Ophtha virus expressing CXCL9 and application thereof in preparation of antitumor drugs
By deleting the ORFs 005-008 gene in ORFV and inserting the Cxcl9 gene, the recombinant sheep mouth virus ORFV Δ-Cxcl9 was constructed, which solved the targeting and safety of oncolytic virus in tumor treatment, achieved efficient lysis of tumor cells and enhanced immune response, and significantly inhibited tumor growth.
Patent Information
- Application Number
- CN202510491994.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-07-22
AI Technical Summary
The existing oncolytic viruses face insufficient targeting and immunosuppressive tumor microenvironment limit their effects in tumor treatment, and there are risks of safety and recombination, and they need to be improved to improve their efficiency and safety in tumor treatment.
By deleting the non-essential gene region of ORFV, 005-008, and inserting the Cxcl9 gene, the recombinant sheep mouth virus ORFV Δ-Cxcl9 is constructed, and it is used to express CXCL9 in tumor cells to enhance the anti-tumor immune response and improve the targeting and immune regulation of the virus on the tumor microenvironment.
It enhances the lysis effect of tumor cells and the recruitment of immune cells, significantly inhibits tumor growth, improves the effect of tumor treatment, and maintains the safety and efficiency of the virus.
Smart Images

Figure CN120349976A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to an oncolytic orf virus expressing CXCL9. Background Art
[0002] The tumor microenvironment (TME) is a complex ecosystem surrounding tumor cells, including various cell types (such as immune cells, fibroblasts, endothelial cells, etc.) and acellular components (such as extracellular matrix, cytokines, growth factors, etc.). The tumor microenvironment plays a crucial role in the occurrence, development, invasion and metastasis of tumors.
[0003] Oncolytic viruses (OVs) are a class of viruses that can selectively infect and kill tumor cells, while triggering an anti-tumor immune response. ORFV is an oncolytic virus belonging to the genus Parapoxvirus of the family Poxviridae. It is a double-stranded DNA virus. The virus particles are oval-shaped, about 260×160 nm in size, and have a typical poxvirus structure, including a core, lateral bodies and an envelope. The genome of ORFV is linear double-stranded DNA, about 135 kb in size, containing more than 130 open reading frames (ORFs). The two ends of the ORFV genome are terminal repeat sequences, and the middle is the central coding region. The genome contains genes related to virus replication, transcription, structure formation and morphogenesis, as well as some genes related to virus virulence, immune regulation and host range. ORFV can not only directly lyse tumor cells, but also enhance the anti-tumor immune response by regulating the tumor microenvironment. After ORFV infection, the levels of immunosuppressive cytokines (such as TGF-β, IL-10) in the tumor microenvironment decrease, while the levels of pro-inflammatory cytokines (such as IFN-γ, IL-12) increase, thus reversing the immunosuppressive state of the tumor microenvironment. And ORFV can also induce the expression of chemokines (such as CXCL9, CXCL10), and these chemokines can attract + CXCR3+ T cells and NK cells into the tumor microenvironment to enhance the anti-tumor immune response.
[0004] Oncolytic virus (OV) therapy for tumors is an emerging tumor immunotherapy strategy with dual effects of directly lysing tumor cells and activating anti-tumor immune responses. However, despite the promising potential shown by OV in preclinical studies and clinical trials, it still faces some challenges and drawbacks in practical applications. When OV is administered systemically, such as by intravenous injection, the virus may be cleared by the immune system (e.g., captured by the complement system, antibodies, or phagocytes), resulting in insufficient virus reaching the tumor site; it may also be restricted in its spread in tumor tissues due to certain barriers in the body or high interstitial pressure in the tumor microenvironment, affecting its infection and replication efficiency. Meanwhile, due to the presence of a large number of immunosuppressive cells (e.g., Tregs, MDSCs) and factors (e.g., TGF-β, IL-10) in the tumor microenvironment, these factors will inhibit the anti-tumor immune response induced by OV. And OV usually needs to be used in combination with other therapies (such as immune checkpoint inhibitors, chemotherapy, radiotherapy) to enhance the therapeutic effect. By overcoming these drawbacks, oncolytic viruses are expected to become an important tool in the field of tumor treatment.
[0005] Therefore, based on the characteristics of OVs, modifications are currently being made to improve the effects of oncolytic viruses. There are two main modification strategies to enhance the targeting of OVs: one is to increase the affinity and binding activity of OVs for overexpressed receptors on the tumor surface; the other is to improve the viral replication efficiency by exploiting the characteristics of tumor cells (such as abnormal tumor cell pathways and protein expression), thereby enhancing the targeting accuracy. For example, the targeting of viruses to tumor cells can be enhanced by modifying viral spikes or using heterologous retargeting ligands. Some viruses have their own mechanisms to promote replication. For instance, herpes simplex virus type 1 has a natural RNA capsid protein, and the US11 protein can counteract the body's innate immune response and inhibit the viral response, thus facilitating viral replication. Additionally, some overexpressed genes or proteins produced by tumor cells may further enhance the activity of OVs. For example, Talimogene laherparepvec (T-VEC), which has been approved by the US Food and Drug Administration (FDA), has reduced virulence by deleting the herpes neurovirulence virus gene, enhanced immunogenicity by deleting the viral ICP47 gene, and further enhanced immunogenicity by inserting the human granulocyte-macrophage colony-stimulating factor (GM-CSF) gene. The safety of wild-type OVs has always been a concern. Although attenuated OVs are available, there are still concerns related to viral recombination, toxicity, and the possibility of off-target effects. Therefore, appropriate modification of OVs to improve their safety is crucial for clinical applications. For example, the third-generation oncolytic herpes simplex virus vector G47Δ, which has been approved by the Japanese Ministry of Health, Labour and Welfare (WHLW) for the treatment of gliomas, has had the ICP34.5 gene knocked out to eliminate the virus's neurotoxicity. At the same time, the ECOL-I LacZ gene has been inserted into the ICP6 (UL39) region to inactivate ribonucleotide reductase (RR), enabling the virus to replicate only in tumor cells. Genetically modified / engineered oncolytic viruses have made great progress in the field of cancer treatment and have become a hot research direction in cancer immunotherapy.
[0006] Chemokine (C-X-C motif) ligand 9 (CXCL9), also known as monokine induced by gamma interferon (MIG), is a small-molecular-weight cytokine belonging to the CXC chemokine family. It is induced by IFN-γ and its main function is chemotaxis, attracting CXCR3+ (CXCR3-A and CXCR3-B) T lymphocytes. CXCL9 is one of the ligands of the chemokine receptor CXCR3 and mediates the entry of NK and Th1 cells into the inflammatory site by binding to CXCR3 expressed on activated Th1 and NK cells. It is an essential chemokine for the infiltration of effector T cells into the tumor microenvironment and subsequent immunotherapy efficacy. Moreover, CXCL9 can inhibit endothelial cell proliferation by interfering with the functions of growth factors, basic fibroblast growth factor, and vascular endothelial growth factor receptor, thereby inhibiting angiogenesis and the growth and metastasis of tumors.
[0007] Addison et al. found that there is a high protein level of the ELR-(Glu-Leu-Arg) chemokine CXCL9 in NSCLC tissues. In addition, they found that both recombinant human cytokine CXCL9 (rhCXCL9) or gene transfer of CXCL9 inhibits tumor-derived angiogenesis, suppresses tumor growth and metastasis, thus partially counteracting the angiogenic effects of + chemokines such as IL-8 and epithelial neutrophil activating protein. Thakur et al. suggested that recombinant human cytokines IFN-γ, CXCL9, and CXCL10 can reduce the myeloid-derived suppressor cell (MDSC) population and may inhibit MDSC differentiation. Walsern et al. found that in a murine model of breast cancer, tumor cells expressing CXCL9 inhibit local tumor growth and lung metastasis through host NK cells and a large number of CD4 + CXCR3 + and CD8 + CXCR3 + T cells. Wu et al. detected by PCR and IHC that CXCL9 is highly expressed in tumor tissues of 130 patients and correlated it with clinicopathological features such as tumor metastasis and differentiation. The high expression level of CXCL9 predicts a better overall survival. Harlin et al. found that in 44 melanoma biopsies, highly expressed chemokines (including CXCL9, CCL2, CCL3, CCL4, CCL5, and CXCL10) are significantly correlated with CD8 + T cell recruitment and migration, predicting a good prognosis for cancer patients. Berghuis reported that in 20 patients with Ewing sarcoma, CXCL9, CXCL10, and CCL5 highly expressed in tumor and stromal cells are positively correlated with the accumulated CD8 + T cells.
