Sugarcane ShERF1b gene, protein and application

By screening and cloning the sugarcane ShERF1b gene, constructing its overexpression and gene editing vector, analyzing its sugar accumulation mechanism in sugarcane, solving the in-depth analysis of the molecular network of sugarcane sugar accumulation, achieving a significant improvement in sugarcane sugar, and promoting the improvement of high-sugar sugarcane varieties.

CN120350031AActive Publication Date: 2025-07-22SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510854643.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-25
Publication Date
2025-07-22
Estimated Expiration
2045-06-25

AI Technical Summary

Technical Problem

The molecular action network of sugar cane sugar accumulation in the prior art lacks systematic in-depth analysis, which makes it difficult to achieve the improvement of high-sugar sugar cane varieties.

Method used

ShERF1b, a transcription factor gene specifically upregulated in the mature stem nodes of sugar cane, was selected, and its full-length gene was cloned and overexpression and gene editing vector was constructed. Through genetic transformation of sugar cane, the molecular action pathways and networks that regulate sugar cane in vivo were analyzed.

Benefits of technology

It provides theoretical basis and genetic resources for the improvement of high-sugar sugar cane varieties, significantly improves the sugar accumulation ability of sugar cane, and enhances the economic value and bioenergy potential of sugar cane.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350031A_ABST
    Figure CN120350031A_ABST
Patent Text Reader

Abstract

The invention provides a sugarcane ShERF1b gene, a protein and application, belongs to the technical field of biology, and particularly discloses application of the sugarcane ShERF1b gene in improving sugar accumulation. According to the invention, a potential key regulation transcription factor gene ShERF1b for specific up-regulation expression and sugar accumulation regulation in mature stem nodes of sugarcane is screened out, a ShERF1b full-length gene in cultivated sugarcane is cloned, overexpression and gene editing vectors of the gene are respectively constructed, genetic transformation of cultivated sugarcane is carried out, gene functions of the gene in regulation of sugar accumulation in sugarcane are analyzed, and the application of the gene in regulation of sugar accumulation in sugarcane is realized. Meanwhile, downstream action target genes of the ShERF1b are separated by utilizing a co-immunoprecipitation technology, molecular action ways and networks of the ShERF1b for regulating and controlling the sugar accumulation of the cane are analyzed, the molecular mechanism of the ShERF1b for regulating and controlling the sugar accumulation of the cane is preliminarily clarified, and a theoretical basis and gene resources are provided for the variety improvement of the high-sugar cane.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to plant transgenic biotechnology breeding, and particularly relates to a sugarcane ShERF1b gene, protein and application. Background Art

[0002] The sugar content of sugarcane is one of the key factors determining the quality and economic value of sugarcane. In the sugar industry production, sugarcane varieties with high sugar content can effectively improve the sugar production efficiency and reduce the production cost, which is of crucial significance for ensuring the sugar supply and enhancing the economic benefits of the sugar industry. At the same time, high-sugar sugarcane varieties also have potential application value in the energy field and are important raw material sources for the development of the bioenergy industry.

[0003] To analyze the molecular mechanism of sugar accumulation in sugarcane, many researchers have screened out some candidate genes that play important regulatory roles in the process of sugar accumulation in sugarcane through methods such as differential expression analysis and gene co-expression network analysis. These genes include some transcription factor genes, such as transcription factors related to hormone signal transduction and transcription factors involved in light signal regulation, which play a key role in regulating the expression of genes related to sugar accumulation in sugarcane. Although certain progress has been made in the research on sugar accumulation in sugarcane and the screening of key genes, there is still a lack of systematic and in-depth analysis of the molecular interaction network of sugar accumulation in sugarcane. Summary of the Invention

[0004] In view of the above problems, the present invention provides a sugarcane ShERF1b gene, protein and application.

[0005] A sugarcane ShERF1b gene, the coding sequence of the ShERF1b gene is SEQ ID NO: 1; the ShERF1b gene is related to the sugar accumulation ability.

[0006] A sugarcane ShERF1b protein, the ShERF1b protein is the protein encoded by the above ShERF1b gene, and its amino acid sequence is as shown in SEQ ID NO: 2.

[0007] A primer pair, the primer pair is used for PCR amplification of the above ShERF1b gene, and the primer pair includes: upstream primer ERF1b-F: GAGCAGAGGCAGAGGCAGAGCAGTA; downstream primer ERF1b-R: GGTAGCACAGCACGGATCAGATTCA.

[0008] A plasmid containing the ShERF1b gene, the containing ShERF1bThe plasmid of the gene is obtained by ligating the above ShERF1b gene to a cloning vector (such as plasmid pCAMBIA1300, etc.).

[0009] A recombinant vector containing ShERF1b the gene, the recombinant vector containing ShERF1b the gene (such as plant expression vector pCAMBIA3300-ERF1b-FLAG, gene editing vector CBP-ZmUBI-Cas9-ERF1b, etc.) is obtained by ligating the PCR amplification product containing ShERF1b the gene to the vector; alternatively, using a plasmid as the basic backbone of the experimental vector, two target sites ERF-T1 and ERF-T2 are designed through online software and driven by an independent U6-2 promoter, and then assembled into the insertion fragment "Promotor-target-SgRNA" by the method of Over lap PCR, and the assembled insertion fragments of the two targets are inserted into the backbone vector by Infusion seamless ligation technology to obtain; The ShERF1b coding sequence of the gene is shown in SEQ ID NO: 1.

[0010] A strain containing ShERF1b the gene, the strain containing ShERF1b the gene is Agrobacterium containing ShERF1b the gene or Escherichia coli containing ShERF1b the gene.

[0011] An application of the above ShERF1b gene in improving the sugar accumulation ability, the application is to use the ShERF1b gene for sugarcane to improve the sugar accumulation ability; The ShERF1b coding sequence of the gene is shown in SEQ ID NO: 1.

