Composition, kit and detection method for specifically amplifying tomicus glabrus

By specifically amplifying the primer set of smooth-spotted beetles under isothermal conditions, DNA amplification is solved, and the problem of fast, simple, high sensitivity and high specific detection of smooth-spotted beetles is achieved, achieving efficient detection in non-laboratory environments.

CN120350134APending Publication Date: 2025-07-22INSPECTION & QUARANTINE TECH CENT OF NINGBO ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510569565.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-04
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The prior art is difficult to detect smooth foot-distance worms quickly, easily, with high sensitivity and high specificity, especially in ports and non-laboratory environments in the field. Traditional morphological identification methods are time-consuming and easy to misjudgment. Molecular biological identification methods require professional equipment, and the attractant monitoring method has poor specificity.

Method used

The composition of specifically amplified smooth-splitting worms, including the primer sets XG-F3-4, XG-B3-4, XG-FIP-4, XG-BIP-4, XG-LF-4, DNA amplification under isothermal conditions through strand displacement reaction and cyclic amplification, and was detected using a simple constant temperature device.

Benefits of technology

It realizes efficient and rapid DNA amplification under isothermal conditions, has higher sensitivity than traditional PCR, has strong specificity, short reaction time, no complex equipment required, and reduces cost and operational complexity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350134A_ABST
    Figure CN120350134A_ABST
Patent Text Reader

Abstract

The invention discloses a composition, a kit and a detection method for specific amplification of smooth foot beetle, the composition comprises a primer group for specific amplification of target DNA fragments of the smooth foot beetle, and the primer group is composed of XG-F3-4, XG-B3-4, XG-FIP-4, XG-BIP-4 and XG-LF-4. The method is used for rapidly detecting the smooth foot distance bark beetles with high sensitivity and high specificity, and is suitable for non-laboratory environments such as ports and fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of insect detection, and particularly relates to a composition, a kit and a detection method for specifically amplifying Ips nitidus. Background Art

[0002] Ips nitidus is an important forest pest. It is tiny in size (body length 2 - 5 mm), and its morphological characteristics are similar to those of related species. Traditional morphological identification methods are prone to misjudgment and time-consuming. Existing detection methods include:

[0003] 1. Morphological identification method: It relies on microscopic observation of the surface characteristics of adults, but the morphologies of related species are similar, making identification difficult.

[0004] 2. Molecular biology identification method (such as PCR): It requires professional equipment and takes a long time (2 - 3 days), and is not suitable for non-laboratory scenarios such as ports.

[0005] 3. Attractant monitoring method: It is easily interfered by the environment and has poor specificity.

[0006] The comparative document CN111187844B discloses a gene barcode detection kit for Tomicus, but it is based on PCR technology and still requires a temperature-changing device. Summary of the Invention

[0007] The purpose of the present invention is to solve the above technical problems, and provide a composition, a kit and a detection method for specifically amplifying Ips nitidus. The present invention is used for quickly, highly sensitively and highly specifically detecting Ips nitidus, and is applicable to non-laboratory environments such as ports and the wild.

[0008] The technical solution adopted by the present invention to solve the above technical problems is: A composition for specifically amplifying Ips nitidus, including a primer set for specifically amplifying the target DNA fragment of Ips nitidus. The primer set consists of XG-F3-4, XG-B3-4, XG-FIP-4, XG-BIP-4, XG-LF-4, and their sequences are as follows: XG-F3-4: TCTTGGAATAATCTACGCCA;

[0009] XG-B3-4: ACAGAGATCTAGGTCTGGC;

[0010] XG-FIP-4:

[0011] GCTCGTGTGTCAACATCTATTCCTA-CTTCTAGGGTTCCTAGTATGG; XG-BIP-4: TATTGCTGTACCAACTGGCATT-GATTTGTGTTCCGTGGTATG; XG-LF-4: GTGAATATGTGATGGGC.