[0008] ORFV mainly infects sheep and other ruminants, has a lower infectivity to humans and other mammals, and does not cause severe systemic infections. ORFV replicates in the host cytoplasm and does not integrate into the host cell genome, so there is no risk of causing mutations or insertional mutations in the host genome. After ORFV infection, it mainly causes local skin lesions, and the lesions usually heal on their own without causing severe systemic toxic reactions. This makes ORFV have a high safety in human tumor treatment. The ORFV genome is about 135 kb in size, has a large genome capacity, and can accommodate the insertion of foreign genes. This allows multiple foreign genes (such as immunomodulatory factors, reporter genes, etc.) to be inserted into the ORFV genome without significantly affecting virus replication and function. There are some non-essential gene regions in the ORFV genome (such as the ORFV ORFs005 - 008 gene region), and the deletion of these regions does not affect the basic replication and infectivity of the virus. Therefore, by deleting these non-essential gene regions, space can be vacated for inserting foreign genes. And after ORFV infection, it can release various immunomodulatory molecules (such as cytokines, chemokines), activate immune cells (such as T cells, NK cells, DCs, etc.) in the tumor microenvironment, and enhance the anti-tumor immune response. Therefore, by modifying ORFV to overexpress certain chemokines, it may be possible to change the tumor immune microenvironment, enhance the immune regulatory effect of the virus on the tumor microenvironment, and thus improve the oncolytic efficiency. Summary of the Invention
[0009] The object of the present invention is to solve the above problems. The present invention provides a recombinant oncolytic parapoxvirus ORFV virus carrying the Cxcl9 gene and its application in the preparation of anti-tumor drugs. The technical idea of the present invention is that while ORFV acts on tumor cells, CXCL9 acts on immune cells to enhance the anti-tumor immune response and improve the tumor treatment effect, and ORFV is expected to play a greater role in tumor treatment.
[0010] The present invention provides a novel oncolytic virus attenuated strain prepared by precisely modifying an oncolytic virus. The oncolytic virus is orf virus, specifically selected from the Orf virus strain SY17 (GenBank: MG712417.1). The present invention deleted the ORFs 005 - 008 gene cluster of the ORFV virus to obtain an attenuated strain. Compared with the wild-type ORFV, it has higher safety and can be used as a carrier for substances such as antigens and cytokines. After binding with antigens, cytokines, etc., it can be used as a vaccine or a drug.
[0011] To achieve the above object, the present invention provides a novel recombinant orf virus that expresses CXC chemokine ligand 9, namely CXCL9.
[0012] Preferably, the recombinant orf virus is a strain with deletions of ORFV ORFs 005-008 genes, and the deleted fragment is the nucleotide fragment shown in SEQ ID NO: 1.
[0013] Preferably in any of the above, the Cxcl9 gene carried by the recombinant orf virus is one of murine, human, feline or canine origin.
[0014] Preferably in any of the above, the CXCL9 expressed by the recombinant orf virus is mCXCL9, and the amino acid sequence is as shown in SEQ ID NO: 2.
[0015] Preferably in any of the above, the CXCL9 expressed by the recombinant orf virus is hCXCL9, and the amino acid sequence is as shown in SEQ ID NO: 3.
[0016] Preferably in any of the above, the CXCL9 expressed by the recombinant orf virus is fCXCL9, and the amino acid sequence is as shown in SEQ ID NO: 4.
[0017] Preferably in any of the above, the recombinant orf virus is ORFV SY17 strain.
[0018] The present invention also provides a method for preparing the recombinant orf virus described in any of the above. The ORFs 005-008 genes of the wild-type orf virus are deleted, and the Cxcl9 gene is inserted at the deletion position of the ORFs 005-008 genes to obtain the recombinant orf virus. The present invention is also called ORFVΔ-Cxcl9, or an oncolytic virus of ORFV carrying Cxcl9. To achieve the above technical solution, preferably:
[0019] The oncolytic virus of ORFV carrying Cxcl9 includes at least one of recombinant orf viruses ORFVΔ-mCxcl9, ORFVΔ-hCxcl9, and ORFVΔ-fCxcl9.
[0020] The construction method of ORFVΔ-mCxcl9 is to delete the ORFs 005-008 genes of the wild-type orf virus and insert the mCxcl9 gene at the deletion position of the ORFs 005-008 genes. The orf virus with the genomic sequence based on GenBank: MG712417.1 is used as the maternal genome. The genomic sequence of mCxcl9 (murine origin) is GenBank: CT010194.1.
[0021] The nucleotide sequence (mCxcl9 gene sequence) expressing mCxcl9 in the present invention is the nucleotide sequence shown as follows:
[0022] 1) The nucleotide sequence as shown in SEQ ID NO: 5.
[0023] 2) A nucleotide sequence that has codon degeneracy with the nucleotide sequence shown in SEQ ID NO: 5 and expresses the amino acid sequence shown in SEQ ID NO: 2. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 8.
[0024] The construction method of the said ORFVΔ-hCxcl9 is to delete the wild-type orf virus ORFs 005-008 genes and insert the hCXCL9 gene at the position where the ORFs 005-008 genes are deleted. The genome sequence of the orf virus with GenBank: MG712417.1 as the reference is used as the maternal genome. hCXCL9 (human source) genome sequence: HF583679.1.
[0025] The nucleotide sequence (hCXCL9 gene sequence) expressing hCxcl9 in the present invention is the nucleotide sequence shown as follows:
[0026] 3) The nucleotide sequence as shown in SEQ ID NO: 6.
[0027] 4) A nucleotide sequence that has codon degeneracy with the nucleotide sequence shown in SEQ ID NO: 6 and expresses the amino acid sequence shown in SEQ ID NO: 3. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 9.
[0028] The construction method of the said ORFVΔ-fCxcl9 is to delete the wild-type orf virus ORFs 005-008 genes and insert the fCXCL9 gene at the position where the ORFs 005-008 genes are deleted. The genome sequence of the orf virus with GenBank: MG712417.1 as the reference is used as the maternal genome. fCXCL9 (cat source) genome sequence: XM_045056212.1.
[0029] The nucleotide sequence (fCXCL9 gene sequence) expressing fCXCL9 in the present invention is the nucleotide sequence shown as follows:
[0030] 5) The nucleotide sequence as shown in SEQ ID NO: 7.
[0031] 6) A nucleotide sequence that has codon degeneracy with the nucleotide sequence shown in SEQ ID NO: 7 and expresses the amino acid sequence shown in SEQ ID NO: 4. Preferably, it is the nucleotide sequence shown in SEQ ID NO: 10.
[0032] Preferably, in any of the above, the gene sequence inserted at the gene deletion position of ORFs 005 - 008 further includes the gene sequences of P2A and EGFP.
[0033] Preferably, in any of the above, the foreign gene inserted at the gene deletion position of ORFs 005 - 008 is Cxcl9 - P2A - EGFP, which is composed of the gene sequences of the mCxcl9 gene, hCxcl9 gene, fCXCL9 gene described in 1) to 6), the P2A gene sequence, and the EGFP gene sequence.
[0034] Preferably, in any of the above, the P2A gene sequence is as shown in SEQ ID NO: 14.
[0035] Preferably, in any of the above, the EGFP gene sequence is as shown in SEQ ID NO: 15.
[0036] Preferably, in any of the above, the inserted foreign gene Cxcl9 - P2A - EGFP further includes the vv7.5 promoter sequence as shown in SEQ ID NO: 16.
[0037] Preferably, in any of the above, the foreign gene inserted at the gene deletion position of ORFs 005 - 008 is mCxcl9 - P2A - EGFP as shown in SEQ ID NO: 11.
[0038] Preferably, in any of the above, the foreign gene inserted at the gene deletion position of ORFs 005 - 008 is hCxcl9 - P2A - EGFP as shown in SEQ ID NO: 12.
[0039] Preferably, in any of the above, the foreign gene inserted at the gene deletion position of ORFs 005 - 008 is fCxcl9 - P2A - EGFP as shown in SEQ ID NO: 13.
[0040] The present invention also provides the application of the recombinant orf virus described in any of the above in the preparation of anti - tumor drugs.
[0041] The beneficial effects of the present invention are as follows: The present invention uses the ORFV oncolytic virus as a vector to develop tumor immunotherapy drugs ORFVΔ - mCxcl9, ORFVΔ - hCxcl9, and ORFVΔ - fCxcl9 that express Cxcl9. ORFV can utilize the characteristics of virus infection to express CXCL9 inside tumor cells, promote the recruitment of T cells in the tumor microenvironment while lysing tumor cells, and enhance the anti - tumor effect of the oncolytic virus. The present invention provides a new strategy for tumor treatment. Description of the Drawings
[0042] Figure 1This is the construction strategy diagram of the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 1 of the present invention.
[0043] Figure 2 This is the fluorescence detection of the recombinant orf virus ORFVΔ-mCxcl9 obtained after homologous recombination of the recombinant plasmid pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 and the ORFV-SY17 wild-type virus in Preferred Embodiment 1 of the present invention.
