATTTCCGCGACGACCTGCTCGGGCGCCTGCGTCGCACCGGTCAGTTCATCTCGGCCACCACCTACGGCCCGCTGGCCGATGCCGAGCGACTGATCGAGCGGGTCCGGCGCATCCACGAAAGCGTCATCGGCCAGTTGCCCGACGGCACGCCCTACTCCGCCAGCGACCCGGACC

[0214] Table 9 Primers Used in Example 3

[0215] Primer Sequence (5'-3') PaleuDHup-(pK18)-F attacgaattcgagctcggtGGAATGTCCAGCCGCCGCG PaleuDHup-(Ptac)-R cattatacgagccgatgattaattgtcaaACGACCAGGCGGCGG PaleuDHdw-(Ptac)-F aatcatcggctcgtataatgGCAAGCAGGGGAGCCCCAGC PaleuDHdw-(pK18)-R gtgccaagcttgcatgcctgGAGGCGCGCCTGGGCGCTG Ptac-F gacaattaatcatcggctcgta PaleuDHdw-R CCTGCACCGCGACCCGCAGG PabkdRup-(pK18)-F attacgaattcgagctcggtCGGGTCGGCCTCGTTGGAG PabkdRup-(Ptac)-R CTCAATAttgacaattaatcatcggctcgtataatgGACCGGGCCGGAGGCCTGTC PabkdRdw-(Ptac)-F gattaattgtcaaTATTGAGAATTAGAAATTAAATGGGAAATTTACTGAGCCAATCCCGCATAGACCCTGTCTATCTG PabkdRdw-(pK18)-R gtgccaagcttgcatgcctgCAATGCTACATCCACCCG PabkdRup-R GCCTCCTTGCTCGAGTAC PaliuAup-(pK18)-F attacgaattcgagctcggtCCAGGCGTTGACAGGATTTC PaliuAup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATATTGTCCGGTTTAAAGCTTTG PaliuAdw-(Ptac)-F caattaatcatcggctcgtataatgGCACAATTACAGGTGAAAGC PaliuAdw-(pK18)-R gtgccaagcttgcatgcctgCATCTTGCTGCCGTTGAG PaliuAdw-R GGCGTAGATCACATAGGTATG Paechup-(pK18)-F attacgaattcgagctcggtTTTCTGCGTGGCGAGCCG Paechup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATACGGCAACCGCCGAGCATAG Paechdw-(Ptac)-F caattaatcatcggctcgtataatgAATAGCGTGGAGATCAGTTG Paechdw-(pK18)-R tgccaagcttgcatgcctgGCCGATCAGGCGCGGCAGG Paechdw-R CTCGGCCTTGTTTTCCTTGC PalacIup-(pK18)-F attacgaattcgagctcggtGGCATTTCGCCGGCCTTC PalacIup-(Ptac)-R acgagccgatgattaattgtcaaAATTTCTAATTCTCAATAACGTCCTTCATTGTCGCC EcpaaI-(Ptac)-F acaattaatcatcggctcgtataatgGGCGCTTCTGGAGAGCGGTTATG EcpaaI-(dw)-R GGCTCAGTAAATTTCCCATTTTCAGGCTTCTCCTGTAATGG PalacIdw-(ppaI)-F AATGGGAAATTTACTGAGCCAATCCCCGCCGCTGGTGCGGGTCTGA PalacIdw-(pK18)-R gtgccaagcttgcatgcctgGGCTTTCCAGTTGGCAGACT PalacI-R CGGGTTGAGGATCACCGTC PaleuAup-(pK18)-F attacgaattcgagctcggtCCATCCCCGGCATGCCGGCATGGA PaleuAup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATACCCATTTGTGCGGCTTTTGT PaleuAdw-(Ptac)-F caattaatcatcggctcgtataatgCTCCGCCAACACGCCTGCCT PaleuAdw-(pK18)-R gtgccaagcttgcatgcctgCTTCTTCGCCCCGCGCAGGG PaleuAdw-R GACGATGCGGCGGAACGACGGG PailvEup-(pK18)-F attacgaattcgagctcggtGCTGGCGAGGCCGCGCGATC PailvEup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATAAGTTGCCAGCTCCTTCAG PailvC-(Ptac)-F caattaatcatcggctcgtataatgCTTACTGAAGGGGAATTCCC PailvC-(ilvEdw)-R GGATTGGCTCAGTAAATTTCCCATTTTTAGTTCTTGCTCTTGTCGACG PailvEdw-(ilvC)-F GAAATTTACTGAGCCAATCCCGCACCGAAGAAGGGTGTGAC PailvEdw-(pK18)-R gtgccaagcttgcatgcctgCTTCGGCAACTCCACGCC PailvEdw-R CCTGGCGGCTGCCGTCGTC PailvIHup-(pK18)-F attacgaattcgagctcggtTGCGCTCGGCCTCTTCC PailvIHup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATATTCCATAAAAAAGCTGATC PailvIHdw-(Ptac)-F caattaatcatcggctcgtataatgAGCGTTCTAGAGGTGAAAAC PailvIHdw-(pK18)-R gtgccaagcttgcatgcctgATCCACGACCACCGGCCC ilvIHdw-R CGCAACTTGACCTTCTTCGG PailvDup-(pK18)-F attacgaattcgagctcggtGGTCGCCTGCGTCGAGGG PailvDup-(Ptac)-R tacgagccgatgattaattgtcaaAATTTCTAATTCTCAATACGGTCGGCGGAGCGGCGC PailvDdw-(Ptac)-F caattaatcatcggctcgtataatgATTAGCCGCAGGAAATCGTC PailvDdw-(pK18)-R gtgccaagcttgcatgcctgCAGGCCGTGGCTGGCCAG PailvDdw-R GACCTTCTCGTCGGAGCAGG PaacsAup-(pK18)-F attacgaattcgagctcggtGCTGCTGGTCGCCGGCAG PaacsAup-(Ptac)-R ttatacgagccgatgattaattgtcaaAATTTCTAATTCTCAATAGGCTTTAACCTCGGTACGTG BaFxpk-(Ptac)-F tgacaattaatcatcggctcgtataatgATATAACCAGGGGTATTTTCatgacgagtcctgttattg BaFxpk-(Ppacsdw)-R TTGGCTCAGTAAATTTCCCATTTtcactcgttatcgccagcggttg PaacsAdw-(BaFxpk)-F TGGGAAATTTACTGAGCCAATCCCCTTCCGCCTGATCCGAAACG PaacsAdw-(pK18)-R gtgccaagcttgcatgcctgAAATAGAACCTTGCCCAGGC PaacsAdw-R CGAGCTTCTTCATCTGGAAC PaacsBup-(pK18)-F attacgaattcgagctcggtGCCGGAAGCCGAAGTGCAG PaacsBup-(Ptac)-R gagccgatgattaattgtcaaAATTTCTAATTCTCAATAGGCGGTTTCCTTTGTTTTTC Ecpta-(Ptac)-F tgacaattaatcatcggctcgtataatgGTAACGAAAGAGGATAAACCATGTCCCGTATTATTATGCTG Ecpta-(acsBdw)-R GATTGGCTCAGTAAATTTCCCATTTTTACTGCTGCTGTGCAGACTGAATCGC PaacsBdw-(Ecpta)-F GGAAATTTACTGAGCCAATCCCCCCGCGCAACCGTCCCGCCG PaacsBdw-(pK18)-R gtgccaagcttgcatgcctgGGTCCGGGTCGCTGGCGGAG PaacsBdw-R GCGCAGGTAGGACTTGAG

[0216] Example 4. Preparation of Recombinant Corynebacterium glutamicum Producing HMB

[0217] In Example 4, using Corynebacterium glutamicum ATCC 13032 as the starting strain, recombinant strains HM125 and HM136 for synthesizing HMB were prepared, and the preparation method of this strain refers to Example 1. The genotypes of the recombinant strains are shown in Table 10.

[0218] The preparation methods of the related strains were obtained according to the following steps (1)-(2):

[0219] (1) Heterologously express the leucine dehydrogenase (hereinafter referred to as PpleuDH) gene from Pseudomonas putida in Corynebacterium glutamicum

[0220] Starting from Corynebacterium glutamicum ATCC 13032 (purchased from China General Microbiological Culture Collection Center, CGMCC), the L-lactate dehydrogenase gene in this strain was replaced with the leucine dehydrogenase gene of Pseudomonas putida (hereinafter referred to as PpleuDH). The specific steps are as follows (Reference: Rational Design of a Corynebacterium glutamicum Pantothenate Production Strain and Its Characterization by Metabolic Flux Analysis and Genome-Wide Transcriptional Profiling):

[0221] (1-a) Construction of the plasmid required for heterologous gene expression:

[0222] Using pK18mobSacB (Zhuangmeng Biotech, ZK1642) as a template, the pK18 fragment was amplified with primers pK18-F and pK18-R; using the genomic DNA of Corynebacterium glutamicum ATCC 13032 as a template, the Cgldhup fragment was amplified with primers Cgldhup-(pK18)-F and Cgldhup-(LeuDH)-R, and the Cgldhdw fragment was amplified with primers Cgldhdw-(leuDH)-F and Cgldhdw-(pK18)-R; using the genomic DNA of Pseudomonas putida KT2440 as a template, the PpLeuDH fragment was amplified with primers PpLeuDH-(ldhup)-F and PpLeuDH-(ldhdw)-R; the fragments pK18, Cgldhup, Cgldhdw, and PpLeuDH were ligated using the Gibson Assembly Kit (Novoprotein, C117-01), and then transformed into competent Escherichia coli DH5α to obtain the plasmid pK18-ΔCgldh::PpleuDH.

[0223] (1-b) Transformation of Corynebacterium glutamicum and completion of single crossover:

[0224] The plasmid pK18-ΔCgldh::PpleuDH was electrotransformed into Corynebacterium glutamicum ATCC 13032, and colonies with single crossover were screened by plates supplemented with kanamycin.