[0012] Preferably, the primer concentration ratio in the primer set is XG-F3-4: XG-B3-4: XG-FIP-4: XG-BIP-4: XG-LF-4 = 1:1:8:8:4.

[0013] A kit for specifically amplifying *Xylosandrus germanus* includes the composition for specifically amplifying *Xylosandrus germanus*.

[0014] Preferably, the kit reaction includes strand displacement reaction, specifically including the following: At the beginning of the reaction, heat is applied to denature and unwind the template DNA; The F3 primer first binds to the F3c region of the template DNA. Under the action of a DNA polymerase with strand displacement activity, DNA synthesis starts from the 3'-end of the F3 primer, extends to the binding region of the FIP primer, synthesizes a new DNA strand, and simultaneously displaces the original complementary strand; On the displaced single-stranded DNA, the F1c region of the FIP primer binds to the F1 region of the template, and the B1c region of the BIP primer binds to the B1 region of the template. Then, starting from these two binding sites, DNA synthesis is carried out under the action of DNA polymerase to form a single-stranded DNA with a dumbbell structure.

[0015] Preferably, it further includes cyclic amplification, specifically including the following: The single-stranded DNA with a dumbbell structure obtained from the strand displacement reaction can be used as the template for subsequent reactions; The F3 primer binds to the F3c region on the template again, triggering a new round of strand displacement synthesis to produce more DNA with a dumbbell structure; At the same time, the loop primer LF can bind to the corresponding loop region on the single-stranded DNA with a dumbbell structure, initiating rapid DNA synthesis to further accelerate the amplification reaction; This cycle repeats to achieve exponential amplification of the target gene.

[0016] A detection method for specifically amplifying *Xylosandrus germanus* includes the following steps:

[0017] Step 1: Extract the DNA of the sample to be tested, mix it with the composition for specifically amplifying *Xylosandrus germanus* and the fluorescence premix, mix well, perform a short centrifugation, and dispense it into PCR tubes.

[0018] Step 2: Amplify the mixture in the PCR tubes obtained in Step 1 at a constant temperature of 63.5 °C for 60 minutes, and monitor the fluorescence signal.

[0019] Step 3: According to the monitoring results in Step 2, if an S-shaped amplification curve appears and the Ct value is less than 25, it is a positive result, that is, it is determined to be *Xylosandrus germanus*; if the amplification curve is flat and there is no Ct value, it is determined to be a negative result, that is, not *Xylosandrus germanus*.

[0020] Preferably, the fluorescence premix includes DNA polymerase, nucleic acid fluorescent dye, dNTPs, Mg + .

[0021] The beneficial effects of the present invention are as follows:

[0022] 1. The present invention can efficiently amplify target DNA under isothermal conditions, and its sensitivity is usually higher than that of traditional polymerase chain reaction (PCR), and it can detect as low as a few copies of target nucleic acid;

[0023] 2. The present invention uses multiple pairs of specific primers to recognize multiple regions on the target DNA, greatly improving the specificity of the reaction;

[0024] 3. The present invention is carried out under isothermal conditions without the need for the temperature change process required by PCR, greatly shortening the reaction time, and can be completed within 30 - 60 minutes;

[0025] 4. The present invention does not require complex instruments and equipment such as PCR instruments, and only needs a simple constant temperature device to carry out the reaction. The operator only needs to add the sample into the reaction tube, then put the tube into the constant temperature device for reaction, and finally read the detection result. The operation process is simple and does not require professional technicians;

[0026] 5. The present invention uses a small reaction system, greatly reducing the usage of samples and reagents, and reducing the detection cost; at the same time, it does not require expensive equipment such as fluorescence quantitative PCR instruments, further reducing the input cost of instruments and equipment; in addition, due to the simple operation of this technology, the labor cost and time cost are reduced. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is a schematic diagram of the principle of strand displacement isothermal amplification.

[0028] Figure 2 is the result diagram of primer screening test (primer set 4 is the best).