[0044] Figure 3 This is the agarose gel verification of the CXCL9 PCR amplification product of the genome of the recombinant orf virus ORFVΔ-mCxcl9 in Preferred Embodiment 1 of the present invention.
[0045] Figure 4 This is the result of the effective inhibition of murine melanoma B16 by the recombinant orf virus ORFVΔ-mCxcl9 and the weight graph of the tumor-excised mice in Preferred Embodiment 2 of the present invention.
[0046] Figure 5 This is the schematic diagram of the recombinant plasmid pUC57-LFΔORFs 005-008-hCxcl9-EGFP-RFΔORFs 005-008 for preparing the recombinant orf virus ORFVΔ-hCxcl9 (human source) in Preferred Embodiment 4 of the present invention.
[0047] Figure 6 This is the infection result of CT26 cells and the morphology of tumor cells after treatment with ORFVΔ-hCxcl9 in Preferred Embodiment 4 of the present invention.
[0048] Figure 7 This is the detection of the survival of 4T1 cells and B16 cells by the CCK-8 method after treatment with ORFVΔ-hCxcl9 in Preferred Embodiment 4 of the present invention.
[0049] Figure 8 This is the schematic diagram of the recombinant plasmid pUC57-LFΔORFs 005-008-fCxcl9-EGFP-RFΔORFs 005-008 for preparing the recombinant orf virus ORFVΔ-fCxcl9 (cat source) in Preferred Embodiment 6 of the present invention.
[0050] Figure 9 This is the enzyme digestion identification result of the recombinant plasmid pUC57-LFΔORFs 005-008-fCxcl9-EGFP-RFΔORFs005-008 in Preferred Embodiment 6 of the present invention.
[0051] Figure 10After treatment with the recombinant orf virus ORFVΔ-fCxcl9 described in Preferred Embodiment 6 of the present invention, the infection results of 4T1 cells and the effects on the morphology of tumor cells.
[0052] Figure 11 After treatment with the recombinant orf virus ORFVΔ-fCxcl9 described in Preferred Embodiment 6 of the present invention, the survival of 4T1 and B16 cells was detected by the CCK-8 method.
[0053] Figure 12 Amplification diagram of the left and right homologous arms for the construction of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid described in Preferred Embodiment 8 of the present invention.
[0054] Figure 13 Sequencing result diagram of the left and right homologous arms of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid described in Preferred Embodiment 8 of the present invention.
[0055] Figure 14 Identification diagram of the left homologous arm of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid described in Preferred Embodiment 8 of the present invention.
[0056] Figure 15 Identification diagram of the right homologous arm of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid described in Preferred Embodiment 8 of the present invention.
[0057] Figure 16 Fluorescence detection of the recombinant orf virus ORFVΔ005-008 obtained after homologous recombination of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 recombinant plasmid with the ORFV-SY17 wild-type virus in Preferred Embodiment 8 of the present invention.
[0058] Figure 17 Results of the effective inhibition of mouse melanoma lung metastatic tumor B16-F10 by the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 3 of the present invention and the mouse survival curve diagram.
[0059] Figure 18 Significant up-regulation of CXCL9 expression promoted by the recombinant orf virus ORFVΔ-mCxcl9 infecting B16 cells described in Preferred Embodiment 2 of the present invention.
[0060] Figure 19 Results diagram of GMGB1 release and B16 LDH release after treatment of 4T1 and B16 cells with the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 4 of the present invention.
[0061] Figure 20 This is the PI staining result diagram after treating B16 cells with the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 4 of the present invention.
[0062] Figure 21 This is the tumor immunohistochemistry result diagram of B16 tumor-bearing mice treated with the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 2 of the present invention.
[0063] Figure 22 This is the HE staining diagram of the heart, liver, spleen, lung and kidney of B16 tumor-bearing mice treated with the recombinant orf virus ORFVΔ-mCxcl9 described in Preferred Embodiment 2 of the present invention.
[0064] Figure 23 This is the flow chart of neutralizing antibody detection in Preferred Embodiment 9 of the present invention.
[0065] Figure 24 This is the result diagram of neutralizing antibody detection in Preferred Embodiment 9 of the present invention. Detailed implementation manners
[0066] The present invention will be further described in detail below with reference to the accompanying drawings and specific implementation manners.
[0067] Orf virus strain (ORFV-SY17): a virus strain already disclosed in the prior art, which can be obtained by the public through sharing with the author.
[0068] OFTu cells: fetal lamb turbinate cells prepared by using the prior art method.
[0069] B16 cells: mouse B16 melanoma cells; B16-F10 cells: mouse skin melanoma cells; 4T1 cells: mouse breast cancer cells, all of which are commercially purchased cells.
[0070] Example 1
[0071] In Example 1, the recombinant orf virus ORFVΔ-mCxcl9 carrying murine chemokine CXC ligand 9 was constructed.
[0072] The recombinant plasmid pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 containing the homologous arms of ORFV ORFs 005-008 genes and EGFP was constructed by homologous recombination technology. Based on the ORFs005-008 gene sequences of orf virus published by NCBI, the upstream and downstream homologous arm sequences were determined. Primers were designed using Premier 5.0 software, and restriction enzyme sites and 20bp nucleotide sequences repeated with both ends of the vector were introduced into the primers. The primers were synthesized by Sangon Biotech Co., Ltd., and the primers are shown in Table 1.1: the primers of the left and right homologous arms, LFΔF is shown in SEQ ID NO: 17, LFΔR is shown in SEQ ID NO: 18, RFΔF is shown in SEQ ID NO: 19, and RFΔR is shown in SEQ ID NO: 20.
[0073] Table 1.1: Primer sequences of the left and right homologous arms
[0074]
[0075] Note: Δ represents deletion; LF represents the left homologous arm; RF represents the right homologous arm; italics represent restriction enzyme sites.
[0076] Viral genomic DNA extraction:
[0077] According to the instructions of the viral gene DNA / RNA extraction kit, the genomic DNA of the ORFV-SY17 isolate was extracted as the template for PCR amplification. The specific operations are as follows:
[0078] (1) Prepare the Carrier RNA working solution (final concentration of 1 μg / μL); buffer GD (60 mL C2H6O) and wash buffer PW (60 mL C2H6O);
[0079] (2) Take 200 μL of the ORFV-SY17 virus solution and add 20 μL of Proteinase K to a 1.5 mL centrifuge tube, then add the mixed solution of 200 μL of Carrier RNA working solution and buffer GB, repeatedly pipette and mix the liquid, and place it in a 56 °C water bath for incubation for 15 min;
[0080] (3) After incubation, add 250 μL of C2H6O, repeatedly pipette and mix the liquid, and let it stand at room temperature for 5 min;
[0081] (4) At the end of the previous step, centrifuge briefly to ensure that all the liquid is centrifuged to the bottom of the tube, and use a pipette to transfer all the liquid into the RNase-Free adsorption column, centrifuge at 8000 rpm for 1 min, and discard the waste liquid;
[0082] (5) Add 500 μL of buffer GD, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and repeat this operation once;
[0083] (6) Add 500 μL of C2H6O, centrifuge at 8000 rpm for 1 min, discard the waste liquid;
[0084] (7) Place the adsorption column back into the collection tube and centrifuge at 12000 rpm for 3 min. The purpose is to remove the C2H6O that may remain in the previous step;
[0085] (8) Place the adsorption column into an RNase-Free centrifuge tube, let it stand at room temperature for 3 min to allow the liquid on the adsorption membrane to evaporate as much as possible. Pipette 50 μL of RNase-Free dd H2O and add it to the middle of the adsorption membrane, avoiding adding the liquid to the side wall or hitting the liquid forcefully onto the adsorption membrane. Let it stand at room temperature for 5 min, centrifuge at 12000 rpm for 1 min, and store at -40 °C for later use.
[0086] Construction of the deletion plasmid:
[0087] Amplification of the left and right homologous arms:
[0088] Using the ORFV-SY17 genomic DNA as a template, amplify the left and right homologous arm sequences by PCR. The PCR reaction system is as follows: 1 μL of template; upper and lower primers for ORFV-SY17 ORFs005 - 008 (LFΔF as shown in SEQ ID NO: 17, LFΔR as shown in SEQ ID NO: 18, RFΔF as shown in SEQ ID NO: 19, RFΔR as shown in SEQ ID NO: 20): 1 μL each; ddH2O: 9.5 μL; Prime STAR Max: 12.5 μL. The PCR reaction conditions are: 98 °C for 2 min, 98 °C for 10 s, 55 °C for 15 s, 72 °C for 8 s, for a total of 36 cycles. After identifying the PCR products by 1% agarose gel electrophoresis, use a gel extraction kit to recover the PCR products, measure the concentration, and store at -40 °C for later use.