[0225] (1-c) Screening of positive clones:

[0226] Pick the colonies that have completed single crossover and streak them on an LB plate containing 15% sucrose. The growing colonies are those that have completed two homologous crossovers. Pick 30 colonies and use primers PpLeuDH-(ldhup)-F and PaleuDHdw-R to perform colony PCR verification to obtain strain HM121.

[0227] (2)Preparation of strains HM122 to HM136

[0228] In this step, the construction process of each strain adopts exactly the same method as in Example 4(1).

[0229] It includes the following strain modifications:

[0230] Starting from strain HM121, replace the CglldA gene (where Cg is the abbreviation of Corynebacterium glutamicum, the same below) in this strain with the Ppbkd gene expression cassette containing the Psod promoter to obtain strain HM122.

[0231] Starting from strain HM122, replace the Cgdld gene in this strain with the Ppivd gene expression cassette containing the Psod promoter to obtain strain HM123.

[0232] Starting from strain HM123, replace the CgpoxB gene in this strain with the Ppech gene expression cassette containing the Psod promoter to obtain strain HM124.

[0233] Starting from strain HM124, replace the cg2266 gene in this strain with the EcpaaI gene expression cassette containing the Psod promoter to obtain strain HM125.

[0234] Starting from strain HM125, replace the promoter of the CgleuA gene in this strain with the Psod promoter to obtain strain HM131.

[0235] Starting from strain HM131, replace the CgilvE gene in this strain with the CgilvC gene expression cassette containing the Psod promoter to obtain strain HM132.

[0236] Starting from strain HM132, replace the promoter of the CgilvBN gene in this strain with the Psod promoter to obtain strain HM133.

[0237] Starting from strain HM133, replace the promoter of the CgilvD gene in this strain with the Psod promoter to obtain strain HM134.

[0238] Starting from strain HM134, the CgadhA gene in this strain was replaced with the Bafxpk gene expression cassette containing the Psod promoter to obtain strain HM135.

[0239] Starting from strain HM135, the cg0273 gene in this strain was replaced with the Ecpta gene expression cassette containing the Psod promoter to obtain strain HM136.

[0240] The difference in the construction process of each strain from Example 4 (1) was that different starting strains, different targeting fragments, and different primers were used. The specific experimental materials used and the information of the obtained strains are shown in Tables 10 and 11.

[0241] Table 10. Genotypes of each strain in Example 4

[0242] Strain name Starting strain Genotype ATCC 13032 13032 HM121 13032 13032, ΔCgldh:: PpleuDH HM122 HM121 HM121, ΔCglldA:: Ppbkd HM123 HM122 HM122, ΔCgdld:: Ppivd HM124 HM123 HM123, ΔCgpoxB:: Ppech HM125 HM124 HM124, Δcg2266:: EcpaaI HM131 HM125 HM125, ΔPCgleuA::Psod HM132 HM131 HM131, ΔCgilvE::Psod-CgilvC HM133 HM132 HM132, ΔPCgilvBN::Psod HM134 HM133 HM133, ΔPCgilvD::Psod HM135 HM134 HM134, ΔCgadhA:: Bafxpk HM136 HM135 HM135, Δcg0273:: Ecpta