[0029] Figure 3 is the result of system optimization test (the Ct value is the smallest when the primer ratio F3:B3:FIP:BIP:LB = 1:1:8:8:4).

[0030] Figure 4 is the result of sensitivity test.

[0031] Figure 5 is the result of specificity test.

[0032] Figure 6 is the result of blind sample detection. DETAILED DESCRIPTION OF THE INVENTION

[0033] The present invention will be further described below in conjunction with the drawings and embodiments.

[0034] The present invention relates to a composition for specifically amplifying Ips nitidus, which comprises a primer set for specifically amplifying a target DNA fragment of Ips nitidus. The primer set consists of XG-F3-4, XG-B3-4, XG-FIP-4, XG-BIP-4, and XG-LF-4, and their sequences are as follows:

[0035] XG-F3-4: TCTTGGAATAATCTACGCCA;

[0036] XG-B3-4: ACAGAGATCTAGGTCTGGC;

[0037] XG-FIP-4:

[0038] GCTCGTGTGTCAACATCTATTCCTA-CTTCTAGGGTTCCTAGTATGG; XG-BIP-4: TATTGCTGTACCAACTGGCATT-GATTTGTGTTCCGTGGTATG; XG-LF-4: GTGAATATGTGATGGGC.

[0039] As Figure 2 shown, the primer screening test is as follows: A total of 5 groups of primers were designed and screened according to the volume ratio of primers: F3:B3:FIP:BIP:LB = 1:1:8:8:4. Each group of primers was screened with the same nucleic acid sample, and 4 replicates were set. On the premise that there is no peak in the negative sample, the primer group with the earliest peak and good repeatability was determined and selected as the optimal primer for subsequent experiments. After screening, the primer group 4 had the lowest Ct value, so the primer group 4 was selected.

[0040] Table 1 Nucleic acid sequence table for primer screening

[0041]

[0042]

[0043] System optimization test: As Figure 3 shown, by optimizing the concentration ratio of primers, as shown in Table 2, the ratio with the earliest peak and better repeatability was selected, and 8 replicates were set. After optimization, when the primer ratio was F3:B3:FIP:BIP:LF = 1:1:8:8:4, the Ct value was the smallest.

[0044] Table 2 Concentration ratio of primers

[0045] Group Primer ratio Ratio Final concentration 1 F3:B3:FIP:BIP:LB 1:1:4:4:4 0.3 μM:0.3 μM:1.2 μM:1.2 μM:1.2 μM 2 F3:B3:FIP:BIP:LB 1:1:6:6:4 0.3 μM:0.3 μM:1.8 μM:1.8 μM:1.2 μM 3 F3:B3:FIP:BIP:LB 1:1:8:8:4 0.3 μM:0.3 μM:2.4 μM:2.4 μM:1.2 μM 4 F3:B3:FIP:BIP:LB 1:1:10:10:4 0.3 μM:0.3 μM:3 μM:3 μM:1.2 μM 5 F3:B3:FIP:BIP:LB 1:1:12:12:4 0.3 μM:0.3 μM:3.6 μM:3.6 μM:1.2 μM

[0046] Sensitivity test: As Figure 4As shown in the figure, the positive plasmid of *Xylosandrus germanus* was diluted by a 10-fold concentration gradient according to Table 3, from 106 copies / μL to 100 copies / μL, with 4 replicates set, to determine the lowest concentration value that could be detected.

[0047] Table 3 Concentration of the positive plasmid of *Xylosandrus germanus*

[0048]

[0049] Specificity test: The specificity test was carried out using *Xylosandrus germanus* and its related species. The sample information is shown in Table 4, with 4 replicates set for each treatment. The public can obtain the above biological materials from the applicant. The obtained above biological materials are only used for repeating the experiments of the present invention and cannot be used for other purposes. As Figure 5 shown, the results showed that: except for *Xylosandrus germanus* (as Figure 5 shown in 1), other related species (as Figure 5 shown in 2) were all negative, indicating that the specificity of this detection method was good.