[0012] Furthermore, the application is to overexpress the ShERF1b gene to improve the sugar accumulation ability.

[0013] A plant breeding method for improving the sugar accumulation ability is to overexpress the ShERF1b gene in sugarcane to obtain sugarcane with high sugar accumulation ability; The ShERF1b coding sequence of the gene is shown in SEQ ID NO: 1.

[0014] A planting method for improving the sugar accumulation ability is to plant ShERF1b gene overexpressing plants to improve the sugar accumulation ability; The ShERF1bThe coding sequence of the gene is shown in SEQ ID NO: 1.

[0015] A kind of sugarcane of the present invention ShERF1b The beneficial effects of the gene, protein and application of the present invention are as follows: Based on the transcriptome analysis of the molecular action network of sugar accumulation in the stems of tropical sugarcane species and screening of key candidate genes for sugar accumulation, in order to further analyze the molecular mechanism of sugar accumulation in the stems of cultivated sugarcane species, a potentially key regulatory transcription factor gene that is specifically up-regulated and involved in the regulation of sugar accumulation in mature sugarcane nodes was screened ShERF1b , and the full-length gene in cultivated sugarcane was cloned ShERF1b . Overexpression and gene editing vectors were constructed respectively, and cultivated sugarcane was genetically transformed to analyze the gene function of regulating sugar accumulation in sugarcane. At the same time, immunoprecipitation technology was used to isolate its downstream target genes, and the molecular action pathway and network of regulating sugar accumulation in sugarcane were analyzed, and the molecular mechanism of regulating sugar accumulation in sugarcane was preliminarily clarified ShERF1b , providing a theoretical basis and gene resources for the improvement of high-sugar sugarcane varieties. Brief Description of the Drawings

[0016] Figure 1 shows the amplification results of the full-length sequences in different sugarcane varieties in Example 1 of the present invention ShERF1b ; Figure 2 shows the conserved DNA domain of ShERF1b in sugarcane in Example 1 of the present invention Figure 3 shows the analysis of the amino acid sequence conservation of ShERF1b in different sugarcanes in Example 1 of the present invention Figure 4 shows the phylogenetic tree of the ERF1b amino acid sequences in different plant species in Example 1 of the present invention Figure 5 shows the analysis of the expression pattern of the ShERF1b gene in different tissue parts of sugarcane in Example 2 of the present invention Figure 6 shows in Example 3 of the present invention ShERF1b1 and ShERF1b2 schematic diagram of the GFP fusion vector; Figure 7 shows the subcellular localization analysis of ShERF1b in sugarcane protoplast cells in Example 3 of the present invention Figure 8 shows the enzyme digestion verification of the pCAMBIA3300-ShERF1b overexpression vector in Example 4 of the present invention; among them, the left band is Marker, the middle is the pCAMBIA3300-ShERF1b overexpression vector, and the right is the pCAMBIA3300 plant expression vector; Figure 9It is the PCR detection result of positive clones of Agrobacterium transformed with pCAMBIA3300-ShERF1b in Example 4 of the present invention. Among them, the leftmost is Marker, and the 9 bands on the right are all Agrobacterium strains transformed with the pCAMBIA3300-ShERF1b overexpression vector; Figure 10 It is the restriction enzyme digestion verification diagram of the ShERF1b gene editing vector in Example 4 of the present invention. Among them, the left band is Marker, and the right is the CBP-ZmUBI-Cas9-ERF1b gene editing vector; Figure 11 It is the PCR detection result of positive clones of Agrobacterium transformed with the ShERF1b gene editing vector in Example 4 of the present invention. Among them, the leftmost is Marker, and the 24 bands on the right are all Agrobacterium strains transformed with the CBP-ZmUBI-Cas9-ERF1b gene editing vector; Figure 12 It is a part in Example 4 of the present invention ShERF1b-Flag Genetic transformation of sugarcane with fusion genes; Figure 13 It is a part in Example 4 of the present invention ShERF1b-Flag PCR detection results of the integration of Bar gene and target fragment in some transgenic herbicide-resistant positive plants in Example 4 of the present invention. Among them, the upper figure is the detection result of the Bar gene, and the lower figure is the PCR detection result of the integration of the target fragment. M in both the upper and lower figures represents Marker, CK+ represents the vector plasmid as the template, CK- represents the non-transgenic plant DNA as the template, H2O represents the blank control as the template, and 1-19 represent 19 ShERF1b-Flag Transgenic herbicide-resistant positive plants; Figure 14 It is the PCR positive of CPB-ERF-Cas9 in Example 4 of the present invention ShERF1b PCR detection results of the integration of the Bar gene and genome in gene-edited sugarcane. Among them, the upper figure is the detection result of the Bar gene, and the lower figure is the PCR detection result of the integration of the target fragment. M in both the upper and lower figures represents Marker, CK+ represents the vector plasmid as the template, CK- represents the non-transgenic plant DNA as the template, H2O represents the blank control as the template, and 1-10 represent 10 ShERF1b Gene-edited sugarcane; Figure 15 It is in Example 4 of the present invention ShERF1b-FLAG In sugarcane ShERF1b Expression level analysis; among them, CK represents non-transgenic sugarcane, and F2, F8, and F10 are the corresponding Figure 13 Three lines numbered 2, 8, and 10 respectively; Figure 16 In Example 4 of the present invention ShERF1b-FLAG Statistical data of plant heights of transgenic sugarcane lines and ShERF1b mutant plants with gene mutations; among them, the left figure is a comparison chart of sugarcane plant heights; the right figure is a statistical chart of plant height data; Figure 17 In Example 4 of the present invention ShERF1b-FLAG Statistical data of stem diameters of transgenic sugarcane lines and ShERF1b mutant plants with gene mutations; among them, the left figure is a comparison chart of sugarcane stem diameters; the right figure is a statistical chart of stem diameter data; Figure 18 In Example 4 of the present invention ShERF1b-FLAG Statistical data of the number of effective stems of transgenic sugarcane lines and ShERF1b mutant plants with gene mutations; Figure 19 In Example 4 of the present invention ShERF1b-FLAG Statistical data of the Bx of the cane juice of transgenic sugarcane lines and ShERF1b mutant plants with gene mutations; Figures 16 - 19 Among them, CK represents non-transgenic sugarcane, and OE, OE1 to OE3 all represent ShERF1b-FLAG transgenic sugarcane lines; GE, GE1 to GE3 all represent ShERF1b mutant plants with gene mutations. Detailed implementation manners

[0017] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments for the understanding of those skilled in the art.

