Application of OsCDPK28 gene in rice disease-resistant breeding

Abstract

The invention discloses application of an OsCDPK28 gene in rice disease-resistant breeding, and belongs to the technical field of molecular biology. According to the invention, a calcium-dependent protein kinase induced by magnaporthe oryzae is identified, and the calcium-dependent protein kinase is named as OsCDPK28. Experiments show that the expression quantity of the OsCDPK28 protein and the encoding gene thereof OsCDPK28 is closely related to the development of rice blast. The rice OsCDPK28 gene overexpression and gene knockout plants are constructed, disease resistance analysis is performed on the rice OsCDPK28 gene overexpression and gene knockout plants, results show that the OsCDPK28 gene knockout remarkably improves the resistance level of rice to rice blast, it is indicated that OsCDPK28 negatively regulates the disease resistance of the plants, the encoding gene OsCDPK28 can serve as a target gene to be used for improving the disease resistance of the plants, and the application of the OsCDPK28 gene to the rice blast resistance is achieved. The method has a good application prospect in cultivation of disease-resistant rice varieties, and lays an important foundation for rice resistance breeding.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and particularly to the application of the OsCDPK28 gene in rice disease-resistant breeding. Background Art

[0002] As the most destructive fungal disease of rice, rice blast seriously threatens global rice production. Although the current prevention and control mode relying on chemical pesticides can achieve short-term effects, long-term use is likely to trigger the evolution of pathogen drug resistance and lead to environmental risks such as soil microecological imbalance. In contrast, cultivating disease-resistant varieties, as a core prevention and control strategy with both environmental friendliness and economic benefits, can not only reduce the application of pesticides, but also is the key breakthrough for building a green prevention and control system and promoting the sustainable development of agriculture.

[0003] Currently, the cultivation of disease-resistant rice varieties faces two core bottlenecks: one is the lack of known disease-resistant gene resources, and most major resistance genes have become ineffective due to the rapid evolution of pathogens; the other is that existing disease-resistant materials are often accompanied by the deterioration of agronomic traits, making it difficult to coordinately improve traits such as resistance, yield, and quality. These limiting factors have slowed down the progress of disease-resistant breeding, and there is an urgent need for breakthrough gene resources and breeding strategies.

[0004] Based on this, by systematically mining rice disease-resistant genetic genes to break through the technical bottleneck of the lack of existing resistance gene resources, it not only provides new molecular breeding targets for the prevention and control of rice blast and other fungi, but also lays a theoretical foundation and technical reserve for cultivating a new generation of high-quality and multi-resistant rice varieties. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of the OsCDPK28 gene in rice disease-resistant breeding to solve the problems existing in the above-mentioned prior art. The present invention proves that OsCDPK28 negatively regulates the disease resistance of plants, and its coding gene OsCDPK28 can be used as a target gene to improve the disease resistance of plants, and has good application prospects in cultivating disease-resistant rice varieties, laying an important foundation for rice resistance breeding.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides the application of the OsCDPK28 gene or its related biological materials in regulating the resistance of rice to rice blast. Increasing the expression level of the OsCDPK28 gene reduces the resistance of the rice to rice blast; decreasing the expression level of the OsCDPK28 gene increases the resistance of the rice to rice blast; the CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.3.

[0008] Optionally, the related biological material includes the protein encoded by the OsCDPK28 gene, a recombinant expression vector related to the OsCDPK28 gene, or a recombinant microorganism.

[0009] Optionally, the amino acid sequence of the protein is as shown in SEQ ID NO.4.

[0010] Optionally, reducing the expression level of the OsCDPK28 gene includes knocking out the OsCDPK28 gene.

[0011] The present invention also provides a method for improving the blast resistance of rice, including the step of reducing the expression level of the OsCDPK28 gene in the rice; the CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.3.

[0012] Optionally, reducing the expression level of the OsCDPK28 gene includes knocking out the OsCDPK28 gene.

[0013] The present invention also provides the application of the OsCDPK28 gene or its related biological material in cultivating rice varieties resistant to blast, and the CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.3.