[0243] Table 11. Gene editing fragments and sequences in Example 4

[0244] Serial number Fragment name Sequence (5'-3') SEQ ID NO. 91 Cgldhup AAAACAGCCAGGTTAGCAGCCGTAACCCACCACGGTTTCGGCAACAATGACGGCGAGAGAGCCCACCACATTGCGATTTCCGCTCCGATAAAGCCAGCGCCCATATTTGCAGGGAGGATTCGCCTGCGGTTTGGCGACATTCGGATCCCCGGAACTAGCTCTGCAATGACCTGCGCGCCGAGGGAGGCGAGGTGGGTGGCAGGTTTTAGTGCGGGTTTAAGCGTTGCCAGGCGAGTGGTGAGCAGAGACGCTAGTCTGGGGAGCGAAACCATATTGAGTCATCTTGGCAGAGCATGCACAATTCTGCAGGGCATAGGTTGGTTTTGCTCGATTTACAATGTGATTTTTTCAACAAAAATAACACTTGGTCTGACCACATTTTCGGACATAATCGGGCATAATTAAAGGTGTAACAAAGGAATCCGGGCACAAGCTCTTGCTGATTTTCTGAGCTGCTTTGTGGGTTGTCCGGTTAGGGAAATCAGGAAGTGGGATCGAAA SEQ ID NO. 92 PpLeuDH ATGTTCGCGCTGATGCAAAGCACCCGTACCCAGTCACTGCACCTGTTCAATGACCCGCCTACGGGCCTGAAAGCCGTTGTGGCAATCCACAGTGAGCATTTGGGCCCGGCCATGGGGGGGTGCCGCTACCTGCCTTACGCCGATGACGAAAGCGCCATGACCGACGCGATTCGCCTGGCCCAGGGCATGAGCTACAAGGCAGCACTGGCCGGCTTGCCGATGGGGGGTGGCAAGGCGGTAATCATGCGCAACCCGCATGTGGAAAACCGCGCAGCGCTGTTCGAGGCCTTTGGCCGCTTCATCGATACCTTGCATGGGCGCTTCATCATCGCCGTGGACAGTGGCACCTCGACCTTGGACATGGACTGCATTGCCCACAGCACGCCCTACGTGACCAGCACCACTGCATCGGGCGACCCATCGCCACATGCGGCGATGGGGGTGTTCGCGGGCATACGTGCCACAACCTCGTTCCGGCTGGGCAGCGATGACCTGAGAGGCTTGCGGGTAGCGGTCCAGGGGTTGGGCAATGTTGGTTATGCCCTGGCGGAGCAATTGCATGCGGTGGGCGCGGAGCTGCTGGTCAGCGACTTGGACCCGGGGCGGGTGCGGCTGGCGATGGAGCAGTTCGATGCCAAACCGGTGACCAACGATGCGTTGATCAGTACCCCTTGCGATATCTTTGCACCCTGCGGCGTGGGCCCGGTACTGAACGGGCAGAGCGTGATGCAACTGCGTTGTGCGGCAGTGGCGGGGGCGGCCAACAACCAGCTGACTACCTTGCAGGTGGCAGACCAGCTGGAGTCGCGCGGCATATTGTATGCACCTGACTACGTGATCAATGCCGGTGGGCTGATCTATGTGGCACTCACCCACCGTGGCGAAGACCAGCGCACCATTACTGCGCACCTGGCGCGAATCCCTTCACGGCTGACCGAAGTGTTTGGCCATGCGCAGGCGGAGAAGCGTTCGCCGGCAAGGGTGGCGCAGATGTTGGCGGAGCGGTTGTTGTATGGCTGA SEQ ID NO. 93 Cgldhdw ATCTTTGGCGCCTAGTTGGCGACGCAAGTGTTTCATTGGAACACTTGCGCTGCCAACTTTTTGGTTTACGGGCACAATGAAACTGTTGGATGGAATTTAGAGTGTTTGTAGCTTAAGGAGCTCAAATGAATGAGTTTGACCAGGACATTCTCCAGGAGATCAAGACTGAACTCGACGAGTTAATTCTAGAACTTGATGAGGTGACACAAACTCACAGCGAGGCCATCGGGCAGGTCTCCCCAACCCATTACGTTGGTGCCCGCAACCTCATGCATTACGCGCATCTTCGCACCAAAGACCTCCGTGGCCTGCAGCAACGCCTCTCCTCTGTGGGAGCTACCCGCTTGACTACCACCGAACCAGCAGTGCAGGCCCGCCTCAAGGCCGCCCGCAATGTTATCGGAGCTTTCGCAGGTGAAGGCCCACTTTATCCACCCTCAGATGTCGTCGATGCCTTCGAAGATGCCGATGAGATTCTCGACGAGCACGCCGAAATTCTC SEQ ID NO. 94 CglldAup CATTGTCCTTCTGGCAGTTGCTTGCGCCGCCCTCGTTGCCACCATCTGGATGCCACTGTTCGGATCCTTCTCCGACCGCGTCAACCGTGCAGTGCTCTACAGGATCTGTGCATCCGCAACCATCGTGCTGATTGTCCCTTACTACTTGGTCCTCAACACCGGCGAAATTTGGGCACTGTTTATCACTACCGTGATTGGCTTCGGCATCCTCTGGGGTAGCGTCAACGCAATCCTCGGAACCGTCATCGCAGAAAACTTCGCACCTGAGGTCCGCTACACCGGCGCTACCCTGGGTTACCAAGTCGGAGCAGCACTCTTCGGCGGTACCGCACCCATTATCGCAGCATGGCTGTTCGAAATCTCCGGCGGACAATGGTGGCCAATCGCCGTCTACGTCGCTGCATGTTGCCTTCTCTCTGTGATCGCCTCGTTCTTCATCCAACGCGTCGCGCACCAAGAGAACTAAAATCTAAGTAAAACCCCTCCGAAAGGAACCACCC SEQ ID NO. 95 Ppbkd ATGAACGAGTACGCCCCCCTGCGTTTGCATGTGCCCGAGCCCACCGGCCGGCCAGGCTGCCAGACCGATTTTTCCTACCTGCGCCTCAACGATGCAGGTCAAGCCCGTAAACCCGCGATCGATGTCGATGCTGCCGACACTGCCGACCTGTCCTACAGCCTGGTCCGCGTGCTCGACGAGCAAGGCGATGCGCAAGGCCCCTGGGCCGAAGACATCGACCCGCAGATCCTCCGTCAAGGCATGCGCGCCATGCTCAAGACGCGGATCTTCGACAGCCGCATGGTGGTTGCCCAGCGCCAGAAGAAGATGTCCTTCTACATGCAAAGCCTGGGCGAAGAAGCCATCGGCAGCGGCCAGGCGCTGGCGCTGAACCGCACCGACATGTGCTTCCCGACCTACCGCCAGCAAAGCATCCTGATGGCCCGCGACGTGTCGCTGGTCGAGATGATCTGCCAACTGCTGTCCAACGAGCGCGACCCCCTCAAGGGCCGCCAGTTGCCGATCATGTATTCGGTGCGCGAAGCCGGCTTCTTCACCATCAGCGGCAACCTGGCGACCCAGTTCGTGCAGGCGGTCGGCTGGGCCATGGCATCGGCGATCAAGGGCGATACCAAGATCGCCTCGGCATGGATCGGTGACGGCGCTACTGCCGAGTCGGACTTCCACACCGCCCTTACCTTTGCCCACGTATACCGCGCCCCGGTCATCCTCAACGTGGTCAACAACCAATGGGCCATTTCCACCTTCCAGGCCATCGCCGGTGGCGAGTCGACCACCTTTGCCGGCCGTGGCGTGGGTTGCGGTATTGCTTCGCTGCGGGTTGACGGCAACGACTTCGTCGCCGTGTACGCTGCCTCGCGCTGGGCGGCCGAGCGCGCCCGCCGCGGCCTGGGCCCAAGCCTGATCGAGTGGGTCACCTACCGTGCCGGCCCGCACTCGACGTCGGACGACCCCTCCAAGTACCGCCCTGCCGACGACTGGAGCCACTTCCCGCTGGGTGACCCGATCGCCCGCCTGAAGCAGCACCTGATCAAGATCGGCCACTGGTCCGAGGAAGAACACCAGGCCGTCACGGCCGAGCTCGAAGCTGCGGTGATTGCCGCACAGAAAGAAGCCGAGCAGTACGGCACCCTGGCCAACGGGCACATCCCGAGCGCCGCCTCGATGTTCGAGGATGTGTACAAGGAAATGCCCGACCACCTGCGCCGTCAACGCCAGGAACTGGGGGTTTGAGATGAACGACCACAACAACAGCATCAACCCGGAAACCGCCATGGCCACCACTACCATGACCATGATCCAGGCCCTGCGCTCGGCCATGGATGTCATGCTTGAGCGCGACGACAATGTGGTGGTGTACGGCCAGGACGTCGGTTACTTCGGCGGCGTGTTCCGCTGCACCGAAGGCCTGCAGAACAAGTACGGCAAATCGCGCGTGTTCGACGCGCCCATCTCCGAGAGCGGCATCGTCGGTACCGCCGTGGGCATGGGTGCCTATGGCCTGCGCCCGGTGGTGGAGATCCAGTTCGCCGACTACTTCTACCCGGCCTCCGACCAGATCGTCTCCGAGCTGGCCCGCCTGCGTTACCGTTCGGCCGGCGAGTTCATTGCCCCGCTGACCCTGCGCATGCCTTGCGGCGGCGGCATCTATGGCGGCCAGACTCACAGCCAGAGCCCGGAAGCGATGTTCACCCAGGTGTGCGGCCTGCGCACCGTGATGCCGTCCAACCCTTATGACGCCAAAGGCCTGTTGATTGCCTCGATCGAATGCGACGACCCGGTAATCTTCCTGGAGCCCAAACGCCTGTACAACGGCCCGTTCGATGGCCACCACGACCGCCCTGTAACCCCGTGGTCGAAGCACCCGCACAGCGCCGTGCCCGACGGTTATTACACCGTACCGCTGGACAAGGCCGCCATTACCCGCCCTGGCAATGACGTGACCGTGCTGACCTACGGCACCACGGTGTACGTGGCCCAGGTGGCCGCCGAAGAAAGCGGCGTCGATGCCGAAGTGATCGACCTGCGCAGCCTGTGGCCGCTGGACCTGGACACTATCGTCGAGTCGGTGAAAAAGACCGGCCGTTGCGTGGTGGTGCACGAGGCCACCCGCACCTGCGGCTTCGGTGCCGAGCTGGTGTCGCTGGTGCAGGAGCACTGCTTCCACCACCTGGAGGCGCCGATCGAACGCGTCACCGGCTGGGACACCCCCTACCCTCACGCACAGGAATGGGCTTACTTCCCAGGCCCTTCGCGGGTAGGTGCGGCACTGAAAAAGGTCATGGAGGTCTGAATGGGCACGCACGTCATCAAGATGCCGGACATTGGCGAAGGCATCGCGCAGGTCGAGTTGGTGGAATGGTTCGTCAAGGTCGGCGACATCATCGCCGAGGACCAGGTGGTGGCCGACGTCATGACCGACAAGGCCACCGTGGAAATCCCCTCGCCGGTCAGCGGCAAGGTGTTGGCCCTGGGTGGCCAGCCCGGGGAAGTGATGGCGGTCGGTAGCGAACTGATCCGCATCGAAGTGGAAGGCAGCGGCAACCATGTGGATGTGCCTCAGCCAAAACCGGTAGAGGCCCCGGCTGCCCCCATTGCAGCCAAGCCGGAACCGCAGAAAGACGTAAAACCCGCCGTGTACCAGGCGCCCGCCAACCACGAAGCTGCGCCCATCGTGCCGCGCCAGCCGGGCGACAAGCCGCTGGCCTCGCCTGCCGTGCGCAAACGCGCCCTGGACGCCGGTATCGAACTGCGTTATGTGCATGGTAGCGGCCCGGCCGGGCGTATTCTGCACGAAGACCTCGATGCCTTCATGAGCAAGCCGCAAAGCAATGCCGGGCAAGCACCTGATGGTTATGCCAAGCGCACCGACAGCGAGCAGGTGCCAGTGATCGGCCTGCGCCGCAAGATTGCCCAGCGCATGCAGGACGCCAAACGCCGGGTCGCGCACTTCAGTTATGTCGAGGAAATCGACGTCACCGCCCTGGAGGCCCTGCGCCAGCAACTCAACAGCAAGCACGGCGACAGCCGGGGCAAGCTGACCTTGCTGCCATTCCTGGTACGCGCCCTGGTCGTGGCGCTGCGTGACTTCCCGCAGATCAACGCGACCTACGATGACGAAGCGCAGATCATCACCCGCCATGGCGCGGTGCATGTGGGCATTGCCACCCAAGGTGACAACGGCCTGATGGTGCCCGTGCTGCGCCACGCCGAAGCGGGCAGCCTGTGGGCCAATGCCGGCGAGATTTCGCGCCTGGCCAACGCTGCACGTAACAACAAGGCCAGCCGTGAAGAGCTGTCCGGCTCGACCATCACCCTGACCAGCCTTGGCGCCCTGGGTGGCATTGTCAGCACGCCGGTGGTCAACACCCCGGAAGTGGCAATCGTCGGGGTCAACCGCATGGTCGAACGGCCAGTGGTGATCGACGGCCAGATCGTCGTGCGCAAGATGATGAACCTGTCCAGCTCGTTCGACCACCGCGTGGTCGATGGCATGGATGCCGCCCTGTTCATCCAGGCCGTACGTGGCCTGCTCGAACAACCCGCCTGCCTGTTCGTGGAGTGAGCATGCAACAGATTATCCAGACTACCCTGTTGATCATCGGCGGCGGCCCTGGCGGCTATGTAGCAGCCATCCGCGCCGGGCAACTGGGCATTCCTACCGTACTGGTGGAAGGCCAGGCACTGGGCGGCACCTGCCTGAACATCGGCTGCATCCCGTCCAAGGCGCTGATCCACGTGGCCGAGCAGTTTCACCAGGCCTCGCGCTTTACCGAACCCTCGCCGCTGGGCATCAGCGTGGCTTCGCCGCGCCTGGACATCGGCCAGAGCGTCACCTGGAAGGACGGCATTGTCGACCGCCTGACCACAGGTGTTGCCGCCCTGCTGAAAAAGCACGGGGTGAAAGTGGTGCATGGTTGGGCCAAGGTACTGGACGGCAAGCAGGTCGAGGTCGATGGCCAGCGTATCCAGTGCGAGCATCTGTTGCTGGCGACCGGTTCCAGCAGTGTCGAACTGCCTATGCTGCCGCTGGGTGGCCCGGTGATTTCCTCGACCGAAGCCCTGGCGCCGAAAACCCTGCCGCAACACCTGGTGGTGGTCGGCGGTGGCTATATCGGCCTGGAGCTGGGCATTGCCTATCGCAAGCTGGGTGCACAGGTGAGTGTGGTGGAAGCGCGGGAGCGCATCCTGCCGACCTACGACAGCGAATTGACCGCCCCGGTGGCCGAGTCGCTGAAGAAACTGGGCATAGCGTTGCACCTGGGCCACAGCGTCGAGGGCTACGAAAATGGCTGCCTGCTGGCCAGCGACGGCAAGGGTGGGCAACTGCGCCTTGAGGCCGACCAGGTACTGGTGGCCGTGGGACGCCGGCCACGCACCAAGGGCTTCAACCTGGAATGCCTGGACCTGAAGATGAACGGCGCCGCCATTGCCATCGACGAGCGCTGTCACACCAGCATGCACAACGTCTGGGCCATCGGCGACGTCGCTGGCGAACCGATGCTGGCGCACCGGGCCATGGCCCAGGGCGAGATGGTCGCCGAAATCATCGCCGGCAAGGCCCGACGCTTTGAACCGACAGCGATTGCCGCCGTGTGCTTTACCGACCCGGAAGTGGTGGTGGTCGGCAAGACCCCGGAACAAGCCAGCCAGCAGGGCCTGGACTGCATCGTCGCGCAGTTCCCGTTTGCCGCCAATGGCCGGGCCATGAGCCTGGAATCGAAAAGCGGTTTCGTGCGGGTGGTGGCGCGCCGTGACAACCACCTGATCGTGGGTTGGCAGGCGGTTGGCGTGGCGGTCTCCGAGCTATCCACCGCGTTTGCCCAATCGCTGGAGATGGGCGCGTGCCTGGAAGATGTGGCCGGTACCATTCATGCCCACCCAACGCTCGGTGAAGCGGTACAGGAAGCCGCACTGCGCGCCCTGGGCCACGCCTTGCATATCTGA SEQ ID NO. 96 CglldAdw AAGTTTCTCTCCTTAGCTATTAAAAGGTGCCCATCCGTTTGGATGGGCACCTTCTCGTTTCTTGCAATCGGCATATTCAGTCAAAAAATGTTGAAATCAGCACTTTCAATTTGGGACATCTACTCTTAGGAGAAAAGCCACAAACCTTTCCCACCCCACAACCGTGTGTTCTGCAGTCGACCCAGTTTAGAGGAAACATGAGTGACTTCACGGAAAATACTTGGACTGTCCACTACGACGAAGATGGTGATTTCCCAAAATTCTTCAACTCTCTAAAGGAACACGAGCGCGCTGCAGTTATCTTGACCATCGAAAATATTCTAACTCCTCTAGGCATTAACATTTGCCAGACTGAATGGGGAAAAGCGCTGGGCCAGGGCCTTTACGAAATTAGGATTAGACATACCGTAAAAAAATCTCAAGAACCTCACTAGAAATTCAGGCTCAGAACTAGCCCTCAACGCTGGAGAAAACTCACCGGTGTTGCTTCGGGTATTTTG SEQ ID NO. 97 Cgdldup TACCCGGGCAGCGCCACGCCGTTCGATCCTTGACTACGCGCTACACCCTCATCTGTGAAGAGCCACCAAACCTGGGACGGTTCAAGCGGCGCTAGGCGAGTCTGATTGCTGCGTCGATCTATGGGGTGAGGGCAGTGGCCGACATCGCGGTCCGAACTATCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAACCTACCGGAGTCCGAAAGTACCGCGGTCCGAAACTATCTGATGCGCATCTTGTACAATGAGGATGCGCGTATGCACATGCATACGCACACGCACACTCCTTGGACGCCGTAGCGAGCTTCCGGGCAGACGGTCGCAGACGTCGTCCCCCTGGCTCGTTTCCCCGCCCATCAAAAAATGAACGACCGCGGACTAGCTCGGATCAAGGCGACATCCCCTCAGCATCATGACGCGCTTGTGATGCAACTGAATATAGGAAGCTTAGAG SEQ ID NO. 98 Ppivd ATGCATTACCCCTCCCTGAACTTCGCCCTGGGCGAGACCATCGACATGCTCCGCGACCAGGTGCGCACCTTCGTCGCCGCTGAACTGGCCCCAAGGGCCGCGCAGATCGACCACGACAACCTGTTCCCCGCCGACATGTGGCGCAAGTTCGGTGACATGGGCCTGCTGGGCATCACCGTACCGGAAGAGTACGGCGGCGCTGGCCTGGGCTACCTGGCCCATGTGGTGTCGATGGAAGAGATCAGCCGTGGCTCCGCCTCGGTGGCGCTGTCCTACGGCGCCCATTCCAACCTGTGCGTCAACCAGATCAACCGCAACGGCACCCACGAGCAGAAGCTCAAGTACCTGCCCAAGCTGATCAGCGGCGAGCACATCGGCGCCTTGGCCATGAGCGAGCCCAATGCCGGTTCCGACGTGGTGTCGATGAAGCTGCGCGCAGAAAAACGCGGCGATCACTACGTGCTCAACGGCAGCAAGACCTGGATCACCAACGGTCCCGACGCCAACACCTACGTGATTTACGCCAAGACCGACCTGGACAAGGGTGCGCACGGCATCACCGCGTTCATCGTCGAGCGCGACTGGAAAGGCTTCAGCCGCAGCAACAAGTTCGACAAGCTGGGCATGCGCGGGTCCAACACCTGCGAGTTGTTCTTCGATGGCGTGGAAGTGCCGGCAGAGAACATTCTGGGCCAGCTCAACGGCGGCGTGCGCGTCCTTATGAGCGGCCTGGACTACGAACGTGTGGTGCTGTCCGGCGGCCCGACCGGCATCATGCAAAGCTGCATGGACCTGGTGGTGCCGTATATCCACGACCGCAAGCAATTCGGCCAGAGCATCGGCGAGTTCCAGCTGATCCAGGGCAAGATTGCCGACATGTACACCCAGCTCAATGCCAGCCGCGCCTACCTGTATGCCGTGGCTCAGGCGTGCGACCGTGGCGAAACCACCCGCAAGGACGCTGCCGGCGTGATCCTGTACACCGCCGAGCGTGCCACGCAAATGGCCCTGGAGGCGATCCAGATTCTTGGCGGCAACGGCTATATCAACGAATTCCCGGCTGGCCGCCTGTTGCGCGACGCCAAGCTGTACGAAATCGGTGCCGGCACCAGTGAAATCCGCCGGATGCTGATCGGCCGCGAACTGTTCAACGAAACCCGCTGA SEQ ID NO.99 Cgdlddw GTCCCCAAGGTAGCGCGACGCCGTGAGAGCCTGAGCGATGTCTTATCCATCTCGGGTGGACCTAGGGCTCGACTCCCTAGGTCCACCGGGACGGATGAGTCGAGACATCGGTCAGAGGCTGGGCAGGCCATAGAATCGCGTGGCGGCGAGGGCCACGCCCGGTCCGAGAACGGGTCATCGCCTCACGCCGTCAGCTGACCCGCGACGGCCGGCACACCGGCGAAATCCTCGCCACCGGCCACATCGACGAGCCCGGAGGCTATTGCTGAAACACATTGCCTGAACATATTGGTGGAGCTGAAGGTGTGTAGGTTCAGGACATCGTTCATAGGTGAGTCGGGACATCGTTCATAGTGGTCCGTGACGATGAGGGATGTCTAAAGCGGCTCTTCACAGATGAGGGTGTAGTTGAGGTCTGAATCCGCCGGAACTCGAGCAGGGATCTGGCGATGTAGTTGGTCAGGTTGCGGAAGCCCAGGGCCGAGCCGCGCAGGTGCTCC SEQ ID NO. 100 CgpoxBup TTTTCGTAGGCGCTTGCGCCTGTAAGGTTTCTGAAGTCATGGATCGTAACTGTAACGAATGGTCGGTACAGTTACAACTCTTTTGTTGGTGTTTTAGACCACGGCGCTGTGTGGCGATTTAAGACGTCGGAAATCGTAGGGGACTGTCAGCGTGGGTCGGGTTCTTTGAGGCGCTTAGAGGCGATTCTGTGAGGTCACTTTTTGTGGGGTCGGGGTCTAAATTTGGCCAGTTTTCGAGGCGACCAGACAGGCGTGCCCACGATGTTTAAATAGGCGATCGGTGGGCATCTGTGTTTGGTTTCGACGGGCTGAAACCAAACCAGACTGCCCAGCAACGACGGAAATCCCAAAAGTGGGCATCCCTGTTTGGTACCGAGTACCCACCCGGGCCTGAAACTCCCTGGCAGGCGGGCGAAGCGTGGCAACAACTGGAATTTAAGAGCACAATTGAAGTCGCACCAAGTTAGGCAACACAATAGCCATAACGTTGAGGAGTTCAG SEQ ID NO. 101 Ppech