[0018] Plant materials: Sugarcane varieties LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, wild sugarcane YN82-114, FN094095 were planted in the Haikou campus of the Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences.

[0019] Example 1 Sugarcane ShERF1b Cloning of the full-length gene sequence and bioinformatics analysis I. Sugarcane ShERF1b Cloning of the full-length gene sequence Transcriptome sequencing analysis was performed on the low-sugar culm segments of the tropical variety Badila (Jun-Gang, Wang, Ting-Ting, et al. Culm transcriptome sequencing of Badila (Saccharum officinarum L.) and analysis of major genes involved in sucrose accumulation. [J]. Plant physiology and biochemistry : PPB, 2019, 144:455-465), and ERF1b partial known gene sequences were obtained. By searching the genome databases of Saccharum spontaneum AP85-441 and ROC22, ShERF1b the full-length genome sequences were found. ShERF1b The coding sequence of the gene is SEQ ID NO: 1. Through sequence analysis, ShERF1b there are no introns in the genomic sequence. Therefore, PCR amplification was performed using sugarcane leaf genomic DNA as a template. Primers for amplifying the full-length gene were designed with Primer 5, including: forward primer ERF1b-F: GAGCAGAGGCAGAGGCAGAGCAGTA and reverse primer ERF1b-R: GGTAGCACAGCACGGATCAGATTCA. ShERF1b

[0020] Total DNA of young leaves of sugarcane varieties LA, SP80, Badila, Co285, Kassoer, Cheribon, POJ2878, EK28, ROC22, 1202, 1301, 1305, Saccharum spontaneum YN82-114, and FN094095 was extracted by the CTAB method. Using the total DNA of these sugarcane varieties as templates, ShERF1b PCR amplification of the full-length sequence was carried out. The PCR amplification system is as follows: Table 1 PCR amplification system

[0021] PCR amplification program: 95°C for 7 min; 95°C for 40 s, 60°C for 40 s, 72°C for 1 min, for 35 cycles; extension at 72°C for 10 min. The obtained PCR amplification products were subjected to 1% agarose gel electrophoresis, the gel was cut and recovered, and then ligated to the pMD19-T vector (to obtain ShERF1b -pMD19T plasmid), and sent to Sangon Biotech Co., Ltd. for sequencing.

[0022] II. Sugarcane ShERF1b Bioinformatics analysis of the sugarcane ​The sequenced obtained sequence was analyzed for the reading frame and the amino acid sequence of the encoded protein using the Open Reading Frame Finder software on the NCBI website. The amino acid sequence is SEQ ID NO: 2. BLAST search was performed using BLASTP on the NCBI website to obtain ShERF1b conserved domains; DNAMAN 8.0 was used for comparative analysis of homologous sequences of ShERF1b in different sugarcane varieties and related species such as sorghum and maize, and the conserved DNA-binding domain of ShERF1b was obtained; MEGA-X software was used to construct the phylogenetic tree of ERF1b in different plant species.

[0023] Based on the partial Sub - ShERF1b sequences obtained from transcriptome sequencing and combined with sugarcane genome data, primers were designed to amplify the ShERF1b full-length DNA sequences (see Figure 1 ), and it was found that there were differences in sequence lengths among different varieties and within the same variety (see Table 2). ShERF1b Table 2 Statistical information on the coding sequences of ShERF1b in different sugarcane varieties

[0024]

[0025] Homologous alignment of the ShERF1b amino acid sequence revealed that ShERF1b belongs to the AP2 superfamily and has a conserved AP2 DNA-binding domain of 70 amino acids (see Figure 2 ); homologous alignment of the ShERF1b amino acid sequences in different varieties showed that the homology reached 97.02%. The AP2 DNA-binding conserved domain was located at positions 147 - 216, and the sequence differences mainly existed at positions 81, 112, and 223 (see Figure 3 ).

[0026] A phylogenetic tree was constructed for the ShERF1b protein sequences in different sugarcane cultivars, primitive species, and different plant species. The results showed that the ShERF1b of cultivar ROC22 had the highest homology with the ERF1b of cultivar Zhongzhe 1, high homology with the ERF1b of sugarcane tropical species, Saccharum spontaneum, and Erianthus fulvus, and close genetic relationship with the ERF1b of gramineous crops such as maize, wheat, and rice, and they were grouped together into a large category, while the ERF1b from dicotyledonous plants such as Arabidopsis thaliana was grouped into another category (see Figure 4 ). These research results indicate that in the genus Saccharum ShERF1bGenes have high homology, close genetic relationships, and similar functions.

[0027] Example 2 In sugarcane ShERF1b Analysis of gene tissue expression patterns Take 100 mg of tissues such as young leaves, mature leaves, old leaves, stem nodes at different parts, and roots of the cultivated sugarcane variety ROC22 at the tillering stage, jointing stage, and maturity stage, and grind them into powder with liquid nitrogen. Use a plant total RNA extraction kit (Omega) to extract total RNA, and use the DNase in the kit to digest genomic DNA. The extracted RNA was reverse transcribed into cDNA using the Fermentas cDNA first-strand synthesis kit. The reaction system is as follows: Table 3 Reaction system for reverse transcription synthesis of cDNA - I

[0028] The reaction conditions were: 65°C for 5 min, cooled on ice. Based on Table 3, continue to add the substances in Table 4 for reaction.