[0089] Ligation of the left homologous arm with the target vector:
[0090] Plasmid digestion:
[0091] Digest the pUC57-vv7.5-EGFP vector with the fast-cutting enzymes EcoR I and BglⅡ. The digestion system is as follows: Add 0.5 μL of EcoR I and BglⅡ restriction endonucleases respectively, 2 μL of 10×Quick Cut Buffer, 17 μL of pUC57-vvp7.5-EGFP plasmid, and incubate overnight in a 37°C water bath. The plasmid pUC57-vv7.5-EGFP used in this invention is a plasmid that has been publicly disclosed in the prior art (Zhou Yanlong, Guan Jiyu, Gao Feng, Li Zi, Lan Yungang, Lu Huijun, Song Deguang, Lv Lijun, Lv Pin, Xu Mengshi, Wang Zhenzhen, He Hongbin, Zhao Kui, He Wenqi. Orf virus ORF120 protein positively regulates the NF-κB pathway by interacting with G3BP1. [J]. Journal of virology, 2021.), and the public can obtain it by sharing with the author.
[0092] Ligation:
[0093] Use the pEASY-Basic Seamless Cloning and Assembly Kit from TransGen Biotech to ligate the left homologous arm and the pUC57-vv7.5-EGFP vector digested with EcoRⅠ and BglⅡ at a molar mass ratio of 2:1 to construct the pUC57-EGFP-LF_ORF 005 plasmid. Subsequently, perform a transformation experiment: Add 10 μL of the ligated recombinant plasmid pUC57-EGFP-LF_ORF 005 to 50 μL of Trans-1-T1 competent cells, gently pipette several times with a pipette gun, incubate on ice for 30 min, incubate at 42°C for 90 s; then incubate on ice for 3 min, add 1 mL of LB liquid medium without resistance, place it in a 37°C shaker at 180 rpm for 1-2 h, take 200 μL of the bacterial solution and spread it on an LB solid medium containing ampicillin resistance with a spreader, and place the plate upside down in a 37°C constant temperature incubator for 12-16 h.
[0094] Identification:
[0095] Pick several single colonies on the plate and add them separately to 3 mL of LB liquid medium containing ampicillin resistance. Incubate them in a shaker at 37°C and 180 rpm / min for 6 - 10 h. Identify the bacterial solution by PCR. The reaction conditions are: 98°C for 2 min, 98°C for 10 s, 55°C for 15 s, 72°C for 8 s, for a total of 36 cycles. Identify the PCR products by 1% agarose gel electrophoresis. Send the bacterial solution that matches the size of the left homologous arm fragment to Sangon Biotech Co., Ltd. for sequencing. At the same time, expand the culture of this bacterial solution, extract the plasmid using the Endo-free Plasmid Mini KitⅡ kit, and perform double digestion identification.
[0096] Ligation of the right homologous arm and the target vector:
[0097] Plasmid digestion:
[0098] Digest the recombinant vector pUC57-EGFP-LF_ORF 005 with the fast cut enzymes BamH I and HindⅢ. The reaction conditions are 1 - 2 h in a 37°C water bath. After 1% agarose gel electrophoresis of the digestion products, recover the gel, measure the concentration, and store it at -40°C for later use.
[0099] Ligation:
[0100] According to the method described above, ligate the right homologous arm and the pUC57-EGFP-LF_ORF005 vector digested with BamH I and HindⅢ at a molar mass ratio of 2:1. The product is named pUC57-LF_ORF 005-EGFP-RF_ORF008.
[0101] Transformation and identification:
[0102] According to the method described above, add 10 μL of the ligated recombinant plasmid pUC57-LF_ORF 005-EGFP-RF_ORF008 to 50 μL of Trans-1-T1 competent cells and perform identification.
[0103] Construction of the recombinant plasmid:
[0104] Figure 1 It is the construction strategy diagram of the recombinant orf virus ORFVΔ-mCxcl9. In the foreign gene ligated after deleting the ORFs 005 - 008 genes of ORFV, insert the target gene Cxcl9 and the self-cleaving 2A peptide (P2A) between the VV7.5 promoter and the EGFP green fluorescent reporter gene. Its function is to express the target gene Cxcl9 and EGFP separately.
[0105] Fusion PCR:
[0106] The present invention uses fusion PCR technology to link Cxcl9 with P2A. The specific process is as follows: First, through the homologous directed amplification strategy, the P2A self-cleaving sequence shown in SEQ ID NO: 14 is introduced at the N-terminus of the target gene. Specific primer pairs (mF / mR1) containing homologous arms are designed, where the 5'-end of mF carries the P2A coding sequence and the 3'-end of mR1 contains the downstream stop codon. The reaction system for the first-round PCR is: 1 μL of murine cell cDNA template, 1 μL of each primer, 12.5 μL of PrimeSTAR Max DNA Polymerase, 2 μL of dNTP mix, and ddH2O is added to make up to 25 μL. The reaction program is set as: pre-denaturation at 98°C for 2 min; then 35 cycles (denaturation at 98°C for 15 s, annealing at 55 - 63°C for 15 s, extension at 72°C for 30 s). The amplification products are separated by 1% agarose gel electrophoresis (Bio-Rad GelImage System), and the target bands are purified using the Omega Bio-tek gel extraction kit and used as intermediate templates. For the second amplification, the overlap extension method is used to introduce vector-compatible sequences, and the primer pair mF / R2 is used instead. The reaction system is adjusted to: 1 μL of intermediate product template, 1 μL of each primer, 12.5 μL of PrimeSTAR Max DNA Polymerase, 2 μL of dNTP mix, and ddH2O to 25 μL. The amplification parameters remain the same, only the annealing temperature gradient is optimized to 58 - 60°C to enhance primer specificity. The final products are subjected to secondary gel extraction and stored at -40°C for later use.
[0107] The nucleotide sequences of the primers are as follows: mF is the nucleotide sequence shown in SEQ ID NO: 21, mR1 is the nucleotide sequence shown in SEQ ID NO: 22, and R2 is the nucleotide sequence shown in SEQ ID NO: 23.
[0108] Plasmid digestion:
[0109] The successfully constructed pUC57-LF_ORF 005-EGFP-RF_ORF 008 gene deletion plasmid carrying green fluorescent protein is digested with Xba I restriction endonuclease. The digestion system is as follows: 1 μL of Xba I, 2 μL of 10×Quick Cut Buffer, 17 μL of pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid, and the reaction is carried out overnight in a 37°C water bath.
[0110] Ligation and transformation:
[0111] Construct the pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 plasmid. The specific process is as follows: The gel-extracted Cxcl9-P2A fragment and the pUC57-LF_ORF 005-EGFP-RF_ORF 008 vector digested with Xba I were mixed at a molar ratio of 2:1. According to the operation method of the seamless cloning kit, the seamless cloning was completed by reacting at 37°C for 20 min. Add 10 μL of the ligation product to 50 μL of Trans-1-T1 competent cells, gently pipette several times with a pipette gun, incubate on ice for 30 min, and incubate at 42°C for 90 s; then incubate on ice for 3 min, add 1 mL of LB liquid medium without antibiotic, place it on a shaker at 37°C and 180 rpm / min for 1-2 h. Take 200 μL of the bacterial solution and spread it on an LB solid medium containing ampicillin resistance with a spreader. Invert the plate and place it in a 37°C constant temperature incubator for 12-16 h. The nucleotide sequence of the mCxcl9 gene is shown in SEQ ID NO: 5. The nucleotide sequence of mCxcl9-P2A-EGFP with the vv7.5 promoter (that is, the mCxcl9-P2A-EGFP sequence in the pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 recombinant plasmid of the present invention) is shown in SEQ ID NO: 11.
[0112] Identification:
[0113] Send the bacterial solution for PCR identification to Sangon Biotech for sequencing. After verification, perform large-scale shaking culture. Extract the plasmid using the Endo-free Plasmid Mini Kit П kit and perform enzyme digestion identification. The pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 recombinant plasmid carrying the Cxcl9 gene was successfully constructed.
[0114] Transfection, screening and purification:
[0115] Inoculate the contagious ecthyma virus strain of sheep (ORFV-SY17) into a 6-well plate pre-coated with OFTu cells grown to about 80% confluence at an MOI of 0.1. After mixing, place it in a 37°C, 5% CO2 incubator for culture. After 30 min, shake the culture medium and place it in a 37°C, 5% CO2 incubator for another 30 min. Incubate the virus solution for 1 h, then supplement with DMEM high-glucose culture medium containing 3% BI fetal bovine serum, and place it in a 37°C, 5% CO2 incubator for 6 h.