ATGATTTACGAAGGTAAAGCCATCACGGTTAAGGCTCTTGAAAGTGGCATCGTCGAGCTCAAGTTCGACCTCAAGGGTGAGTCCGTCAACAAGTTCAACCGCCTTACCCTGAACGAGCTGCGCCAGGCCGTCGATGCCATCCGGGCCGATGCTTCGGTCAAGGGCGTGATCGTCAGGAGTGGCAAGGACGTGTTCATCGTCGGCGCCGACATCACCGAGTTCGTCGACAACTTCAAGCTGCCTGAGGCCGAACTGGTCGCTGGCAACCTGGAAGCCAATCGCATCTTCAACGCGTTCGAAGACCTCGAAGTGCCGACCGTTGCCGCCATCAACGGCATCGCGCTGGGCGGCGGCCTGGAAATGTGCCTGGCGGCCGACTACCGGGTCATGTCCACCAGCGCCAGGATCGGCCTGCCGGAAGTCAAGCTGGGTATCTACCCGGGCTTTGGCGGTACCGTGCGCCTGCCGCGCCTGATCGGCTCGGACAACGCCATCGAGTGGATCGCCGCCGGCAAGGAAAACCGTGCCGAAGATGCCCTGAAAGTGGGGGCCGTCGACGCCGTGGTCGCCCCTGAGCTGCTGCTGGCCGGTGCCCTCGACCTGATCAAGCGTGCCATCAGTGGCGAGCTGGACTACAAGGCCAAGCGCCAGCCGAAGCTGGAAAAGCTCAAGCTCAATGCCATCGAGCAGATGATGGCCTTCGAGACTGCCAAGGGCTTCGTCGCTGGCCAGGCCGGCCCGAACTACCCGGCCCCGGTCGAAGCGATCAAGAGCATCCAGAAAGCCGCCAACTTCGGTCGCGACAAGGCCCTGGAAGTCGAAGCCGCAGGCTTTGCCAAGCTGGCCAAGACCTCTGTCGCCGAGAGCCTGATCGGCTTGTTCCTCAACGATCAGGAACTCAAGCGCAAGGCCAAGGCGCATGACGAGATCGCCCACGACGTGAAGCAGGCCGCCGTGCTCGGCGCCGGCATCATGGGCGGCGGTATCGCCTACCAGTCGGCGGTCAAAGGTACGCCGATCCTGATGAAGGACATCCGCGAGGAAGCCATTCAGCTGGGTCTGAACGAGGCCTCCAAGTTGCTTGGCAACCGCGTCGAGAAGGGCCGCCTGACCCCGGCCAAGATGGCCGAGGCCCTCAACGCCATTCGCCCGACCCTGTCCTATGGCGATTTCGCCAATGTCGACATCGTCGTCGAGGCTGTGGTCGAGAACCCGAAGGTCAAGCAAGCGGTACTGGCGGAAGTGGAAGGCCAGGTGAAGGACGATGCGATCCTCGCTTCCAACACCTCTACCATCTCCATCAACCTGCTGGCCAAGGCGCTCAAGCGCCCGGAAAACTTCGTCGGCATGCACTTCTTCAACCCGGTGCACATGATGCCGCTGGTTGAAGTGATCCGTGGCGAGAAGTCCAGTGACGTGGCGGTCGCCACCACCGTGGCCTACGCCAAGAAAATGGGCAAGAACCCGATCGTGGTCAACGACTGCCCGGGCTTTTTGGTCAACCGCGTGCTGTTCCCGTACTTTGGCGGTTTTGCCAAGCTGGTCAGCGCCGGTGTCGACTTCGTGCGCATCGACAAGGTCATGGAGAAGTTCGGCTGGCCGATGGGCCCAGCCTACTTGATGGACGTGGTCGGCATCGACACCGGCCACCACGGCCGTGACGTCATGGCCGAAGGCTTCCCGGATCGCATGAAGGACGAGCGCCGCTCGGCAGTCGACGCGTTGTACGAGGCCAACCGCCTGGGCCAGAAGAACGGTAAGGGCTTCTACGCCTACGAAACCGACAAGCGCGGCAAGCCGAAGAAGGTCTTCGATGCCACCGTGCTCGACGTGCTCAAACCGATCGTGTTCGAGCAGCGTGAAGTCACTGACGAAGACATCATCAACTGGATGATGGTCCCGCTGTGCCTTGAGACCGTGCGTTGCCTGGAAGACGGCATCGTCGAAACCGCTGCCGAAGCCGACATGGGCCTGGTCTACGGCATTGGTTTCCCTCCCTTCCGCGGTGGTGCGCTGCGTTACATCGACTCGATCGGTGTGGCCGAATTCGTCGCCCTGGCCGATCAGTATGCCGACCTGGGGCCGCTGTACCACCCGACCGCCAAGCTGCGTGAAATGGCCAAGAACGGCCAGCGCTTCTTCAACTGA SEQ ID NO. 102 CgpoxBdw CGATGATCGATCTGGCCCGTTCGAACATAAGGAATATTCCTACTCCATGATGATTGATACACCTGCTGTTCTCATTGACCGCGAGCGCTTAACTGCCAACATTTCCAGGATGGCAGCTCACGCCGGTGCCCATGAGATTGCCCTGCGTCCGCATGTGAAAACGCACAAAATCATTGAAATTGCGCAGATGCAGGTCGACGCCGGTGCCCGAGGGATCACCTGCGCAACCATTGGCGAGGCGGAAATTTTTGCCGGCGCAGGTTTTACGGACATCTTTATTGCATATCCGCTGTATCTAACCGATCATGCAGTGCAACGCCTGAACGCGATCCCCGGAGAAATTTCCATTGGCGTGGATTCGGTAGAGATGGCACAGGCGACGGCGGGTTTGCGGGAAGATATCAAGGCTCTGATTGAAGTGGATTCGGGACATCGTAGAAGTGGAGTCACGGCGACTGCTTCAGAATTGAGTCAGATCCGCGAGGCGCTGGGCAGCAGGT SEQ ID NO. 103 Cg2266up GGGTGGTTTGGCTTTGGCGGCTGTGCCGACTGTTGCTGGAGTAGCCACTGTTGCCTCGACACTCGCAGCATTTGGTCCAGGTGGGATGATGGGCGGTTTGGTCACTGCAGGAACACTGCTCACAGTTGGTGGCGGCAGTTTAACCGCTGGGGTGTTGAGCTCGGTGAACACCACGGAAGAGATCGAAGCGCTCGTTGTACAGAAGCTAAGTTTGGCTATTTTGTGGCAGCGCCATGAGATAGATAGAACTCATGAGGTGTGGGAAGAATTCGCGGAGGCAGAACGTCTGATTGTGCGGGAGCACACGCGTGTGAAAAACGTGTCGGATAGTTCTTCGCCCATTTTGAAAGCTTTCGAGCAGCAGCGTTCGACTATTGAGCGGGCGTTGAAGTATTTGAGCGATCATGGGATGGAACCTGGCTGGTTTGAAGAACTCGAACCACCAGCCCCAACACCGTTTCTAAAACTGCGGGCTAAGAAAACTGATTAGGAGAAACACA SEQ ID NO. 104 Cg2266dw ACTTTAACCCCGTTATGTATTTGAAATCGTTGACGCTCAAGGGGTTTAAGTCTTTCGCGTCTGCGACGACCCTGAAATTTGAGCCAGGCATTTGTGCCGTGGTGGGTCCGAATGGTTCAGGCAAATCCAATGTGGTTGATGCGCTGGCCTGGGTGATGGGTGAAGGTTCTGCGAAGACCTTGCGTGGCGGCAAAATGGAAGATGTCATTTTTGCTGGCGCGGGCGATCGTAAACCGTTGGGTCGCGCAGAAGTCACGCTGACCATTGATAACTCTGATGGCGCACTGCCCATTGAGTACACCGAAGTGTCGGTGACCAGACGGATGTTCCGTGATGGTGCAAGTGAATATGAGATCAATGGGGCGAAAGCTCGATTGATGGATATCCAGGAGCTGTTGTCGGATACCGGTATTGGCCGTGAAATGCACATCATGGTGGGGCAGGGAAAGCTCGCAGAGATTTTGGAGTCCCGCCCCGAAGAGCGCCGAGCGTATATCGAA SEQ ID NO. 105 CgleuAup GAAGGCTACGGCCTAATCCTCACCGCATTACTTGGAACAATCGTGCAGCAGTATTCCTTTAACGCTGGCGAACTACAAAAATCGCTACCCGCCATGACCATTGCCGAACCAATTGTTGCCTTCAGTTTGGGCTACTTGGTTCTGGGCGAAAAATTCCAAGTCGTGGACTGGGAATGGATCGCCATGGGCATCGCACTACTGGTGATGATTGTTTCCACCATTGCACTGTCTCGTACAAGCACAATGCCGGCCGGATCGAAAAGGTAAAACTCCAAAGTTCCCCCCGAGACATGACAGCACTGGAACTGGGCGTCGAAAAGCTTTTTTAAAAGAAAACTCCCCCGAGTTGCTACCCACACCACAAAGTTGTTGTATGCTTCACCACATGACTTCGCGTGCGAATCTACTTCTTCTTCGCCGCGGCGGGTCCCAGAGGTCTTAACACGACCGGCATCCCGTCGCGGAGTTTGGTGTTGCCGGTCGTGGACCCACCCAAAACT SEQ ID NO. 106 Psod tagctgccaattattccgggcttgtgacccgctacccgataaataggtcggctgaaaaatttcgttgcaatatcaacaaaaaggcctatcattgggaggtgtcgcaccaagtacttttgcgaagcgccatctgacggattttcaaaagatgtatatgctcggtgcggaaacctacgaaaggattttttaccc SEQ ID NO. 107 CgleuAdw TTTTAAGAAGGTTGAACACAATGTCTCCTAACGATGCATTCATCTCCGCACCTGCCAAGATCGAAACCCCAGTTGGGCCTCGCAACGAAGGCCAGCCAGCATGGAATAAGCAGCGTGGCTCCTCAATGCCAGTTAACCGCTACATGCCTTTCGAGGTTGAGGTAGAAGATATTTCTCTGCCGGACCGCACTTGGCCAGATAAAAAAATCACCGTTGCACCTCAGTGGTGTGCTGTTGACCTGCGTGACGGCAACCAGGCTCTGATTGATCCGATGTCTCCTGAGCGTAAGCGCCGCATGTTTGAGCTGCTGGTTCAGATGGGCTTCAAAGAAATCGAGGTCGGTTTCCCTTCAGCTTCCCAGACTGATTTTGATTTCGTTCGTGAGATCATCGAAAAGGGCATGATCCCTGACGATGTCACCATTCAGGTTCTGGTTCAGGCTCGTGAGCACCTGATTCGCCGTACTTTTGAAGCTTGCGAAGGCGCAAAAAACGTTATC SEQ ID NO. 108 CgilvEup GCGCGGCGGAGGGTCTCGTCGTCAAGCAAATCAGCCTTGCCCAAACCAACCGCAATGACAGGCGCAACGTCGGTGCCTGGGACGCGGGTGATGCTGTTTGCGGTGGCCTTTGCGCCGACAGCTTCGAGCTGAGTGAGGATGTCGGCCTGCTGCTCGGTACTGAAGATGAAATCGAGGATTTCGCCGCCGGCGAGTTCGATGGAATCTTCGCCTTCAAAAATCGCGACGATGATGGCATCAATCTTCTTTGGCAACTTCTTTTCGAGCTTGAGTTCAGCGACCGTTCCACGAACTGGAAGAGTGGCATCCTTGGACACCTTGGTTGGTGCTGTTGTGCTGTAGGCATTTTTCGCCATTGAAAGCTGAGTCCTCTCGTTGAAGTTGTGTCTCCGCTTTGGTTGGGGGAGGCATCAAATTGAAACTAACTTTTAACAAGCCTAGCCATTCCTCAAAACCGTGAGACGAAATTGGCTATTCATCCCATAAAATGGGGCTGACTA SEQ ID NO. 109 CgilvC