[0029] Table 4 Reaction system for reverse transcription synthesis of cDNA - II

[0030] 42°C for 60 min, terminate the reaction at 70°C for 5 min, and store at -20°C for later use.

[0031] The obtained products were detected by Q-PCR, among which ShERF1b Expression detection primers: ERF1b-RTF: AGAATTCAAACAGCTCCCCG; ERF1b-RTR: TGCTGGAACTGGAAGGATGA. Internal reference gene expression detection primers: GADPH-F: CACGGCCACTGGAAGCA; GADPH-R: TCCTCAGGGTTCCTGATGCC. The Q-PCR amplification system is: Table 5 Q-PCR amplification system

[0032] Q-PCR amplification program: 95°C for 3 min; 95°C for 10 s, 58°C for 30 s, 72°C for 30 s; 40 cycles. After amplification, the ct values of the internal reference gene and the target gene were obtained respectively, and the relative expression level of the target gene was calculated by method, and the results are shown in Figure 5 , it can be seen that in sugarcane plants at the tillering stage, ShERF1b is mainly expressed in tissues with active growth in meristematic tissue areas such as shoot tips, tiller buds, and roots, indicating that it plays an important role in the early rapid growth and development of sugarcane; in sugarcane plants at the jointing stage, ShERF1bIt is mainly expressed in the shoot apex and may play an important role in the elongation of sugarcane stem internodes; in mature sugarcane plants, ShERF1b It is highly expressed in the shoot apex, sugar-rapidly accumulating stem internodes 6 - 7, mature stem internodes 12 - 13, and roots, indicating that it may be involved in regulating the sugar accumulation process in sugarcane stems.

[0033] Example 3 Subcellular Localization Analysis of the Protein Encoded by Sugarcane ShERF1b Gene 1) Construction of ShERF1b-GFP Fusion Vector At both ends of the ShERF1b -1, ShERF1b -2 open reading frame sequences of ROC22 sugarcane, NcoI and SpeI restriction enzyme sites were added respectively, the stop codon was deleted, and protection bases were added before the enzyme digestion sites, as shown below:

[0034] Using ShERF1b -pMD19T plasmid as a template, PCR amplification was carried out. The amplification system and PCR reaction program are as follows: Table 6 PCR Amplification Reaction System

[0035] The PCR reaction program was: 98 °C for 7 min, 98 °C for 40 s, 60 °C for 40 s, 72 °C for 1 min, 30 cycles, and 72 °C for 15 min.

[0036] After the obtained PCR amplification products were subjected to agarose gel electrophoresis respectively, the gel was cut and recovered. The recovery steps were carried out according to the instructions of the Magen gel recovery kit. Then, the gel recovery fragments and pCAMBIA1302 plasmid were double digested with restriction enzymes NcoI and SpeI respectively. The enzyme digestion reaction system is as follows: Table 7 Enzyme Digestion Reaction System

[0037] The double-digested vector and the target ShERF1b fragment were respectively subjected to gel electrophoresis again and gel recovery. The recovered fragments were measured with a nucleic acid concentration detector, and the concentration ratio of the fragment to the vector was calculated. T4 ligase (Thermo Fisher: EL0014) was used for ligation. The ligation system is as follows: Table 8 Ligation System

[0038] At 25 °C, ligate for 1 hour. Respectively take 10.0 μL of the ligation product for transformation, DH5α Escherichia coli competent cells (Vidy No: DL1001S).

[0039] The positive colonies were verified by PCR respectively, plasmids were extracted, the recombinant plasmids were verified by restriction digestion, and then sent to the company for sequencing. The pCAMBIA1302-ERF1b-1-GFP and pCAMBIA1302-ERF1b-2-GFP fusion vectors were obtained, as Figure 6 shown. Among them, the restriction digestion identification system is as follows: Table 9 Restriction digestion identification system

[0040] 2) Subcellular localization of ShERF1b-GFP fusion protein Rice seedlings grown for one to two weeks were taken, the young leaves and stems were continuously shredded, and rice protoplast cells were extracted according to the method of Yoo et al. (Yoo et al. (2007). Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nature Protocol, 2(7), 1565-1572.). The pCAMBIA1302-ERF1b-1-GFP and pCAMBIA1302-ERF1b-2-GFP fusion plasmids were transfected into the protoplast cells for transient expression, observed and photographed by a laser confocal microscope (Nikon C2-ER), and the pictures were combined with Photoshop software.

[0041] To clarify the action site of ShERF1b in sugarcane cells, the present invention used seamless cloning technology to clone the ShERF1b - 1 , ShERF1b - 2 reading frame from ROC22 sugarcane and integrated it into the N-terminus of GFP in the pCAMBIA1302 vector. Further, the ShERF1b - 1 - GFP , ShERF1b - 2 - GFP fusion vectors were transiently expressed in protoplasts. The results showed that ShERF1b - 1 - GFP , ShERF1b - 2 - GFP the fusion proteins were all localized in the nuclear region (see Figure 7 ), indicating that ShERF1b is a nuclear localization protein and may be involved in the regulation of gene expression in sugarcane cells.