[0014] Optionally, the related biological material includes the protein encoded by the OsCDPK28 gene, a recombinant expression vector related to the OsCDPK28 gene, or a recombinant microorganism.

[0015] Optionally, the recombinant expression vector or recombinant microorganism related to the OsCDPK28 gene includes a recombinant expression vector or recombinant microorganism that knocks out the OsCDPK28 gene.

[0016] The present invention discloses the following technical effects:

[0017] The present invention identified a calcium-dependent protein kinase induced by Magnaporthe oryzae and named it OsCDPK28. Experiments showed that the expression levels of the OsCDPK28 protein and its encoding gene OsCDPK28 were closely related to the development of rice blast. By constructing overexpression and gene knockout plants of the rice OsCDPK28 gene and analyzing their disease resistance, the results showed that knocking out the OsCDPK28 gene significantly improved the blast resistance level of rice, indicating that OsCDPK28 negatively regulates plant disease resistance, and its encoding gene OsCDPK28 can be used as a target gene to improve plant disease resistance and has good application prospects in cultivating disease-resistant rice varieties, laying an important foundation for rice resistance breeding. Description of the Drawings

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0019] Figure 1 Representative leaf pictures and statistical result graphs of puncture inoculation and spray inoculation for the control, OsCDPK28 knockout plants, and OsCDPK28 overexpression plants; A is a representative lesion picture of the leaves of three-week-old Kitaake, oscdpk28-1, oscdpk28-2, OsCDPK28OE-1, and OsCDPK28OE-2 plants at 5 days after puncture inoculation with Magnaporthe oryzae (physiological race Zhong10-8-14), and the scale bar is 1 cm; C is a representative lesion picture of the leaves of three-week-old Kitaake, oscdpk28-1, oscdpk28-2, OsCDPK28OE-1, and OsCDPK28OE-2 plants at 5 days after spray inoculation with Magnaporthe oryzae (physiological race Zhong10-8-14), and the scale bar is 1 cm; B is the statistical result of the lesion length of the leaves of plants with puncture inoculation (mean ± SD, n≥18), and D is the statistical result of the lesion number of the leaves of plants with spray inoculation (mean ± SD, n≥14). The asterisks above the bar graphs indicate significant differences (* indicates 0.01 < P < 0.05; ** indicates P < 0.01). Detailed implementation manners

[0020] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0022] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although only preferred methods and materials are described in this invention, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0023] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the description of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the description of the present invention are obvious to those skilled in the art. The description and examples of the present invention are merely exemplary.

[0024] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0025] In the study of the rice immune response, a calcium-dependent protein kinase induced by Magnaporthe oryzae was identified, and its encoding gene was named OsCDPK28. OsCDPK28 plays an important role in plants' response to abiotic stresses. Therefore, previous studies on OsCDPK28 focused on its regulation of ABA response and cold stress. Whether OsCDPK28 can regulate rice resistance to rice blast has not been reported. This invention attempts to study the effect of the OsCDPK28 gene on rice blast resistance, and knockout plants and overexpression plants of OsCDPK28 were constructed in rice, respectively. The results showed that the OsCDPK28 knockout plants were more resistant to rice blast, while the OsCDPK28 overexpression plants were more susceptible to rice blast, indicating that OsCDPK28 negatively regulates rice resistance to rice blast and can be used as a target gene for molecular breeding to improve plant disease resistance. The technical solutions of this invention are specifically demonstrated below in combination with specific examples.

[0026] In this invention, the biological materials used and their source information are as follows:

[0027] The rice variety Kitaake has been publicly reported in "Wang Kang. Mechanism analysis and breeding application evaluation of rice transcription factor OsMYB3 regulating rice blast resistance [D]. Sichuan Agricultural University, 2019.". The rice variety Nipponbare (O. sativa L. spp. japonica, var Nipponbare, AA genome, Nip) belongs to the japonica subspecies and is recorded in "Rice Variety 'Nipponbare', Agricultural Science and Technology Communication, 1973(02):31".