[0116] Refer to the instruction manual of Hanheng Biotechnology LipoFiter 3.0 liposome transfection reagent. Add 4 μg of pUC57-LF_ORF005-mCxcl9-EGFP-RF_ORF 008 recombinant plasmid into 250 μL of DMEM solution, and gently pipette to mix evenly. Then take another clean and sterile centrifuge tube, add 250 μL of DMEM solution, and then add 6 μL of LipoFiter 3.0. Gently pipette to mix evenly, incubate at room temperature for 5 min. Then mix the above two incubated liquids, gently pipette to mix evenly, and incubate at room temperature for 20 min. After that, add all 500 μL of the LipoFiter 3.0-DNA incubation mixture into one well of the above virus-infected 6-well plate. When adding, pay attention to adding as evenly as possible to the whole well, and then gently mix in an "8" shape. Incubate the cells in an incubator at 37°C and 5% CO2 for 72 h, and then observe the virus infection situation under an inverted fluorescence microscope. For the green fluorescence area observed under the fluorescence inverted microscope (suspected gene-deleted virus carrying the EGFP fluorescence marker), scrape this area with 10 μL of DMEM culture medium, place it in 50 μL of serum-free DMEM culture medium, and store it at -80°C for subsequent screening.
[0117] Limited dilution screening:
[0118] One day in advance, seed OFTu cells into a 96-well plate to ensure that the cell confluence reaches 80-90% the next day; discard the original culture medium in the 96-well plate and wash it 2-3 times with PBS; serially dilute the above frozen virus solution with serum-free DMEM culture medium, seed it into the 96-well plate, incubate it in a cell incubator at 37°C for 1-2 h, and then supplement with complete medium until the final serum concentration is 2-5%; after 72 h, observe under a fluorescence inverted microscope, and continue to select and mark and scrape the diseased areas that emit green fluorescence, trying to avoid scraping the diseased areas that do not emit green fluorescence; repeat the screening in this way.
[0119] Plaque screening
[0120] One day in advance, seed OFTu cells into a 12-well plate to ensure that the cell confluence reaches 80 - 90% the next day; discard the original culture medium in the 12-well plate and wash it 2 - 3 times with PBS; add 250 μL of serum-free DMEM culture medium to each well, and inoculate the virus solution obtained after limited dilution into the 12-well plate; incubate in a 37 °C cell culture incubator for 1 - 2 h; mix 2×DMEM culture medium containing 6% fetal bovine serum and 2% penicillin / streptomycin double antibody with 1.5% low melting point agarose, discard the incubated virus solution, add 500 μL of the mixed liquid to each well, and place it in a 37 °C incubator after solidification; after 72 h, observe under a fluorescence inverted microscope and pick the green fluorescence aggregation area; repeat the screening in this way, and finally obtain the recombinant orf virus ORFVΔ-mCxcl9.
[0121] As Figure 2 Shown in the figure, after infecting OFTu cells with the ORFV-SY17 wild-type virus, transfect the pUC57-LF_ORF 005-mCxcl9-EGFP-RF_ORF 008 recombinant plasmid carrying the ORFV-005-008 homologous arms. After 72 hours, the expression of green fluorescent protein was observed under a fluorescence microscope, indicating that the recombinant plasmid was successfully transfected and homologous recombination occurred with ORFV-SY17. Collect the diseased cells expressing green fluorescence, freeze-thaw repeatedly and then perform gradient dilution and plaque screening. Microscopic observation showed that with multiple rounds of screening, the virus purity gradually increased. Finally, all diseased cells showed fluorescence, indicating that the virus purity reached the expectation.
[0122] Identification:
[0123] Extract the genomes of the ORFV-SY17 wild strain and the ORFVΔ-mCxcl9 recombinant strain. The primers required for PCR identification were provided by Sangon Biotech Co., Ltd., and the specific primer sequences are shown in Table 1.2. The PCR reaction system was configured as follows: 1 μL of genomic DNA template, 12.5 μL of PrimeSTAR Max Premix (2×), 1 μL of upstream primer F (the nucleotide sequence of the upstream primer F for identification is shown in SEQ ID NO: 28), 1 μL of downstream primer R (the nucleotide sequence of the downstream primer R for identification is shown in SEQ ID NO: 29), and 9.5 μL of ddH2O, with a total volume of 25 μL. The PCR reaction conditions were set as follows: pre-denaturation at 98 °C for 15 seconds, annealing at 55 - 62 °C for 20 seconds, extension at 72 °C for 35 seconds, for a total of 34 cycles. After separating the PCR products by 1% agarose gel electrophoresis, use a GelImage System gel imager to observe and record the results. After electrophoresis, the target band was recovered from the gel and sent to Sangon Biotech Co., Ltd. for sequencing analysis, and the sequencing results showed no gene mutations.
[0124] Table 1.2: Identification primer sequences
[0125] Name Sequence Identification upstream primer F Aaagcaccccatccact Identification downstream primer R tgtagtcttccttgaacgacga
[0126] As Figure 3 shown, it is the verification result of agarose gel electrophoresis of the Cxcl9 PCR amplification product of the recombinant orf virus ORFVΔ-mCxcl9 genome in Example 1. Lane 1 is the DNA Marker, lane 2 is the amplification product of the wild-type ORFV genome, and lane 3 is the amplification product of the ORFVΔ-mCxcl9 genome.
[0127] Example 2
[0128] In Example 2, the ORFVΔ-mCxcl9 recombinant oncolytic virus effectively inhibits murine melanoma.
[0129] In this case, taking the ORFVΔ-mCxcl9 oncolytic virus prepared in Example 1 as an example, this virus can significantly increase the expression level of CXCL9 in B16 cells and was studied in a murine melanoma model. In the study, 5×10 5 B16 cells were subcutaneously implanted into the left abdomen of 6- to 8-week-old male C57BL / 6 mice. After the tumors formed, the length (L) and width (W) of the tumors were measured daily with calipers, and the tumor volume was calculated according to the formula (L×W 2 ) / 2. The experiment set up a Ctrl group (PBS treatment group), ORFV WT (ORFV wild strain), and ORFVΔ005-008 (ORFV ORFs005-008 gene deletion strain) as control groups, and PBS, ORFV WT, ORFVΔ005-008, and the ORFVΔ-mCxcl9 recombinant oncolytic virus were respectively injected into the murine melanoma tumors. The injection frequency was once every two days, for a total of three injections, and the injection volume each time was 10 6 TCID 50 / mouse. The volume of PBS injected in the Ctrl group should be the same as the volume of the virus injected in the ORFV WT, ORFVΔ005-008, and ORFVΔ-mCxcl9 recombinant oncolytic virus groups. The experimental results showed that compared with the PBS group, the growth of tumors in each experimental group of mice was inhibited to varying degrees, and the inhibitory effect of the ORFVΔ-mCxcl9 oncolytic virus on tumor growth was particularly significant. After the tumors were dissected, the body weights of the mice were measured. The results showed that the recombinant oncolytic virus treatment had no significant effect on the body weight changes of the mice, indicating that the ORFVΔ-mCxcl9 recombinant oncolytic virus has basic safety during tumor treatment. In addition, the tumors dissected after the last treatment were photographed and weighed. The results showed that there was a significant difference in the size of the tumors in the mice treated with ORFVΔ-mCxcl9 three times compared with the control group.
[0130] Figure 4 It shows the significant inhibitory effect of the recombinant orf virus ORFVΔ-mCxcl9 in Example 2 on the tumor growth of melanoma-bearing mice. In the experiment, treatment was carried out once every two days and the tumor volume was measured, and a total of three treatments were carried out. Figure 4 -A shows the weight changes of tumor-bearing mice in each group when the tumors were dissected after different treatments. The results show that the ORFVΔ-mCxcl9 treatment has no significant effect on the body weight of mice, further verifying its safety. Figure 4 -B is a photographic record of the dissected tumor tissues after the last recombinant oncolytic virus treatment, visually showing the inhibitory effect of ORFVΔ-mCxcl9 on tumor growth. Compared with the control group, the tumor volume in the ORFVΔ-mCxcl9 treatment group was significantly reduced, confirming its effectiveness in melanoma treatment.
[0131] Figure 18 It shows the experimental results of the recombinant orf virus ORFVΔ-mCxcl9 in Example 2 after infecting B16 cells for 10 hours. Through quantitative analysis, it was found that the expression level of CXCL9 in the ORFVΔ-mCxcl9 infection group was significantly higher than that in the ORFV WT control group.
[0132] After dissecting the tumor tissues, they were fixed in 4% paraformaldehyde, the tissues were prepared into paraffin sections, and immunohistochemical staining was carried out. The infiltration of CD8 + T cells in the tumors of the ORFV-WT group, ORFV-Δ005-008 group, and ORFVΔ-mCxcl9 group was more than that in the Ctrl group; the infiltration of CD8 + T cells in the ORFVΔ-mCxcl9 group was more than that in the ORFV-WT group and ORFV-Δ005-008 group, as Figure 21 shown.