[0042] Example 4 Sugarcane ShERF1b Regulating sugar accumulation in sugarcane 1) ShERF1b Construction of overexpression plant expression vector First, we synthesized the 3×Flag nucleic acid sequence using gene synthesis technology, and further used seamless cloning and ligation technology to ShERF1b - FLAGThe fusion sequence was inserted into the pCAMBIA3300 plant expression vector framework driven by the Ubi promoter. After double digestion verification with BamHⅠ and SacⅠ, it was confirmed that the target fragment had been completely inserted into pCAMBIA3300 (see Figure 8 ). The constructed vector pCAMBIA3300-ShERF1b was transferred into the Agrobacterium strain EHA105 by the "freeze-thaw method" and verified by colony PCR. The PCR results showed that the target vector plasmid had been transferred into the Agrobacterium strain EHA105 (see Figure 9 ), as follows: According to the same construction method in Example 3, first, 3×FLAG and nuclear localization NLS sequences were added to the 5' end of the ORF sequence by PCR amplification, and 3×His tags were added to the 3' end. BamHⅠ and SacⅠ restriction enzyme sites were added to both ends of the tagged ShERF1b reading frame sequence. The reading frame sequence was integrated into the pCAMBIA3300 plant expression vector containing the downstream of the Ubi promoter by restriction enzyme digestion and ligation. The primers for adding restriction enzyme sites were: ERF1b-OEF: 5′-GGGGATCCATGGTGAGCAGCACCTC-3′, ERF1b-OER: 5′-GGGAGCTCTCAGATGGAGTGGCTCCGGCA-3. The PCR products with added restriction enzyme sites and the vector were digested with double enzymes, ligated and transformed, and the inserted fragments of the positive clones were verified by sequencing. The ligated vector with correct sequencing was verified by double enzyme digestion, and the pCAMBIA3300-ERF1b-FLAG plant expression vector was successfully constructed. The constructed vector plasmid was transferred into the Agrobacterium strain EHA105 by the "freeze-thaw method" for the next genetic transformation.

[0043] 2) ShERF1b Construction of gene editing plant expression vector Using the plasmid CPB-ZmUbi-ShCas9 as the basic backbone for constructing the experimental vector, two target sites ERF-T1 and ERF-T2 were designed by online software and driven by independent U6-2 promoters respectively. Then, the assembled insert fragment "Promotor-target-SgRNA" was assembled by the Overlap PCR method. The assembled insert fragments of the two targets were inserted into the backbone vector by the Infusion seamless ligation technology, and the gene editing vector was constructed. After verification by single digestion with HindⅢ, it was confirmed that the target fragment had been successfully integrated into the vector CPB-ZmUbi-ShCas9, and the CBP-ZmUBI-Cas9-ERF1b gene editing vector was obtained ( Figure 10 ). It was introduced into Agrobacterium EHA105 by the "freeze-thaw method", and it was verified by PCR detection that the target vector plasmid had been successfully transferred into the Agrobacterium strain EHA105 ( Figure 11), as follows: According to the gene editing principle of CRISPR / Cas9 technology, first, CCTop was used to select conserved sgRNA sites in the genome, CRISPRater was used to analyze the secondary structure of sgRNA, and CRISPR efficiency predictor was used to analyze the site-targeted editing efficiency of sgRNA. The designed sgRNA sequence was driven by the maize ZmU6-2 promoter, and the nucleic acid sequence of the cassette expressing sgRNA driven by ZmU6-2 was directly synthesized by Nanjing Genscript Corporation. Then, the target fragment was integrated into the CBP-ZmUBI-Cas9 vector containing Cas9 by homologous recombination. The correctness of the integrated target sequence was confirmed by sequencing, and the construction of the CBP-ZmUBI-Cas9-ERF1b gene editing vector was completed. The constructed ShERF1b gene editing vector plasmid was transferred into the Agrobacterium strain EHA105 by the "freeze-thaw method" for the next genetic transformation.

[0044] 3) ShERF1b Genetic transformation of overexpression and gene editing vectors in sugarcane The young leaves at the shoot tips of sugarcane ROC22 were used as explants. The round slices were cut and induced to form embryogenic callus on MS medium containing 2,4-D. The granular embryogenic callus was collected and co-transformed with Agrobacterium containing the ShERF1b overexpression vector and Agrobacterium containing the ShERF1b gene editing vector. The transformed callus was placed on a proliferation medium containing PPT for screening. The callus granules with strong vitality after screening were placed on a differentiation medium to differentiate into seedlings. The robust plants grown from differentiation were subjected to rooting culture, and finally 30 ShERF1b - Flag transgenic resistant positive seedlings of sugarcane with fusion vectors ( Figure 12 ) and 15 transgenic resistant positive seedlings of CPB-ERF-Cas9 sugarcane were obtained, as follows: (1) Selection and treatment of sugarcane materials The sugarcane variety ROC22 was used as the genetic transformation receptor material. Healthy plants without diseases and insects were selected, and the outer old leaves were removed layer by layer. The young leaves about 12 cm away from the growth point of the sugarcane shoot tip were selected as the explants for inducing callus tissue culture. The selected explants were placed in 75% alcohol and soaked for 5 - 8 min, then placed in 0.1% mercuric chloride and soaked for 8 - 10 min. After disinfection, they were washed 2 - 3 times with sterile ddH2O and dried. The outermost leaf sheath of the explant was peeled off, and then it was cut transversely into thin slices about 0.2 - 0.5 mm thick and placed on the M1 solid medium. It was cultured in the dark at 22 °C for 15 - 20 d, and the medium was changed for subculture until embryogenic callus grew. The embryogenic callus with stronger vitality was selected as the material for genetic transformation.

[0045] (2)Activation of Agrobacterium strains containing plant expression vectors The Agrobacterium strains carrying the pCAMBIA3300-ERF1b-FLAG and CBP-ZmUBI-Cas9-ERF1b vectors were streaked on YEP solid medium containing rifampicin, streptomycin, and kanamycin triple antibiotics, and cultured in an inverted position at 28 °C for 2 days. The corresponding monoclonal colonies were picked and inoculated into YEP liquid containing triple antibiotics, and cultured at 28 °C and 225 rpm for 12 - 16 h. The obtained bacterial liquid was respectively placed in 80 mL of YEP liquid medium containing triple antibiotics, and cultured at 28 °C and 230 rpm until the OD 600 reached 0.4 - 0.6. The obtained bacterial liquid was transferred to a new sterile centrifuge tube, centrifuged at 4 °C and 4000 rpm for 5 min, the supernatant was poured out, the remaining culture medium was aspirated, and 120 mL of MR liquid medium (AS 150 μmol / L) was added to resuspend the cells, and cultured at 28 °C and 200 rpm for 2 h, and then the corresponding Agrobacterium transformation infection liquid was obtained.