ATGGCTATTGAACTGCTTTATGATGCTGACGCTGACCTCTCCTTGATCCAGGGCCGTAAGGTTGCCATCGTTGGCTACGGCTCCCAGGGCCACGCACACTCCCAGAACCTCCGCGATTCTGGCGTTGAGGTTGTCATTGGTCTGCGCGAGGGCTCCAAGTCCGCAGAGAAGGCAAAGGAAGCAGGCTTCGAGGTCAAGACCACCGCTGAGGCTGCAGCTTGGGCTGACGTCATCATGCTCCTGGCTCCAGACACCTCCCAGGCAGAAATCTTCACCAACGACATCGAGCCAAACCTGAACGCAGGCGACGCACTGCTGTTCGGCCACGGCCTGAACATTCACTTCGACCTGATCAAGCCAGCTGACGACATCATCGTTGGCATGGTTGCGCCAAAGGGCCCAGGCCACTTGGTTCGCCGTCAGTTCGTTGATGGCAAGGGTGTTCCTTGCCTCATCGCAGTCGACCAGGACCCAACCGGAACCGCACAGGCTCTGACCCTGTCCTACGCAGCAGCAATCGGTGGCGCACGCGCAGGCGTTATCCCAACCACCTTCGAAGCTGAGACCGTCACCGACCTCTTCGGCGAGCAGGCTGTTCTCTGCGGTGGCACCGAGGAACTGGTCAAGGTTGGCTTCGAGGTTCTCACCGAAGCTGGCTACGAGCCAGAGATGGCATACTTCGAGGTTCTTCACGAGCTCAAGCTCATCGTTGACCTCATGTTCGAAGGTGGCATCAGCAACATGAACTACTCTGTTTCTGACACCGCTGAGTTCGGTGGCTACCTCTCCGGCCCACGCGTCATCGATGCAGACACCAAGTCCCGCATGAAGGACATCCTGACCGATATCCAGGACGGCACCTTCACCAAGCGCCTCATCGCAAACGTTGAGAACGGCAACACCGAGCTTGAGGGCCTTCGTGCTTCCTACAACAACCACCCAATCGAGGAGACCGGCGCTAAGCTCCGCGACCTCATGAGCTGGGTCAAGGTTGACGCTCGCGCAGAAACCGCTTAA SEQ ID NO. 110 CgilvEdw ATCAACCGGTTTTAAGACCCCGCTGCATTAAACCCTGATTTATTGCAGCGGGGTTTTTGCGTTGACAAGCTCTTATGAGACGTAGGGGGTGGAAGCAGGGGTAGGACGTGTCCAGCCCAAGTGGCATGCTGGTTTCTGTACAAAACGTAGGTGACTTTAAGGAGAATGCAGTGGCTGAAAATGGGCAAAAAGTTGCGGTCGTAACTGGTGGATCAAGCGGAATTGGCGCAGCTTCAGCTCGAGCATTGGCAGCTGACGGTTGGAAAGTAATTGTGGCAGCACGTCGCCTCGAGCGCTTGGAAGCACTCGCTCAGGAAATCGGCGGAACTGCAGTGGCACTCGATGTCACTGACCAAGAATCAGTCAACGCATTTTCAGTCACCGTTGGGGAAGTCGATCTGTTGGTCAACAACGCAGGCGGTGCCAAAGGCCTAGACAGCATCCATGACGCCAACATTGATGATTGGACCTGGATGTACGAAACCAACGTGCTGGGCACT SEQ ID NO. 112 PCgilvBup AGTCGGCCGATACGTGGAATCAAAAACGCCAAGACCAGGATAATTGCTACATCAAAACCGGTATCGACAATCCAATTCCACAATGAATAGAGCAAATATTGAATGGGTACGCCTAAAATCATGAGCCAAGATTAGCGCTGAAAAGTAGCGGGAGCCTGCCTGAACTTTGTGAGAATCCTGATTCCTTAACCGAAGTGGGGGAGTTTTGGGGGTGGGAATTTTCGTGCGTTGTGGAATTGGAAACTCGATGTGTGTAGCATGACACACCATGACCATTATTCGACTTGTAGTAGTAACCGCGCGGCGCCTGCCGTAACGGCCTTCCAAGTCGTCTCGTCAAGCGCCCTCGACAACACTCACCACAGTGTTGGAACGAGGGCTTTCTTGTTGGTTATGACCCAAGTAGCCAACTTTGCAACAGACATCTGTCGCACTGCGTGCACACGCATCCGCGTCGGAACAATTTTAAATGAGGGCTTTGTCTTTAGGCTGAGTTGAAA SEQ ID NO. 113 PCgilvBdw AGTAAAGGAGCCAGAAAGTCGTGAATGTGGCAGCTTCTCAACAGCCCACTCCCGCCACGGTTGCAAGCCGTGGTCGATCCGCCGCCCCTGAGCGGATGACAGGTGCAAAGGCAATTGTTCGATCGCTCGAGGAGCTTAACGCCGACATCGTGTTCGGTATTCCTGGTGGTGCGGTGCTACCGGTGTATGACCCGCTCTATTCCTCCACAAAGGTGCGCCACGTCTTGGTGCGCCACGAGCAGGGCGCAGGCCACGCAGCAACCGGCTACGCGCAGGTTACTGGACGCGTTGGCGTCTGCATTGCAACCTCTGGCCCAGGAGCAACCAACTTGGTTACCCCAATCGCTGATGCAAACTTGGACTCCGTTCCCATGGTTGCCATCACCGGCCAGGTCGGAAGTGGCCTGCTGGGTACCGACGCTTTCCAGGAAGCCGATATCCGCGGCATCACCATGCCAGTGACCAAGCACAACTTCATGGTCACCAACCCTAACGACATT SEQ ID NO. 114 PCgilvDup GTCATCGGCGCAGCCCCTCAGTACCTGTTTTGGCTGCTCGCGCTCCCTGTCATCTTCGGTTACTGGGTTCTAAAATCATCCACGATCGTTGATGAACAGGGCATCACCGCAAACTACGCCTTCAAGGGCAAAAAGGTTGTGGCCTGGGAAGACCTCGCAGGAATCGGATTCAAGGGTGCCCGCACTTTCGCTCGCACCACCTCCGATGCAGAAGTCACCCTCCCCGGCGTCACCTTCAACTCCCTTCCCCGCCTTGAAGCTGCTTCCCACGGCCGCATCCCCGATGCGATCACCGCAAGCAAGGAAGCAGCCGACGGCAAGGTTGTAGTCGTTCAAGAAGACGGCTACTCCGTGATGATGTCCAAGGAAGAGTACTTGGAGCGCCAAAAGGCACTGGGCAAGCCAGTTCAGTTGAACTTCGATGACGACACCGATGGGAATACAACACAAACAGAAAGCGTTGAATCCCAAGAGACCGGACAAGCCGCGTCTGAAACCTC SEQ ID NO. 115 PCgilvDdw GCAGATTTGAAAAGCGCATCATGATCCCACTTCGTTCAAAAGTCACCACCGTCGGTCGCAATGCAGCTGGCGCTCGCGCCCTTTGGCGTGCCACCGGCACCAAGGAAAATGAGTTCGGCAAGCCAATTGTTGCCATCGTAAACTCCTACACCCAGTTCGTGCCCGGACACGTTCACCTTAAGAACGTCGGCGATATTGTGGCAGATGCAGTGCGCAAAGCCGGTGGCGTTCCAAAGGAATTCAACACCATCGCCGTCGATGACGGCATCGCCATGGGACACGGCGGCATGCTGTACTCCCTGCCATCCCGTGAAATCATCGCCGACTCCGTCGAATACATGGTCAACGCACACACCGCCGACGCCATGGTGTGTATCTCCAACTGTGACAAGATCACCCCAGGCATGCTCAACGCAGCAATGCGCCTGAACATCCCAGTGGTCTTCGTTTCCGGTGGCCCAATGGAAGCTGGCAAGGCTGTCGTCGTTGACGGCGTTGCA SEQ ID NO. 116 CgadhAup TTGAAAATCGACACTAAAACGATCCTTGGAATGTTGTTGTGTACTGCATGTTTGTCGAGTCTATCTAGTAGGTACGGCGCGCGTGCCTTAATTGCCCGCTGGGGTGGTGGGGAATGGGTGGCTGGGGGCATCGAAAAGCATCTTTGATGCTTTTAAAGGGAATTGTGTGAATCTTGAAAAGTTAATTGAAAAACATTTCCATTAGGGGGTGATTTGCTGGAGTTTTGTGAATCTATTTTTCGAAATTTCAACGTGCGGGGGTGGTTTGTTTTTTTACAATTGCCAGTTCATTCACGGTTGTTGAAATGTTCGGGGGTAATAACTCAACTTTCTATTTTCACCTTATTGGGATTTCGCTAGGGTGGACGATGGCAGCAATTGAATGTTGTAAATCACACAATTGCAAGGATTGTAATTTAAGGCACATCTATGTCGGTGTGAAATTACATGTGCCAGAAGAGCAATTTGCCAAGTAATCCAAGCGAGAAGGAGTGAGTTTT SEQ ID NO. 117 CgadhAdw CGGATTGTGTTGAAACTGCTCTGAAGCTACTTTGAGGCGGTTGCTGCAGAGCGGTTTGGCTGAAAATGTGACGAACTTTGGCTGAGCTTTCGTCGCTTTTGTAGTTCTCGACATTCTCATCGTTCTGGTCGTTCTCATCATTCTCATCATTCTCATCATTGAAAAGTCACGCTTCTCCTTATATATAGCTGGTTCATAGCCAGTTAAAGGAGGGGCGTGGCTTTTTGCTGCTTAAGGCATGACCTTTGTTTGAAGTTGGTGCGGTGATGGGGGAGTGTGACCGGATTCGAACAGGAATGTACGACACGTGTCCACCCCTTCTGGAATAGTCAATTGGCATGACCGTTGTATCGCACGCGCTTGGGTTTAAGCGATTTAGGCAGGAATCCCTGGAGCTGTCTTTGTTGCGCAGTGACAACTTTCCGGTGGTGCTCGCCGTGGTAGCGCAGTATTTTCCGCAGGGGGCTATCGCTAAGCCGGCCTCAGAGCTGTATCAGCTG SEQ ID NO. 118 Cg0273up GCGGAGTACTAGGTCGTGTGCTGTGGGAAGCTCACGAACCGCGGTATATGTTCGTGCAACCAGTTGAGGGTTGATAAGTGGGGAGATTCCAACTCGAATGCTGCGTGCTTCTGAGTTAATCAAACGGTGCGCTTCCGCGGTGATTGCGTCGATTTCAGTCAGCGCGCGTTGGATCAGGGGGAGGATGTGGAGGCCAAAGGACGTCGGGGTGACGCCTTGAGTAGATCGATCGAAGAGTTGTTCACCGAGCCGATCTTCCAGTTTGGCGATGCCGTTGGATAGCGCAGGTTGGGTGACTCCGTATTCGCGGGCTGCTGCGCTGAATGAGTGAGTTTCTGCGACGGCCTGCGCATAGCGGAGCCCTTCAAGGCTGAGCCGTTTGGTCATAACTATATGTTATCCCCCTTATTCAGAGTGATGGTCTACCGGAGAAGTACCCAGACCAATAGCATCGACCAACGATAGCGCGCTCAGAAGTTCTTTAGTGAAAGCAGAACCAA SEQ ID NO. 119 Cg0273dw AATTGATGATGAACCGTCAGATCATCACAGGTCACCTCACTGGAAGTGCGAATGACACGGAACAGACTATGAAATTTGCTCATCTCCATGGCGTGAAACCGCTTATTGAACGGATGCCTCTCGATCAAGCCAACGAGGCTATTGCACGTATTTCAGCTGGTAAACCACGTTTCCGTATTGTCTTGGAGCCGAATTCATAATGCCAACAGCAAGCCCAATTTATGATGTCGTTGTCGTCGGAGCCGGCATTTCTGGCCTCATCGCCACGCAACTGTTGGACCGCGCAGGTCTAAACATCAAATGCTTCGAAGCCTGCTCAAGAGTTGGCGGCCGAGCAGTGTCTGTCCAACAGTCCGATTTGTTCCTGGACCTCGGCGCAACATGGTTCTGGCTCAACGAACCACTTGTGCAGCAACTCGTCAATAATCTCGGCCTCGGCACATTCCCTCAGGCCATCGAGGGTGATGCGCTTTTTGAGACGCTTGTCGACGCCCCGAGCC