[0028] The rice varieties Nipponbare (Nip) and Kitaake were provided by Professor Chen Xuewei of the State Key Laboratory of Sichuan Agricultural University.

[0029] The OsCDPK28 knockout and overexpression transgenic rice were completed by Boyuan Biotechnology Company.

[0030] The plant binary expression vector pYLCRISPR / Cas9Pubi-H was provided by Associate Professor Tang Yongyan of the State Key Laboratory of Sichuan Agricultural University and was published in the literature "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants[J]. Molecular Plant, 2015, 8(8): 1274-1284".

[0031] The plant binary expression vector pCAMBIA2300-3×HA was provided by Professor Wang Wenming of the State Key Laboratory of Sichuan Agricultural University and was published in the literature "Golovinomyces cichoracearum effector-associated nuclear localization of RPW8.2 amplifies its expression to boost immunity in Arabidopsis[J]. New Phytologist, 2023, 238(1): 367-382".

[0032] The tested Magnaporthe oryzae pathogen was the spore of the physiological race Zhong10-8-14 Magnaporthe oryzae, which was published in the literature "A single transcription factor promotes both yield and immunity in rice[J]. Science, 2018, 361(6406): 1026-1028.".

[0033] Total RNA extraction kit: TRIzol purchased from Invitrogen, USA, with the product number 15596026.

[0034] Reverse transcription kit: HiScript III RT SuperMix for qPCR(+gDNA wiper) purchased from Vazyme, China, with the product number R323-01.

[0035] Homologous recombination kit: ClonExpress II One Step Cloning Kit purchased from Vazyme, China, with the product number C112-01.

[0036] Example 1 Rice calcium-dependent protein kinase gene OsCDPK28 and its cloning

[0037] A calcium-dependent protein kinase OsCDPK28 was screened in rice. According to the rice Nip genomic reference gene sequence, primers were designed to clone the gene encoding the calcium-dependent protein kinase OsCDPK28. The primers are as follows:

[0038] OsCDPK28-F: ATGCAGCCTGACCCGCAGCC, SEQ ID NO.1;

[0039] OsCDPK28-R: TCAGTTTTCGTTGGGTTTCA, SEQ ID NO.2.

[0040] Total RNA was extracted from rice Kitaake and reverse transcribed to obtain total cDNA. Using the obtained total cDNA as a template, a DNA band of about 1.5 kb was amplified by the above primers. After sequencing, it was confirmed to belong to the OsCDPK28 gene of the calcium-dependent protein kinase. The sequencing results of the amplification product are as follows:

[0041] CDS sequence (SEQ ID NO.3) of the OsCDPK28 gene of the calcium-dependent protein kinase:

[0042]

[0043] Amino acid sequence of calcium-dependent protein kinase OsCDPK28 (SEQ ID NO.4):

[0044] MQPDPQPHGRGREKAAGAGPRLPPPVTAPSVGRPASVLPHKTANVRDHYRIGKKLGQGQFGTTYLCVGKPDGGEYACKSIPKRKLLCREDYEDVWREIQIMHHLSEHPNVVRIRGAYEDALFVHIVMELCAGGELFDRIVAKGHYTERAAALLIRTIVGVVEGCHSLGVMHRDLKPENFLFASTAEDAPLKATDFGLSVFYKPGDKFSDVVGSPYYVAPEVLQKIYGPEADVWSAGVILYILLCGVPPFWAETESGIFRQILRGKLDLESDPWPSISDSAKDLVRNMLIRDPTKRFTAHEVLCHPWIVDDAVAPDKPIDSAVLSRLKHFSAMNKLKKMALRVIAESLSEEEIGGLKELFKMIDTDNSGTITYDELKNGLKRVGSDLMEPEIQALMDAADIDNSGTIDYGEFLAATLHMNKLEREENLVSAFTFFDKDGSGFITIDELSQACEQFGLSDVHLEDMIKDVDQNNDGQIDYSEFAAMMRKGNAGGANAGGVTSTGGTGRRTMRNSLRVNLGDILKPNEN*。

[0045] Example 2 Construction of OsCDPK28 knockout plants

[0046] OsCDPK28 knockout vector pYLCRISPR / Cas9Pubi-H-sgRNA OsCDPK28

[0047] Using the genome of rice Nip as a template, the designed knockout target sequence is: GCTCATCAGGACCATCGTCG (SEQ ID NO.5).