[0046] (3)Agrobacterium-mediated infection of sugarcane embryogenic callus Select the embryogenic callus with good growth in the sugarcane callus, transfer it to a sterilized filter paper to dry. Transfer the above sugarcane callus into the Agrobacterium infection liquid and place it for 30 min. Filter out the above infection liquid, and place the callus with Agrobacterium on a sterile filter paper to dry. The dried infected callus was placed on MS solid medium and cultured in the dark at 22 °C for 5 days. After dark culture, the tissue was washed once with sterile water containing 200 mg / L kanamycin, then washed 2 - 4 times with sterile water without kanamycin, and washed once with liquid MS, and placed on a sterilized filter paper to dry with a ladle. After drying, it was placed on M2 solid medium containing 200 mg / L kanamycin, and cultured in a constant temperature incubator at 28 °C under light for about three weeks until the embryogenic callus slowly differentiated into green seedlings.

[0047] (4)PPT screening of Agrobacterium-transformed plants The small seedlings differentiated from the callus were transferred to a screening medium containing PPT and cultured for about 20 days. At this time, the PPT screening concentration was about 2.0 mg / L. During this process, the medium needed to be changed in a timely manner until the transformed seedlings were screened out.

[0048] (5)Rooting culture and acclimatization of resistant seedlings The screened resistant plants were transferred to M3 solid medium for rooting culture. After the roots of the seedlings grew completely, they were taken out of the medium, washed clean, the old leaves were removed, and after disinfection, they were transplanted into crystal mud, marked, acclimatized for one week, and then planted in flower pots after growing strong.

[0049] 4) ShERF1bPCR Detection of Integrated Fragments and Positive Detection of bar Gene-encoded Protein Expression in Overexpressing and Gene-edited Plants The ShERF1b - Flag positive transgenic resistant seedlings of the fusion vector sugarcane and the CPB-ERF-Cas9 transgenic sugarcane resistant seedlings in tissue culture bottles were uncapped and acclimatized for one week, then transplanted into crystal mud to adapt to the bacteria-containing growth environment. When their root systems grew stably, they were transplanted into plug trays for cultivation. At the same time, the obtained CPB-ERF-Cas9 transgenic sugarcane resistant seedlings were planted in plug trays for cultivation. When the seedlings in the plug trays had more leaves, young leaves were taken for genomic DNA extraction, and then the screening marker Bar gene primers and the Ubi promoter were used in combination with ShERF1b sequence primers for PCR detection of the integrated fragments of the Bar gene and ShERF1b - Flag sugarcane genome. The results showed that among 30 ShERF1b - Flag transgenic herbicide-resistant positive plants, 18 ShERF1b overexpressing plants with positive PCR detection of the bar gene ( Figure 12 ), ShERF1b - Flag 17 positive gene integration lines ( Figure 13 ), bar plants with positive gene PCR detection and ShERF1b - Flag positive genes were named ShERF1b - FLAG sugarcane; at the same time, 10 bar plants with positive gene PCR detection and positive CPB-ERF-Cas9 PCR were obtained from 15 resistant seedlings ShERF1b gene-edited sugarcane ( Figure 14 ), as follows: When the seedlings planted in plug trays had 3 - 4 leaves, 0.1 g of young leaves were taken and ground into powder with liquid nitrogen, and the total DNA of the leaves was extracted by the CTAB method. The extracted DNA was used as a detection template and diluted 10 times before use.

[0050] (1) First, detect the integration of the herbicide-resistant bar gene in transgenic plants. bar gene detection primers: Bar409-F: CGAGACAAGCACGGTCAACT; Bar409-R: CTGCCAGAAACCCACGTCAT. ShERF1b The PCR detection primers for overexpressing plants were set in the Ubi promoter region for the upstream primer and in the ShERF1b reading frame region for the downstream primer: ERF1b-OEF: GGCGGTCGTTCATTCGTTC; ERF1b-OER: TGCCATTATTCGCCTCTGCT. For ShERF1bIntegrity detection of the CRISPR region in gene-edited plants. Detection primers: CRISPR-F: GCAAGGCGATTAAGTTGGGT; CRISPR-R: AGACATGCAATGCTCATTATCTC. Among them, the PCR reaction system is as follows: Table 10 PCR reaction system

[0051] PCR reaction amplification program: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; extension at 72°C for 5 min. The PCR reaction amplification products were subjected to 1% agarose gel electrophoresis, the gel was cut and recovered, and sent to Sangon Biotech Co., Ltd. for sequencing verification.

[0052] For ShERF1b Overexpression and gene-edited plants were first subjected to bar gene integration PCR detection, and then using the DNA of the transformed plants successfully transferred with Bar genes as a template, overexpression and gene-edited fragment integration detection was carried out to determine the integrity of the integrated fragment region, and bar overexpression and gene-edited plants positive for gene PCR detection were obtained. ShERF1b

[0053] 5) ShERF1b Expression level detection in overexpressed transgenic sugarcane plants ShERF1b Take Figure 13 0.1 g of young leaves from the three plant lines numbered 2, 8, and 10 in , cut them into pieces, grind them into powder with liquid nitrogen, extract total RNA using the plant total RNA extraction kit from Omega, and digest genomic DNA with the DNase provided in the kit. Reverse transcribe to synthesize cDNA using the cDNA first-strand synthesis kit from Fermentas, ShERF1b The specific method for expression detection is the same as that in Example 2. The results showed that the ShERF1b genes in the leaves of the three sugarcane plant lines were all significantly up-regulated, indicating that ShERF1b - FLAG genes in sugarcane ShERF1b were all overexpressed, and transgenic sugarcane lines with overexpression at the transcriptional level were successfully obtained ShERF1b ShERF1b-FLAG ( Figure 15 ).