[0245] Table 12. Primers used in Example 4

[0246] Primer Sequence (5'-3') Cgldhup-(pK18)-F attacgaattcgagctcggtAAAACAGCCAGGTTAGCAGC Cgldhup-(LeuDH)-R GCGCGAACATTTTCGATCCCACTTCCTG PpLeuDH-(ldhup)-F GGGATCGAAAATGTTCGCGCTGATGCAAAG PpLeuDH-(ldhdw)-R AATTTCTAATTCTCAATATCAGCCATACAACAACCG Cgldhdw-(leuDH)-F GATATTGAGAATTAGAAATTATCTTTGGCGCCTAGTTGG Cgldhdw-(pK18)-R gtgccaagcttgcatgcctgGAGAATTTCGGCGTGCTCG Cgldhdw-R GGCAGGGTGACCATGATGC CglldAup-(pK18)-F attacgaattcgagctcggtCATTGTCCTTCTGGCAGTTG CglldAup-(bkd)-R ACTCGTTCATGGGTGGTTCCTTTCGGAG Ppbkd-(lldAup)-F GGAACCACCCATGAACGAGTACGCCCCC Ppbkd-(lldAdw)-R AGAGAAACTTTCAGATATGCAAGGCGTG CglldAdw-(bkd)-F GCATATCTGAAAGTTTCTCTCCTTAGCTA CglldAdw-(pK18)-R gtgccaagcttgcatgcctgCAAAATACCCGAAGCAAC CglldAdw-R TCTCGCTGTTTGTTATATCCGCC Cgdldup-(pK18)-F attacgaattcgagctcggtTACCCGGGCAGCGCCACG Cgdldup-(ivd)-R GGTAATGCATCTCTAAGCTTCCTATATTCAG Ppivd-(dldup)-F AAGCTTAGAGATGCATTACCCCTCCCTG Ppivd-(dlddw)-R GATTGGCTCAGTAAATTTCCCATTTTCAGCGGGTTTCGTTGAAC Cgdlddw-(ivd)-F GGAAATTTACTGAGCCAATCCCGTCCCCAAGGTAGCGCGACG Cgdlddw-(pK18)-R gtgccaagcttgcatgcctgGGAGCACCTGCGCGGCTC Cgdlddw-R TGCTGGCCTACTTCGAGCG CgpoxBup-(pK18)-F attacgaattcgagctcggtTTTTCGTAGGCGCTTGCGC CgpoxBup-(ech)-R CGTAAATCATCTGAACTCCTCAACGTTATG Ppech-(poxBup)-F AGGAGTTCAGATGATTTACGAAGGTAAAGCC Ppech-(poxBdw)-R AATTTCTAATTCTCAATATCAGTTGAAGAAGCGCTGG CgpoxBdw-(ech)-F GATATTGAGAATTAGAAATTCGATGATCGATCTGGCCC CgpoxBdw-(pK18)-R gtgccaagcttgcatgcctgACCTGCTGCCCAGCGCCTCG CgpoxBdw-R TGTTGTTTAGAGCCTGAAGC Cg2266up-(pK18)-F attacgaattcgagctcggtGGGTGGTTTGGCTTTGGC Cg2266up-(paaI)-R TATGACTCATTGTGTTTCTCCTAATCAGTTTTC EcpaaI-(2266up)-F GAGAAACACAATGAGTCATAAGGCCTGGC EcpaaI-(2266dw)-R GGCTCAGTAAATTTCCCATTTTCAGGCTTCTCCTGTAATGG Cg2266dw-(paaI)-F AATGGGAAATTTACTGAGCCAATCCCACTTTAACCCCGTTATGTAT Cg2266dw-(pK18)-R gtgccaagcttgcatgcctgTTCGATATACGCTCGGCG Cg2266dw-R ACGATCAAGATTGACCTGCA CgleuAup-(pK18)-F attacgaattcgagctcggtGAAGGCTACGGCCTAATC CgleuAup-(Psod)-R ttggcagctaAGTTTTGGGTGGGTCCAC Psod-(leuAup)-F ACCCAAAACTtagctgccaattattccggg Psod-(leuAdw)-R CTTCTTAAAAgggtaaaaaatcctttcgtag CgleuAdw-(Psod)-F gattttttacccTTTTAAGAAGGTTGAACACA CgleuAdw-(pK18)-R gtgccaagcttgcatgcctgGATAACGTTTTTTGCGCC CgleuAdw-R ACCTTGTCCATGCGGAAC CgilvEup-(pK18)-F attacgaattcgagctcggtGCGCGGCGGAGGGTCTCGTCGTCAAG CgilvEup-(Psod)-R ttggcagctaTAGTCAGCCCCATTTTATGGG Psod-(ilvEup)-F GGGCTGACTAtagctgccaattattccggg Psod-(ilvC)-R GGGAGAAAATCTCGCCTTTCgggtaaaaaatcctttcgtag CgilvC-(Psod)-F GAAAGGCGAGATTTTCTCCCATGGCTATTGAACTGCTTTATG CgilvC-(ilvEdw)-R GATTGGCTCAGTAAATTTCCCATTTTTAAGCGGTTTCTGCGCGA CgilvEdw-(ilvC)-F GGAAATTTACTGAGCCAATCCCATCAACCGGTTTTAAGACCC CgilvEdw-(pK18)-R gtgccaagcttgcatgcctgAGTGCCCAGCACGTTGGTTTC CgilvEdw-R GGTTTTCTCCTGCAATGGAACC CgilvBup-(pK18)-F attacgaattcgagctcggtAGTCGGCCGATACGTGGA CgilvBup-(Psod)-R AATTTCTAATTCTCAATATTTCAACTCAGCCTAAAG Psod-(ilvBup)-F AATATTGAGAATTAGAAATTtagctgccaattattccgg Psod-(ilvBdw)-R CTCCTTTACTgggtaaaaaatcctttcgta CgilvBdw-(Psod)-F gattttttacccAGTAAAGGAGCCAGAAAGTC CgilvBdw-(pK18)-R gtgccaagcttgcatgcctgAATGTCGTTAGGGTTGGTG CgilvBdw-R CTTAGGAATATCCACCAGAAC CgilvDup-(pK18)-F attacgaattcgagctcggtGTCATCGGCGCAGCCCCTC CgilvDup-(Psod)-R AATTTCTAATTCTCAATAGAGGTTTCAGACGCGGCTTG Psod-(ilvDup)-F TCTATTGAGAATTAGAAATTtagctgccaattattccggg Psod-(ilvDdw)-R TCAAATCTGCgggtaaaaaatcctttcgtagg CgilvDup-(Psod)-F ttttttacccGCAGATTTGAAAAGCGCATC CgilvDdw-(pK18)-R gtgccaagcttgcatgcctgTGCAACGCCGTCAACGAC CgilvDdw-R CGTCGTCGACTGCATCGC CgadhAup-(pK18)-F attacgaattcgagctcggtTTGAAAATCGACACTAAAACG CgadhAup-(Fxpk)-R gactcgtcatAAAACTCACTCCTTCTCGCTTG BaFxpk-(adhAup)-F AGTGAGTTTTatgacgagtcctgttattg BaFxpk-(adhAdw)-R TTGGCTCAGTAAATTTCCCATTTtcactcgttatcgccagcggttg CgadhAdw-(Fxpk)-F TGGGAAATTTACTGAGCCAATCCCCGGATTGTGTTGAAACTGCTC CgadhAdw-(pK18)-R gtgccaagcttgcatgcctgCAGCTGATACAGCTCTGAGG CgadhAdw-R GACTTCACCCAATCACTCAC Cg0273up-(pK18)-F attacgaattcgagctcggtGCGGAGTACTAGGTCGTG Cg0273up-(pta)-R TACGGGACATTTGGTTCTGCTTTCACTAAAG Ecpta-(0273up)-F GCAGAACCAAATGTCCCGTATTATTATGCTG Ecpta-(0273dw)-R GATTGGCTCAGTAAATTTCCCATTTTTACTGCTGCTGTGCAGACTGAATCGC Cg0273dw-(pta)-F GGAAATTTACTGAGCCAATCCCAATTGATGATGAACCGTCAG Cg0273dw-(pK18)-R gtgccaagcttgcatgcctgGGCTCGGGGCGTCGACAAG Cg0273dw-R CCGAGCGCAAGCGAGGAG

[0247] Example 5. Application of the recombinant bacterium in the preparation of HMB

[0248] 1. Medium components

[0249] (1-a) The components and final concentrations of the growth media for Escherichia coli and Corynebacterium glutamicum are as follows:

[0250] The solvent is water, the pH is 7.0 - 7.2, and the solutes and their concentrations are respectively: 25 mM NaHPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, glycerol with a volume percentage concentration of 5%, yeast powder with a mass percentage concentration of 0.5%, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2MO4, 2 μM Na2SeO3, and 2 μM H3BO3.