[0048] Synthesize the following primers:

[0049] F: TGTG GCTCATCAGGACCATCGTCGG , SEQ ID NO.6;

[0050] R: AAAACCGACGATGGTCCTGATGAGC, SEQ ID NO.7.

[0051] After denaturation at 95°C, the above primers annealed to form DNA double strands. The pYLCRISPR / Cas9Pubi-H vector was digested with BsaI, and the linearized vector was recovered. The above DNA double strands and the linearized vector were mixed, and a T4 DNA ligase ligation reaction was carried out and incubated at room temperature for 30 minutes to obtain pYLCRISPR / Cas9Pubi-H-sgRNA OsCDPK28 knockout vector. The ligation system was: 1 μL of DNA double-strand fragment, 1 μL of linearized vector, 1 μL of T4 ligase, 1 μL of T4 ligase buffer, 6 μL of ddH2O, with a total volume of 10 μL.

[0052] The obtained pYLCRISPR / Cas9Pubi-H-sgRNA OsCDPK28 knockout vector was transformed into DH5α competent cells. After screening with kanamycin, single colonies were picked for colony PCR identification. After the positive colonies were used to extract plasmids and the sequencing was correct, pYLCRISPR / Cas9Pubi-H-sgRNA OsCDPK28 was confirmed to be correct. It was handed over to Boyuan Biotechnology Company for genetic transformation of rice, and finally two OsCDPK28 knockout transgenic rice plants: oscdpk28-1 and oscdpk28-2 were obtained.

[0053] Example 3 Construction of OsCDPK28 Overexpressing Plants

[0054] Total RNA from the rice Nip genome was reverse transcribed to obtain cDNA. Using the cDNA as a template, the OsCDPK28 gene was cloned. The cloning primers were:

[0055] F: GACAGGGTACCCGGGGATCC ATGCAGCCTGACCCGCAGCC , SEQ ID NO.8;

[0056] R: TCGTATGGGTAAAGCTGTCGACtGTTTTCGTTGGGTTTCAAGA, SEQ ID NO.9.

[0057] The PCR reaction was carried out on a PE9600 type PCR instrument. The program was pre-denaturation at 94°C for 2 min; then denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, for a total of 30 - 32 cycles; then extension at 72°C for 10 min; and storage at 4°C. The full-length cDNA of OsCDPK28 was obtained by PCR amplification. The pCAMBIA2300 - 3×HA vector was digested with Kpn1 and SalI double enzymes, and the linearized vector was recovered. The above PCR-recovered product, the full-length cDNA of OsCDPK28, and the linearized vector were mixed according to the following system (2 μL of DNA fragment, 2 μL of linearized vector, 2 μL of 5×CE II Buffer, 1 μL of Exnase II, and 3 μL of ddH2O, with a total volume of 10 μL), and reacted at 37°C for 30 min for homologous recombination to obtain the pCAMBIA2300 - OsCDPK28 - 3×HA recombinant vector.

[0058] The pCAMBIA2300 - OsCDPK28 - 3×HA recombinant vector was transformed into DH5α competent cells. After screening with G418 resistance, monoclonal colonies were picked for colony PCR identification. After the positive colonies were extracted with plasmids and sequenced correctly, it was confirmed that pCAMBIA2300 - OsCDPK28 - 3×HA was correct. It was handed over to Boyuan Biotechnology Company for genetic transformation of rice, and finally two OsCDPK28 overexpressing transgenic rice plants: OsCDPK28OE - 1 and OsCDPK28OE - 2 were obtained.