[0054] 6) ShERF1b Analysis of mutant types in gene-edited plants ShERF1bThe analysis of the mutation situation of the target sites in gene-edited sugarcane plants is mainly detected by the Hi-TOM sequencing technology. The Hi-TOM method only requires two steps of ordinary PCR to complete the construction of a multiplexed sequencing library. After obtaining the sequencing data, just upload the sequencing data to the Hi-TOM online analysis website (http: / / www.hi-tom.net / hi-tom / ) to parse and obtain the detailed mutation sequences and corresponding genotype information for each site of each sample.

[0055] (1) PCR amplification of target sites According to the conventional PCR primer design principle, the target site is 10 - 100 bp away from the left and right primers, and the total amplification length generally does not exceed 300 bp. Linker sequences are added to both the forward and reverse primers. The specific primers for the target band are named as Fx: ggagtgagtacggtgtgcACCCRTCATCCTTCCAGTTCC / Rx: gagttggatgctggatggTGTCCAGCAGCGCCATYTC. The primers need to be verified for their specificity before proceeding to the next step. Use the primers for conventional PCR amplification, and take 3 - 5 μL of the PCR product for electrophoresis detection. (When using a 96-well plate, be sure to remember the well position corresponding to each sample for correspondence with the sequencing results). Use Taq polymerase for PCR amplification, and the PCR reaction system is as follows: Table 11 PCR reaction system

[0056] The PCR reaction program is: Table 12 PCR reaction program

[0057] (2) Second-round PCR Add sequences of F1 - F12, RA - RH (adapter sequences for well positioning of each sample) to both ends of the sequence, as well as the HiTom - 2PF / 2PR common sequencing sequences. 20 primers such as HiTom - F1~F12, HiTom - RA~RH (original concentration 10 μM) need to be diluted 50 times for use. Add 5 μL of the corresponding F primer, 5 μL of the R primer, and 90 μL of ddH2O to each well. Mix well, centrifuge, cover the lid, and store at 4°C for use. The use concentration of HiTom - 2PF / 2PR is 10 μM and does not need to be diluted. The specific sequences of the above primers are shown in Table 13.

[0058] Table 13 Primer sequence table for Hi - TOM sequencing

[0059] The PCR reaction system is: Table 14 PCR reaction system

[0060] For HiTom-F1~F12 and HiTom-RA~RH, use a multi-channel pipette to aspirate 2 μL of the diluted mixture and add it to the corresponding wells. For the first-round PCR products, also use a multi-channel pipette to aspirate 1 μL and add it to the 96-well plate for the second-round PCR according to the sample arrangement order recorded in the first-round PCR. The PCR reaction program is as follows: Table 15 PCR reaction program

[0061] (3) Electrophoresis detection Aspirate 3 μL of the second-round PCR product from each well and perform 1% agarose gel electrophoresis to verify the size of the amplified target band.

[0062] (4) Mixing samples and gel extraction for sequencing Mix all the remaining second-round products of each 96-well plate into a 2 mL centrifuge tube, pipette and mix well. Aspirate 50 μL of the mixtures from different 96-well plates of different genes and mix them together, then perform agarose gel electrophoresis and then gel extraction. The extraction concentration should not be less than 200 ng / μL and the volume should not be less than 20 μL. Number the gel extraction products and send them for sequencing.

[0063] (5) Result analysis Log in and download the file compressed package according to the link provided by the sequencing company. Upload the compressed package to the website (http: / / www.hi-tom.net / hi-tom / ) for data analysis. Analyze the mutation types of the edited sites according to the reference data. Among them, SNP refers to base substitution, I refers to base insertion, D refers to base deletion, and large Indel refers to large fragment insertion. The numbers in front of I and D represent the number of inserted or deleted bases. Find the corresponding samples with deletions, insertions, or large fragment insertions, and then compare them with the reference sequence. Finally, find the plants with insertions, deletions, or large fragment insertions at the target site.

[0064] By extraction ShERF1bGenomic DNA in the leaves of gene-edited sugarcane was used to design primer pairs for PCR amplification of two target site sequences, and Hi-TOM high-throughput sequencing was performed. The research results showed that in the first edited target site sequence, deletion mutations mainly occurred, including 1bp, 3bp, 4bp, 20bp, 25bp and large fragment base deletions (Delet, D) mutations, and there was also a 1bp insertion (Insert, I) mutation type; in the second edited target site sequence, insertion mutations were the main type, mainly 6bp and 12bp insertion mutations, and there was also a 6bp deletion mutation; among them, the GE1 mutant line ShERF1b had a 100% mutation rate, and the mutation rates of the GE2 and GE3 mutant lines of ShERF1b were 90% (Table 16); it was shown that gene mutations were successfully achieved in gene-edited sugarcane of ShERF1b ShERF1b gene mutations, and ShERF1b gene mutant plants were obtained.

[0065] Table 16 ShERF1b Analysis of target site mutation types in gene-edited plants

[0066] 7) ShERF1b Determination of agronomic traits of overexpressed and gene-edited transgenic sugarcane in the field The ShERF1b-FLAG sugarcane transgenic lines and ShERF1b gene mutant plant seedlings were planted in the transgenic plant experimental field. After growing for one year and maturing, in the second year, the main stem and tiller plant bud-bearing stem segments were taken for replanting and propagation for phenotypic analysis and field trait statistics.