[0133] The heart, liver, spleen, lung, and kidney tissues of each group were dissected, fixed in 4% paraformaldehyde, the tissues were prepared into paraffin sections, and HE staining was carried out. There were no differences in the tissues of the Ctrl group, ORFV-WT group, ORFV-Δ005-008 group, and ORFVΔ-mCxcl9 group, indicating that the anti-tumor effect of ORFV does not cause damage to the heart, liver, spleen, lung, and kidney tissues, and inserting the CXCL9 gene will not cause additional damage to the mouse tissues, as Figure 22 shown.
[0134] Example 3
[0135] The recombinant orf virus ORFVΔ-mCxcl9 was prepared by the method of Example 1, in which the gene sequence of mCxcl9 was replaced with the sequence shown in SEQ ID NO: 8. Subsequently, according to the experimental procedure of Example 2, the effect of ORFVΔ-mCxcl9 prepared based on SEQ ID NO: 8 was verified. The experimental results showed that the recombinant orf virus ORFVΔ-mCxcl9 obtained in Example 3 could significantly inhibit the growth of tumors in a mouse model. Compared with the ORFV WT and ORFVΔ005-008 control groups, the therapeutic effect of ORFVΔ-mCxcl9 was significantly enhanced, and the inhibitory effect on tumor growth was more obvious. This finding further confirmed that the recombinant orf virus ORFVΔ-mCxcl9 had stronger anti-tumor activity in tumor treatment, providing strong support for its potential clinical application.
[0136] ORFVΔ-mCxcl9 could significantly enhance the survival rate of mice. A mouse lung metastasis model in vivo was constructed using B16-F10 cells. It was significantly observed that the survival rates of the ORFV-WT group, ORFV-Δ005-008 group, and ORFVΔ-mCxcl9 group were all higher than those of the Ctrl group. Moreover, by observing the lung tissues of the mice, the number of lung tumors in the ORFVΔ-mCxcl9 group was lower than that in the ORFV-WT group and the ORFV-Δ005-008 group, as Figure 17 shown. Figure 17 -A is the survival curve of mice, Figure 17 -B is the result of ORFVΔ-mCxcl9 effectively inhibiting B16-F10 melanoma lung metastases in mice.
[0137] Example 4
[0138] Example 4 provided the construction and in vitro verification of the recombinant orf virus ORFVΔ-hCxcl9.
[0139] 1) The recombinant orf virus ORFVΔ-hCxcl9 was constructed by a preparation method similar to that of Example 1, except that the Cxcl9 gene was hCxcl9, and its gene sequence was as shown in SEQ ID NO: 6. Figure 5 The structure of the prepared pUC57-LF_ORF 005-hCxcl9-EGFP-RF_ORF 008 recombinant plasmid was shown. In this plasmid, a self-cleaving 2A peptide (P2A) was inserted between hCxcl9 and EGFP to form an hCxcl9-P2A-EGFP fusion sequence, which was driven by the vv7.5 promoter, and its nucleotide sequence was as shown in SEQ ID NO: 12. This was also the core component of the pUC57-LF_ORF 005-hCxcl9-EGFP-RF_ORF 008 recombinant plasmid described in the present invention.
[0140] The method for constructing the recombinant plasmid containing P2A was basically the same as that in Example 1, with the main difference being the primer sequences used: the nucleotide sequence of the upstream primer hF was as shown in SEQ ID NO: 24, the nucleotide sequence of the downstream primer hR1 was as shown in SEQ ID NO: 25, and the nucleotide sequence of R2 was as shown in SEQ ID NO: 23. The design of these primers ensured the precise ligation of hCxcl9 and EGFP through the P2A peptide, thus achieving the efficient expression of the hCxcl9-P2A-EGFP fusion protein.
[0141] 2) Infect tumor cells
[0142] In this example, the wild strain of orf virus ORFV WT, the gene-deleted strain of orf virus ORFVΔ005-008, and the recombinant orf virus ORFVΔ-hCxcl9 were used to infect CT26 cells (MOI = 1). The cell morphology was observed after 12 h, as Figure 6 shown. The treatment groups of ORFVΔ-hCxcl9, ORFVΔ005-008, and ORFV WT could all infect tumor cells and kill the tumor cells.
[0143] 3) Detect cell survival by CCK-8
[0144] In this example, the wild strain of orf virus ORFV WT, the gene-deleted strain of orf virus ORFVΔ005-008, and the recombinant orf virus ORFVΔ-hCxcl9 were used to infect 4T1 cells and B16 cells at a multiplicity of infection of MOI = 1, respectively. After 72 h of infection, the Cell Counting Kit-8 (CCK-8 kit, product number C0037) from Beyotime Biotechnology Co., Ltd. was used to detect the survival rate of cells in each group. The experimental results were as Figure 7 shown. The treatment groups of ORFVΔ-hCxcl9 and ORFVΔ005-008 could both significantly inhibit the survival of tumor cells, indicating that these two recombinant viruses had a strong killing effect on tumor cells. Compared with the ORFV WT control group, ORFVΔ-hCxcl9 and ORFVΔ005-008 showed more significant effects in inhibiting the survival of tumor cells.
[0145] The wild strain of orf virus ORFV WT, the deletion strain of orf virus ORFVΔ005 - 008, and the recombinant orf virus ORFVΔ - hCxcl9 were used to infect 4T1 cells and B16 cells (MOI = 1) respectively. The release of high mobility group box - 1 protein (HMGB1) in the cell supernatant was detected. From the results of WB, it can be observed that ORFVΔ - hCxcl9 does not affect the release of HMGB1 compared with the ORFV WT group. And the supernatant of B16 cells was collected to detect the release of LDH. The wild strain of orf virus ORFV WT, the gene - deleted strain of orf virus ORFVΔ005 - 008, and the recombinant orf virus ORFVΔ - hCxcl9 all caused the release of LDH from B16 cells, further indicating that after inserting the CXCL9 gene, it does not affect the virus's destruction of the cell membrane integrity of tumor cells. As Figure 19 shown, where 1 is Ctrl, 2 is ORFV WT, 3 is the gene - deleted strain of orf virus ORFVΔ005 - 008, and 4 is the recombinant orf virus ORFVΔ - hCxcl9.
[0146] The wild strain of orf virus ORFV WT, the gene - deleted strain of orf virus ORFVΔ005 - 008, and the recombinant orf virus ORFVΔ - hCxcl9 were used to infect B16 cells (MOI = 1). PI dye was added. Through the fluorescence microscope, the PI dye in the culture medium entered B16 cells as the cells swelled, further indicating that the integrity of the cell membrane was damaged, and after inserting the CXCL9 gene, it does not affect the virus's destruction of the cell membrane integrity of tumor cells. As Figure 20 shown.
[0147] Example 5
[0148] Example 5 is similar to Example 4, except that the hCxcl9 gene for constructing the recombinant orf virus ORFVΔ - hCxcl9 is the nucleotide sequence shown in SEQ ID NO: 9. The CCK - 8 results showed that the treatment groups of the recombinant orf virus ORFVΔ - hCxcl9 obtained in Example 5, the ORFV WT treatment group, and the ORFVΔ005 - 008 treatment group could all inhibit the survival of tumor cells.
[0149] Example 6
[0150] Example 6 provides the construction and in - vitro verification of the recombinant orf virus ORFVΔ - fCxcl9.
[0151] 1) Using a preparation method similar to that in Example 1, the recombinant orf virus ORFVΔ - fCxcl9 was prepared, except that the gene sequence of fCxcl9 is as shown in SEQ ID NO: 7. Figure 8The prepared recombinant plasmid pUC57-LF_ORF 005-fCxcl9-EGFP-RF_ORF 008 has a self-cleaving 2A peptide (P2A) inserted between the site where fCxcl9 is inserted and EGFP. The nucleotide sequence of fCxcl9-P2A-EGFP with the vv7.5 promoter (i.e., the fCxcl9-EGFP sequence in the recombinant plasmid pUC57-LF_ORF 005-fCxcl9-EGFP-RF_ORF 008 of the present invention) is shown in SEQ ID NO: 13.
[0152] The method for constructing the recombinant plasmid containing P2A is similar to that in Example 1, except that the nucleotide sequences of the primers are as follows: fF is the nucleotide sequence shown in SEQ ID NO: 26, fR1 is the nucleotide sequence shown in SEQ ID NO: 27, and R2 is the nucleotide sequence shown in SEQ ID NO: 23.
[0153] Figure 9 It is the restriction enzyme digestion identification result of the recombinant plasmid pUC57-LF_ORF 005-fCxcl9-EGFP-RF_ORF 008; Figure 9 In it, lane 1 is DL15000 DNA Marker, lane 2 is the recombinant plasmid pUC57-LF_ORF 005-fCxcl9-EGFP-RF_ORF 008, and lane 3 is the restriction enzyme digested recombinant plasmid pUC57-LF_ORF 005-fCxcl9-EGFP-RF_ORF 008 (the restriction enzyme sites are BgIII and Xhol).