[0059] Example 4 Regulation of the OsCDPK28 gene on the blast resistance of rice plants

[0060] The test materials were Kitaake, the OsCDPK28 knockout lines oscdpk28 - 1 and oscdpk28 - 2 with Kitaake as the background and genetic stability, and the OsCDPK28 overexpressing lines OsCDPK28OE - 1 and OsCDPK28OE - 2 with Kitaake as the background and genetic stability.

[0061] Wounding inoculation and spraying inoculation treatments at the seedling stage:

[0062] Select seeds with plump grain shape, put them into a conical flask filled with tap water, and germinate them in a 37°C dark incubator, changing the tap water every day. After 2 days, select the seeds with germinated tips and put them into a 96-well seedling plate. Place the 96-well seedling plate on a floating raft and grow them in Hoagland nutrient solution.

[0063] Wounding inoculation: After 21 days, select the second-to-last rice leaf with consistent growth and size. After wounding, inoculate 5 μL of a concentration of 3×10 5The spores of Zhong10-8-14 rice blast fungus were inoculated at 500 μg / mL, and the length of the lesions was observed and counted after 5 days. The statistical results showed that after the puncture inoculation, the lesion length of oscdpk28-1 and oscdpk28-2 plants in the Kitaake background was significantly reduced and the disease resistance was enhanced compared with Kitaake ( Figure 1 Compared with Kitaake, the lesion length of OsCDPK28OE-1 and OsCDPK28OE-2 plants in the Kitaake background was significantly increased, and the disease resistance of the plants was significantly reduced ( Figure 1 A and B).

[0064] Spray inoculation: 3-week-old rice plants were sprayed with an inoculation concentration of 3×10 5 The number of lesions was observed and counted after 5 days of spray inoculation. The statistical results showed that after spray inoculation, the number of lesions of oscdpk28-1 and oscdpk28-2 plants in Kitaake background was significantly reduced and the disease resistance was enhanced compared with Kitaake ( Figure 1 C and D). Compared with Kitaake, the number of lesions in OsCDPK28OE-1 and OsCDPK28OE-2 plants under Kitaake background increased significantly, and the disease resistance of the plants decreased significantly ( Figure 1 The above results indicate that OsCDPK28 negatively regulates plant disease resistance and its encoding gene OsCDPK28 can be used as a target gene for molecular breeding to improve plant disease resistance.

[0065] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the OsCDPK28 gene or its related biological material in regulating rice resistance to rice blast, characterized in that, Increasing the expression level of the OsCDPK28 gene reduces the resistance of the rice to rice blast; decreasing the expression level of the OsCDPK28 gene increases the resistance of the rice to rice blast; the CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.

3.

2. The application according to claim 1, characterized in that, The related biological materials include the protein encoded by the OsCDPK28 gene, the recombinant expression vector or recombinant microorganism related to the OsCDPK28 gene.

3. The application according to claim 2, characterized in that The amino acid sequence of the protein is as shown in SEQ ID NO.

4.

4. The application according to claim 1, wherein Decreasing the expression level of the OsCDPK28 gene includes knocking out the OsCDPK28 gene.

5. A method for improving the resistance of rice to rice blast, characterized in that, It includes the step of decreasing the expression level of the OsCDPK28 gene in the rice; the CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.

3.

6. The method according to claim 5, characterized in that, Decreasing the expression level of the OsCDPK28 gene includes knocking out the OsCDPK28 gene.

7. Use of the OsCDPK28 gene or its related biological material in cultivating rice varieties resistant to rice blast, characterized in that, The CDS sequence of the OsCDPK28 gene is as shown in SEQ ID NO.

3.

8. The application according to claim 7, characterized in that, The related biological materials include the protein encoded by the OsCDPK28 gene, the recombinant expression vector or recombinant microorganism related to the OsCDPK28 gene.

9. The application according to claim 8, characterized in that, The recombinant expression vector or recombinant microorganism related to the OsCDPK28 gene includes the recombinant expression vector or recombinant microorganism with the OsCDPK28 gene knocked out.

Images