[0251] (1-b) The components and final concentrations of the growth media for Pseudomonas putida and Pseudomonas aeruginosa are as follows:

[0252] The solvent is water, the pH is 7.2 - 7.4, and the solutes and their concentrations are as follows: 25 mM NaHPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, glycerol with a volume percentage concentration of 5%, peptone with a mass percentage concentration of 1%, beef extract with 3%, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μM Na2MO4, 2 μM Na2SeO3, and 2 μM H3BO3.

[0253] The components and final concentrations of the (1 - c) transformation medium are as follows (the solvent is water):

[0254] Na2HPO4: 100 mM;

[0255] KH2PO4: 100 mM;

[0256] MgCl2: 5 mM;

[0257] Glucose: 10 g / 100 mL (10%).

[0258] 2. Cultivation of Bacteria and Induction of Enzymes

[0259] The overnight - cultured wild - type Escherichia coli strain BW25113, recombinant Escherichia coli EHM17, EHM27; Pseudomonas putida KT2440, HM705, HM806; Pseudomonas aeruginosa PAO1, HM145, HM156; Corynebacterium glutamicum 13032, HM125, HM136 were inoculated into flasks containing 200 ml of the corresponding growth medium for the bacteria at an inoculation amount of 1% and cultured at 37°C for 16 - 30 h, and then the bacteria were collected by centrifugation at 8000 g for 10 min.

[0260] 3. Whole - cell Catalytic Synthesis of HMB

[0261] The bacteria collected above were respectively resuspended in beakers containing 10 ml of the corresponding transformation medium for the bacteria. During the reaction process, the pH was detected regularly using pH test paper and adjusted with 0.1 M NaOH and HCl solutions to maintain the pH at 7.5. After reacting at 37°C for 24 h, the reaction product was centrifuged at 8000 g for 10 minutes, and the supernatant was filtered through a 0.22 - μm filter membrane, and the content of HMB in the supernatant was detected by HPLC.

[0262] The concentration of HMB was determined using an HPLC system (Dionex UltiMate 3000 Series, Thermo Scientific, USA). The system was equipped with an Aminex HPX-87H ion exchange column (7.8×300 mm, Bio-Rad Laboratories, USA), the column temperature was 35 °C, the flow rate was 0.6 mL / min, the mobile phase was 5 mM sulfuric acid solution, and the injection volume was 10 μL. The concentration of HMB in the sample was calculated through the HMB (standard product purchased from Jizhi Chemistry, product number: H68580) concentration standard curve. The conversion rate was calculated as the ratio of the HMB production amount to the glucose consumption amount in the whole-cell catalysis stage (step 3) * 100%.

[0263] Table 13. HMB production and conversion rates of various engineered bacteria

[0264] Example Strain HMB yield (g / L) Conversion rate WT Escherichia coli BW25113 0 0% Example 1 EHM17 2.7 29% Example 1 EHM27 2.9 31% WT Pseudomonas putida KT2440 0.08 0.8% Example 2 HM705 0.82 8.4% Example 2 HM806 2.8 30% WT Pseudomonas aeruginosa PAO1 0 0% Example 3 HM145 0.23 2.3% Example 3 HM156 2.5 26% WT Corynebacterium glutamicum 13032 0 0% Example 4 HM125 0.21 2.2% Example 4 HM136 2.3 24%

[0265] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made using conventional techniques known in the art. The application of some basic features can be made according to the scope of the following appended claims.

[0266] The above-described embodiments merely represent several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims, and the description can be used to explain the content of the claims.

Claims

1. A recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid (HMB), which comprises deletion, knockout or inhibitory expression of the following gene clusters: NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld, L-lactate dehydrogenase gene lldD, pyruvate oxidase gene poxB, pyruvate formate-lyase 1 gene pflB, branched-chain amino acid aminotransferase gene ilvE, pyruvate formate-lyase 4 gene tdcE, and fumarate reductase flavoprotein A subunit gene frdA; and comprises enhancement or exogenous insertion of the following gene clusters: leucine dehydrogenase gene leuDH, α-ketoisocaproate dehydrogenase complex bkd gene, isovaleryl-CoA dehydrogenase gene ivd, enoyl-CoA hydratase gene ech, acyl-CoA thioesterase gene paaI, keto acid reductoisomerase gene ilvC, dihydroxy acid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase gene ilvBN, glucose transport system IIBC subunit gene ptsG, glucose-6-phosphate dehydrogenase gene zwf, xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, and phosphoacetyltransferase gene pta.

2. A recombinant Escherichia coli for synthesizing β-hydroxy-β-methylbutyric acid (HMB), which comprises deletion, knockout or inhibitory expression of the following gene clusters: NADH-dependent D-lactate dehydrogenase gene ldhA, quinone-dependent D-lactate dehydrogenase gene dld gene, L-lactate dehydrogenase gene lldD gene, pyruvate oxidase gene poxB, pyruvate formate-lyase gene pflB, branched-chain amino acid aminotransferase gene ilvE, pyruvate formate-lyase 4 gene tdcE, and fumarate reductase flavoprotein A subunit gene frdA; and comprises enhancement or exogenous insertion of the following gene clusters: leucine dehydrogenase gene leuDH, α-ketoisocaproate dioxygenase gene kicd, keto acid reductoisomerase gene ilvC, dihydroxy acid dehydratase gene ilvD, 2-isopropylmalate synthase gene leuA, acetolactate synthase gene ilvBN, glucose transport system IIBC subunit gene ptsG, glucose-6-phosphate dehydrogenase gene zwf, xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, and phosphoacetyltransferase gene pta.

3. A recombinant Pseudomonas putida for synthesizing β-hydroxy-β-methylbutyric acid (HMB), which comprises enhanced expression or exogenous insertion of the following gene clusters: leucine dehydrogenase leuDH gene, α-ketoisocaproate dehydrogenase complex bkd gene, isovaleryl-CoA dehydrogenase ivd gene, enoyl-CoA hydratase ech gene, acyl-CoA thioesterase PaaI gene; and comprises deletion, knockout or inhibitory expression of the lactose operon repressor lacI gene and the 2-oxoisovalerate dehydrogenase regulator bkdR gene.

4. The recombinant Pseudomonas putida according to claim 3, further comprising: Deletion, knockout or inhibitory expression of the branched-chain amino acid aminotransferase gene ilvE, the acetyl-CoA synthetase gene acs, and Pp2213; and Enhancement or exogenous insertion of the following gene cluster: the 2-isopropylmalate synthase gene leuA, the keto acid reductoisomerase gene ilvC, the acetolactate synthase genes ilvBN, the dihydroxy acid dehydratase gene ilvD, the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase gene fxpk, the phosphoacetyltransferase gene pta.

5. A recombinant Pseudomonas aeruginosa for synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising the following modifications: Enhanced expression of the leucine dehydrogenase expression PaleuDH gene; Knockout, deletion or inhibitory expression of the 2-oxoisovalerate dehydrogenase regulatory protein bkdR gene, and enhanced expression of the α-ketoisocaproate dehydrogenase complex bkd gene; Enhanced expression of the isovaleryl-CoA dehydrogenase ivd gene; Enhanced expression of the enoyl-CoA hydratase ech gene; and Knockout, deletion or inhibitory expression of the lactose operon repressor protein lacI gene, and exogenous insertion of the acyl-CoA thioesterase PaaI gene.

6. The recombinant Pseudomonas aeruginosa according to claim 5, further comprising: Enhanced expression of the 2-isopropylmalate synthase leuA gene; Enhanced expression of the branched-chain amino acid aminotransferase ilvE gene; Enhanced expression of the acetolactate synthase ilvBN gene; Enhanced expression of the dihydroxy acid dehydratase ilvD gene; Knockout, deletion or inhibitory expression of the acetyl-CoA synthase A gene acsA, and exogenous insertion of the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase fxpk gene; Knockout, deletion or inhibitory expression of the acetyl-CoA synthase B gene acsB, and exogenous insertion of the phosphoacetyltransferase pta gene.

7. A recombinant Corynebacterium glutamicum for synthesizing β-hydroxy-β-methylbutyric acid HMB, comprising: Enhanced or exogenous insertion of the leucine dehydrogenase leuDH gene; Knockout, deletion or inhibitory expression of the NADH-dependent D-lactate dehydrogenase gene ldhA gene, and exogenous insertion of the α-ketoisocaproate dehydrogenase complex bkd gene; Knockout, deletion or inhibitory expression of the quinone-dependent D-lactate dehydrogenase gene dld gene, and exogenous insertion of the isovaleryl-CoA dehydrogenase ivd gene; Knockout, deletion or inhibitory expression of the pyruvate oxidase gene poxB, and exogenous insertion of the enoyl-CoA hydratase ech gene; and Knockout, deletion or inhibitory expression of the acyl phosphatase cg2266 gene, and exogenous insertion of the acyl-CoA thioesterase PaaI gene.

8. The recombinant Corynebacterium glutamicum according to claim 7, comprising: Enhanced expression of the 2-isopropylmalate synthase gene leuA gene; Knockout, deletion or inhibitory expression of the branched-chain amino acid aminotransferase ilvE gene, and enhanced expression of the keto acid reductoisomerase ilvC gene; Enhanced expression of the acetolactate synthase ilvBN gene; Enhanced expression of the dihydroxy acid dehydratase ilvD gene; Knock out or delete or inhibit the expression of the alcohol dehydrogenase adhA gene, and exogenously insert the xylulose-5-phosphate / fructose-6-phosphate phosphoketolase fxpk gene; and Knock out or delete or inhibit the expression of the alcohol dehydrogenase cg0273 gene, and enhance or insert the phosphoacetyltransferase pta gene.

9. Use of the strain according to any one of claims 1 to 8 in the production of β-hydroxy-β-methylbutyric acid HMB.

Images