[0154] 2) Infect tumor cells
[0155] In this example, the wild strain of orf virus ORFV WT, the deleted strain of orf virus ORFVΔ005-008, and the recombinant orf virus ORFVΔ-fCxcl9 infect B16 cells (mouse B16 melanoma cells) (MOI = 1). Observe the cell morphology after 12 h. As Figure 10 shown, the treatment groups of ORFVΔ-hCxcl9, ORFVΔ005-008, and ORFV WT can all infect tumor cells and kill the tumor cells.
[0156] 3) CCK-8 assay for cell viability
[0157] In this example, the orf virus deletion strain ORFVΔ005-008 and the recombinant orf virus ORFVΔ-fCxcl9 were used to infect 4T1 and B16 cells (MOI = 1). After 24 hours, the Cell Counting Kit-8 (CCK-8 kit) (C0037) from Beyotime Biotechnology Co., Ltd. was used to detect the survival of cells in each group; the results are as Figure 11 shown. The ORFVΔ-fCxcl9, ORFVΔ005-008, and ORFV WT treatment groups could all significantly inhibit the proliferation of tumor cells, and the effect of the ORFVΔ-fCxcl9 strain was more significant.
[0158] Example 7
[0159] Example 7 was similar to Example 6, except that the fCxcl9 gene for constructing the recombinant orf virus ORFVΔ-fCxcl9 was the nucleotide sequence shown in SEQ ID NO: 10. The results showed that the release amounts of LDH in the treatment groups of the recombinant orf virus ORFVΔ-fCxcl9 and ORFVΔ005-008 obtained in Example 7 were significantly different from those in the untreated group, indicating that after deletion or addition of foreign genes, the deleted virus or recombinant virus could both infect tumor cells, causing their membrane rupture and releasing LDH; the CCK-8 results showed that the recombinant orf virus ORFVΔ-fCxcl9 had a stronger killing ability against tumor cells compared with the ORFVΔ005-008 treatment group.
[0160] Example 8
[0161] Example 8 details the method for preparing the orf virus ORFs005-008 gene deletion strain (abbreviated as ORFVΔ005-008 strain or ORFVΔ) for the treatment control group in this application. The specific steps are as follows: Through homologous recombination technology, the pUC57-LF_ORF 005-EGFP-RF_ORF 008 recombinant plasmid containing the homologous arms of the ORFV ORFs 005-008 gene and the EGFP reporter gene was constructed. First, according to the upstream and downstream sequences of the orf virus ORFs005-008 gene in the NCBI database, the sequences of the left and right homologous arms were determined. Subsequently, primers were designed using Premier 5.0 software, and restriction enzyme sites were introduced into the primers. At the same time, approximately 20 bp nucleotide sequences repeated with the vector sequence were added to both ends of the primers. The designed primers were synthesized by Sangon Biotech Co., Ltd. The specific primer sequences are shown in Table 1.1: the left homologous arm primers LFΔF (SEQ ID NO: 17) and LFΔR (SEQ ID NO: 18), and the right homologous arm primers RFΔF (SEQ ID NO: 19) and RFΔR (SEQ ID NO: 20).
[0162] Viral genomic DNA extraction:
[0163] According to the instructions of the viral gene DNA / RNA extraction kit, extract the genomic DNA of the ORFV-SY17 isolate as a template for PCR amplification. The specific operation is as follows:
[0164] (1) Prepare carrier RNA working solution (final concentration 1 μg / μL); buffer GD (60 mL C2H6O) and rinse solution PW (60 mL C2H6O);
[0165] (2) Take 200 μL of LORFV-SY17 virus solution and add 20 μL of Proteinase K in a 1.5 mL centrifuge tube, then add 200 μL of a mixture of Carrier RNA and buffer GB, repeatedly pipette and mix the liquid, and incubate in a 56°C water bath for 15 min;
[0166] (3) After incubation, add 250 μL C2H6O, mix the liquid by repeatedly pipetting, and leave at room temperature for 5 min;
[0167] (4) When the previous step is completed, centrifuge briefly to ensure that all the liquid is centrifuged to the bottom of the tube. Use a pipette to add all the liquid to the RNase-Free adsorption column, centrifuge at 8000 rpm for 1 min, and discard the waste liquid;
[0168] (5) Add 500 μL of buffer GD, centrifuge at 8000 rpm for 1 min, discard the waste liquid, and repeat this operation once;
[0169] (6) Add 500 μL C2H6O, centrifuge at 8000 rpm for 1 min, and discard the waste liquid;
[0170] (7) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 3 min to remove any C2H6O that may remain in the previous step;
[0171] (8) Place the adsorption column in an RNase-Free centrifuge tube and leave it at room temperature for 3 min to allow the liquid on the adsorption membrane to evaporate as much as possible. Use a pipette to draw 50 μL RNase-Free dd H2O and add it to the middle of the adsorption membrane. Avoid adding the liquid to the side walls or forcibly hitting the liquid onto the adsorption membrane. Leave it at room temperature for 5 min, centrifuge at 12,000 rpm for 1 min, and store at -40°C for later use.
[0172] Construction of deletion plasmid:
[0173] Amplification of left and right homology arms:
[0174] Using the ORFV-SY17 genomic DNA as a template, the left and right homologous arm sequences were amplified by PCR. The PCR reaction system was as follows: 1 μL of template; the upper and lower primers for ORFV-SY17 ORFs005-008 (LFΔF as shown in SEQ ID NO: 17, LFΔR as shown in SEQ ID NO: 18, RFΔF as shown in SEQ ID NO: 19, RFΔR as shown in SEQ ID NO: 20): 1 μL each; ddH2O: 9.5 μL; Prime STAR Max: 12.5 μL. The PCR reaction conditions were: 98°C for 2 min, 98°C for 10 s, 55°C for 15 s, 72°C for 8 s, for a total of 36 cycles. After the PCR products were identified by 1% agarose gel electrophoresis, the PCR products were recovered using a gel recovery kit, the concentration was measured, and they were stored at -40°C for later use. Figure 12 Construct the amplification diagram of the left and right homologous arms for the plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008.
[0175] Ligation of the left homologous arm to the target vector:
[0176] Plasmid digestion:
[0177] Digest the pUC57-vv7.5-EGFP vector with the fast cutter enzymes EcoR I and BglⅡ. The digestion system was: add 0.5 μL of each of the EcoR I and BglⅡ restriction endonucleases, 2 μL of 10×Quick Cut Buffer, 17 μL of the pUC57-vvp7.5-EGFP plasmid, and incubate overnight in a 37°C water bath.
[0178] Ligation:
[0179] Using the pEASY-Basic Seamless Cloning and Assembly Kit from TransGen Biotech, ligate the left homologous arm to the pUC57-vv7.5-EGFP vector digested with EcoRⅠ and BglⅡ at a molar mass ratio of 2:1 to construct the pUC57-EGFP-LFΔORFs 005 plasmid. Subsequently, perform a transformation experiment: add 10 μL of the ligated recombinant plasmid pUC57-EGFP-LFΔORFs 005 to 50 μL of Trans-1-T1 competent cells, gently pipette several times with a pipette gun, incubate on ice for 30 min, incubate at 42°C for 90 s; then incubate on ice for 3 min, add 1 mL of LB liquid medium without resistance, place it on a shaker at 37°C at 180 rpm / min for 1-2 h, take 200 μL of the bacterial solution and spread it on an LB solid medium containing ampicillin resistance using a spreader, and place the plate upside down in a 37°C constant temperature incubator for 12-16 h.
[0180] Identification:
[0181] Pick several single colonies on the plate and add them into 3 mL of LB liquid medium containing ampicillin resistance respectively. Incubate them in a shaker at 37 °C and 180 rpm / min for 6 - 10 h. Perform PCR identification on the bacterial liquid. The reaction conditions are: 98 °C for 2 min, 98 °C for 10 s, 55 °C for 15 s, 72 °C for 8 s, for a total of 36 cycles. Identify the PCR products by 1% agarose gel electrophoresis. After extracting the plasmid of the bacterial liquid with the Endo-free PlasmidMini KitⅡ kit, perform double digestion reaction with EcoR I and BglⅡ, and verify the correctness of the vector construction by agarose gel electrophoresis. Figure 14 This is the identification diagram of the left homologous arm of the pUC57-LF_ORF 005-EGFP plasmid. Among them, A is the PCR identification diagram of the left homologous arm of pUC57-LF_ORF 005-EGFP. The first lane (Marker) is DL2000 DNA Marker, the second and third lanes (+) are the PCR amplification products of the left homologous arm, and the fourth lane (-) is the PCR amplification product with ddH2O as the PCR template as a negative control. B is the double digestion result diagram of the pUC57-LF_ORF 005-EGFP-RF_ORF 008 plasmid. The first lane (Marker) is DL2000 DNA Marker, the second lane (Marker) is DL15000 DNA Marker, the third and fourth lanes (digestion) are the products of the plasmid digested with EcoR I and BglⅡ, and the fifth lane (-) is the plasmid without digestion as a negative control.