[0067] When the transgenic plants grown in flowerpots had more stem joints, the bud-bearing stem joints were cut into sections and planted in the field in small plots, with one small plot every 5 meters. At the jointing stage, when the sugarcane had not lodged, the plant height, stem diameter and number of effective stems of the sugarcane were measured. The plant height was measured with a tape measure from the base of the sugarcane to the leaf bifurcation; the stem diameter was measured with a vernier caliper at the 13-15th joints in the middle of the stem; the number of effective stems was the total number of effective stems in each small plot. At the maturity stage, the juice of about 13-15th joints in the middle of the sugarcane stem was extracted with a cone and dropped on a refractometer, and the reading on the refractometer was taken to obtain the refractometer data of the control, overexpressed and gene-edited plants. The measurement data were statistically plotted using Origin software.

[0068] By observing and measuring the field phenotypes of sugarcane transgenic lines and ShERF1b-FLAG gene mutant plants that had tillered after growing for 5 months, the plant height, stem diameter, tiller number and other yield trait-related indicators of transgenic sugarcane plants of different lines were measured respectively. The results showed that ShERF1b sugarcane transgenic lines (abbreviation ShERF1b-FLAG is ShERF1b-OE) The plant height is higher than the control, ShERF1b The plant of the gene mutation mutant (abbreviation ShERF1b-GE ) The plant height is significantly lower than the control ( Figure 16 ); ShERF1b-OE There is no difference in the stem diameter of the plant line compared with the control, ShERF1b-GE The stem diameter of the plant line is significantly lower than the control ( Figure 17 ); In terms of the number of effective stems, ShERF1b-OE All plant lines are higher than the control, ShERF1b-GE The plant line is significantly lower than the control ( Figure 18 ); Measure the Bx of the cane juice in the sugarcane plants at the mature stage ShERF1b-OE , and the results show that ShERF1b Overexpression significantly increases the Bx of sugarcane cane juice ( Figure 19 ), and these research results show that ShERF1b is the key gene regulating sugar accumulation and yield formation in sugarcane.

[0069] 8) ShERF1b Analysis of the expression of candidate target genes in the sugar-accumulating internodes of overexpressed and gene-edited sugarcane plants Respectively take the sugar-accumulating internode tissues of overexpressed, ShERF1b gene-edited and control sugarcane plants at the late jointing stage ShERF1b for second-generation transcriptome sequencing. After assembly, the transcript data of these tissues are obtained, and the ShERF1b downstream candidate target genes screened by ChIP-seq ShERF1b in the overexpressed and gene-edited sugarcane stalks ShERF1b are statistically analyzed to determine the

[0070] The parts not described in detail otherwise are all prior art. Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of the embodiments. Those of ordinary skill in the art can also obtain other embodiments according to this embodiment without creative work, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A kind of sugarcane ShERF1b gene, characterized in that The said ShERF1b The coding sequence of the gene is SEQ ID NO: 1; The said ShERF1b gene is positively correlated with the sugar accumulation ability.

2. A sugarcane ShERF1b protein, characterized in that, The ShERF1b protein is the one described in claim 1 ShERF1b protein encoded by the gene, and its amino acid sequence is shown in SEQ ID NO:

2.

3. A primer pair, characterized in that, The primer pair is used for PCR amplification of the ShERF1b gene recited in claim 1, and the primer pair comprises: Forward primer ERF1b-F: GAGCAGAGGCAGAGGCAGAGCAGTA; Reverse primer ERF1b-R: GGTAGCACAGCACGGATCAGATTCA.

4. A plasmid containing ShERF1b a gene, characterized in that The said inclusion ShERF1b The plasmid containing the ShERF1b gene is obtained by ligating the gene described in claim 1 to a cloning vector.

5. A recombinant vector comprising ShERF1b a gene, characterized in that The said inclusion ShERF1b The recombinant vector containing the ShERF1b gene is obtained by ligating the PCR amplification product containing the ShERF1b gene with the vector; alternatively, using a plasmid as the basic backbone for constructing the experimental vector, two target sites, ERF-T1 and ERF-T2, are designed through online software and driven by independent U6-2 promoters, and then assembled into the insertion fragment "Promotor-target-SgRNA" by the method of Overlap PCR. The assembled insertion fragments of the two targets are inserted into the backbone vector to obtain; The said ShERF1b The coding sequence of the gene is shown in SEQ ID NO:

1.

6. A strain containing ShERF1b a gene, characterized in that The strain containing ShERF1b the gene is Agrobacterium containing ShERF1b the gene or Escherichia coli containing ShERF1b the gene.

7. Use of the gene according to claim 1 in enhancing the ability of sugar accumulation, characterized in that, ShERF1b The application is to ShERF1b use genes in sugarcane to improve the ability of sugar accumulation; ​ The said ShERF1b The coding sequence of the gene is shown as SEQ ID NO:

1.

8. The application according to claim 7, wherein, The application is overexpression ShERF1b of genes to improve the sugar accumulation ability.

9. A plant breeding method for improving the sugar accumulation ability, characterized in that, The described plant breeding method is to perform ShERF1b gene overexpression on sugarcane to obtain sugarcane with high sugar accumulation ability; The said ShERF1b The coding sequence of the gene is shown in SEQ ID NO:

1.

10. A planting method for improving the sugar accumulation ability, characterized in that, The planting method is to plant ShERF1b plants with overexpressed genes to improve the sugar accumulation ability; The said ShERF1b The coding sequence of the gene is shown as SEQ ID NO: 1.

Citation Information

Patent Citations

  • Gene for encoding sweet potato ERF (ethylene responsive factor) transcription factor

    CN105671058A

  • Application of multi-effect gene SbSnf4 to improving sugar yield, plant height, fresh stem weight and / or juice amount of cane sugar

    CN112592392A

  • Sugarcane ethylene response transcription factor ShERF3 and application thereof

    CN115724936A

  • Method for detecting ethylene response transcription factor of sugarcane and application of method

    CN117305424A