[0182] Ligation of the right homologous arm and the target vector:
[0183] Plasmid digestion:
[0184] Digest the recombinant vector pUC57-EGFP-LFΔORFs 005 with the fast-cutting enzymes BamH I and HindⅢ. The reaction conditions are a water bath at 37 °C for 1 - 2 h. After the digestion products are subjected to 1% agarose gel electrophoresis, recover the gel, measure the concentration, and store it at -40 °C for standby.
[0185] Ligation:
[0186] According to the method described above, ligate the right homologous arm and the pUC57-EGFP-LFΔORFs005 vector digested with BamH I and HindⅢ at a molar mass ratio of 2:1. The product is named pUC57-LF_ORF 005-EGFP-RF_ORF008.
[0187] Transformation and identification:
[0188] According to the method described above, 10 μL of the ligated recombinant plasmid pUC57-LF_ORF 005-EGFP-RF_ORF008 was added to 50 μL of Trans-1-T1 competent cells. Positive colonies were selected, and after expanded culture, plasmids were extracted. The left and right homologous arm PCR products were sent to a biological company for sequencing, and were identified by digestion with BamH I and HindⅢ. Figure 13 Construct a sequencing result map of the left and right homologous arms for the plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008. Figure 15 For the identification map of the right homologous arm of the plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008, where A is the PCR identification map of the right homologous arm of the plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008. The first lane (Marker) is DL2000 DNA Marker, the second and third lanes (+) are the PCR amplification products of the right homologous arm, and the fourth lane (-) is the PCR amplification product with ddH2O as the PCR template as a negative control. B is the double digestion result map of the plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008. The first lane (Marker) is DL2000 DNA Marker, the second lane (Marker) is DL15000 DNA Marker, the third and fourth lanes (digestion) are the products of the plasmid digested with BamHI and HindⅢ, and the fifth lane (-) is the plasmid without digestion as a negative control.
[0189] Construction of the ORFVΔ005-008 deletion strain:
[0190] Transfection, screening and purification:
[0191] Referring to the instruction manual of Lipofiter 3.0 transfection reagent, 5 μg of the recombinant plasmid pUC57-LF_ORF 005-EGFP-RF_ORF 008 was mixed with 250 μL of serum-free DMEM medium to prepare a premix. At the same time, 10 μL of Lipofiter 3.0 transfection reagent was diluted with 250 μL of serum-free DMEM medium and allowed to stand at room temperature for 15 minutes. Then the two were mixed to form a plasmid-liposome complex, and 500 μL was added to each well of the pre-seeded cells. After 6 hours, the wild-type strain of orf virus (ORFV-SY17) was inoculated into OFTu cells grown to about 80% confluence at a multiplicity of infection of MOI = 0.1. After 2 hours, DMEM culture medium containing 2% fetal bovine serum was added, and the cells were placed in an incubator at 37 °C and 5% CO2 for continued culture.
[0192] After 72 hours, the infection of the recombinant virus was observed under an inverted fluorescence microscope. For the areas where the cells became round and showed green fluorescence (suspected of carrying the recombinant virus with EGFP fluorescence label), they were marked and scraped, and repeatedly frozen and thawed three times as the spare material for the next screening. The virus solution with green fluorescence label was collected, repeatedly frozen and thawed three times, centrifuged at 4°C and 1000 r / min for 10 minutes, and then inoculated into a 96-well plate pre-coated with OFTu cells by the limited dilution method for screening. The fluorescent lesion cells were observed and scraped under a fluorescence inverted microscope, and repeatedly frozen and thawed three times, and screened 6 - 8 rounds by the limited dilution method. The screened fluorescent virus was inoculated into a 12-well plate. During this period, 1% - 1.5% low melting point agarose was prepared and sterilized in a vertical autoclave. The 2×DMEM culture medium containing 2% fetal bovine serum and 2% penicillin / streptomycin was preheated to 37°C and mixed with 1% - 1.5% low melting point agarose for plaque screening. The screening process was repeated 2 - 3 times, and the results were as Figure 16 shown.
[0193] Identification:
[0194] The genomes of ORFV-SY17 wild strain and ORFVΔ005-008 were extracted, and PCR amplification was carried out using the identification primers synthesized by Sangon Biotech Co., Ltd. The primer sequences are shown in the following table. The PCR reaction system was configured as follows: 1 μL of genomic DNA template, 12.5 μL of PrimeSTAR Max Premix (2×), 1 μL of F primer, 1 μL of R primer, and 9.5 μL of ddH2O, with a total volume of 25 μL. The PCR reaction conditions were set as follows: pre-denaturation at 98°C for 15 seconds, annealing at 55 - 62°C for 20 seconds, extension at 72°C for 35 seconds, and a total of 34 cycles were carried out. After the PCR amplification was completed, the products were separated by 1% agarose gel electrophoresis, and observed and photographed using a Gel Image System gel imager. The target bands were recovered from the gel and sent to Sangon Biotech Co., Ltd. for sequencing to confirm the correct ORFVΔ005-008 gene deletion sequence. Among them, the nucleotide sequence of the F primer is shown in SEQ ID NO: 28, and the nucleotide sequence of the R primer is shown in SEQ ID NO: 29.
[0195] Example 9
[0196] Example 9 detected the neutralizing antibodies in the blood of B16 tumor-bearing mice treated with ORFV (orf virus).
[0197] The blood of B16 tumor-bearing mice treated with ORFV (orf virus) was collected. After standing overnight at 4°C, the serum was separated and inactivated at 56°C for 30 minutes. Figure 23The neutralizing antibody detection process is shown as follows. In the experimental preparation stage (Day 0), OFTu cells are seeded in a 96-well plate at a density of 1.2×10 4 cells / well. In the infection stage (Day 1), after diluting the serum sample to be tested (Sreum) 1:8, it is mixed with the reporter viruses in a volume ratio of 1:1. The serum-virus mixture is added to the 96-well plate pre-seeded with cells and incubated overnight at 37°C in a 5% CO2 incubator for 24 hours. The virus infection is detected by fluorescence after infection. The experiment sets up a Ctrl group, a serum group (Sreum), a reporter virus group (Virus), and a serum + reporter virus group (Sreum+Virus). The Ctrl group only adds cell culture medium, the serum group adds the serum isolated from mouse blood, the virus group adds the ORFV virus with the reporter gene EGFP, and the serum + reporter virus group adds serum and virus according to the neutralizing antibody detection process. The final volumes of the Ctrl group, the serum group, the reporter virus group, and the serum + reporter virus group should be kept consistent, and the volume can be adjusted by adding an appropriate amount of cell culture medium. Figure 24 The first row is the Ctrl group, the second row is the serum group (Sreum), the third row is the reporter virus group (Virus), and the fourth row is the serum + reporter virus group (Sreum+Virus). The results show that the neutralizing antibodies in the serum of mice treated with ORFV fail to completely inhibit the virus infection, indicating that although the antibodies in the serum have certain neutralizing ability, they are not sufficient to completely block the infectivity of the virus.
[0198] The above embodiments are only examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.
Claims
1. A novel recombinant orf virus, characterized in that, The recombinant orf virus expresses CXC chemokine ligand 9, namely CXCL9.
2. The recombinant orf virus according to claim 1, characterized in that, The recombinant orf virus is the strain ORFVΔ005-008 with the deletion of ORFV ORFs 005-008 genes, and the deleted fragment is the nucleotide fragment shown in SEQ ID NO:
1.
3. The recombinant orf virus according to claim 2, wherein, The CXCL9 gene expressed by the recombinant orf virus is one of murine, human, and feline sources.
4. The recombinant orf virus according to claim 3, wherein, The CXCL9 expressed by the recombinant orf virus is mCXCL9, and its amino acid sequence is shown in SEQ ID NO:
2.
5. The recombinant orf virus according to claim 3, wherein, The CXCL9 expressed by the recombinant orf virus is hCXCL9, and its amino acid sequence is shown in SEQ ID NO:
3.
6. The recombinant orf virus according to claim 3, wherein, The CXCL9 expressed by the recombinant orf virus is fCXCL9, and its amino acid sequence is shown in SEQ ID NO:
4.
7. The recombinant orf virus according to any one of claims 1-6, characterized in that, The recombinant orf virus is the ORFV SY17 strain.
8. The preparation method of the recombinant orf virus according to any one of claims 1-7, characterized in that, The wild-type orf virus ORFs 005-008 genes are deleted, and the Cxcl9 gene is inserted at the deletion position of the orf virus ORFs 005-008 genes to obtain the recombinant orf virus ORFVΔ-Cxcl9.
9. Use of the recombinant orf virus according to any one of claims 1-7 in the preparation of an anti-tumor drug.