[0050] Table 4 Sample information table for the specificity test

[0051] Serial number Species Collection date 1 Tomicus laevigatus 2024.5.25 2 Tomicus villosus 2024.5.25 3 Orthotomicus erosus 2024.5.25 4 Ips typographus 2024.5.25 5 Dendroctonus terebrans 2024.5.25 6 Xyleborus saxesenii 2024.5.25

[0052] As Figure 6 shown, the actual blind sample detection was carried out: 4 replicates were set for this test.

[0053] Table 5 Sample information table for the actual blind sample detection

[0054]

[0055] As Figure 1 shown, a kit for specifically amplifying *Xylosandrus germanus* of the present invention includes the composition for specifically amplifying *Xylosandrus germanus*.

[0056] The reaction generated by the kit test includes strand displacement reaction, which specifically includes the following contents: at the beginning of the reaction, heating is used to denature and unwind the template DNA; the F3 primer first binds to the F3c region of the template DNA, and under the action of a DNA polymerase with strand displacement activity, DNA synthesis starts from the 3' end of the F3 primer and extends to the binding region of the FIP primer, synthesizing a new DNA strand and simultaneously displacing the original complementary strand; on the displaced single-stranded DNA, the F1c region of the FIP primer binds to the F1 region of the template, and the B1c region of the BIP primer binds to the B1 region of the template, and then starting from these two binding sites, DNA synthesis is carried out under the action of DNA polymerase to form a single-stranded DNA with a dumbbell structure.

[0057] It also includes loop amplification, specifically including the following: The single-stranded DNA of the dumbbell structure obtained by strand displacement reaction can serve as a template for subsequent reactions; The F3 primer binds to the F3c region on the template again, triggering a new round of strand displacement synthesis, generating more dumbbell-structured DNA; At the same time, the loop primer LF can bind to the corresponding loop region on the single-stranded DNA of the dumbbell structure, initiating rapid DNA synthesis and further accelerating the amplification reaction; This cycle repeats to achieve exponential amplification of the target gene.

[0058] A detection method for specifically amplifying Ips nitidus Eggers includes the following steps:

[0059] Step 1: Extract the DNA of the sample to be tested, mix it with the composition for specifically amplifying Ips nitidus Eggers and the fluorescence premix. The fluorescence premix includes DNA polymerase, nucleic acid fluorescent dye, dNTPs, Mg + , Take 10 μL and mix it evenly with 15 μL of template DNA, centrifuge instantaneously, and dispense it into PCR tubes.

[0060] Step 2: Take 5 μL of the mixture in each PCR tube obtained in Step 1, centrifuge instantaneously and then perform on-machine detection. The temperature of the isothermal amplification detector MA2000E is set to 63.5 °C, and the amplification time is set to 60 minutes. Signal collection is performed once every 1 minute, and the reporter group is set to FAM; In this embodiment, the isothermal amplification detector MA2000E is provided by Ningbo Aigene Technology Co., Ltd.

[0061] Step 3: According to the monitoring results in Step 2, if an S-shaped amplification curve appears and the Ct value is less than 25, it is a positive result, that is, it is determined as Ips nitidus Eggers; If the amplification curve is flat and there is no Ct value, it is determined as a negative result, that is, it is not Ips nitidus Eggers.

[0062] It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

Claims

1. A composition for specifically amplifying Ips nitidus Eggers, characterized in that: A primer set for specifically amplifying the target DNA fragment of *Xylosandrus germanus*, the primer set consists of XG-F3-4, XG-B3-4, XG-FIP-4, XG-BIP-4, XG-LF-4, and their sequences are as follows: XG-F3-4: TCTTGGAATAATCTACGCCA; XG-B3-4: ACAGAGATCTAGGTCTGGC; XG-FIP-4: GCTCGTGTGTCAACATCTATTCCTA-CTTCTAGGGTTCCTAGTATGG; XG-BIP-4: TATTGCTGTACCAACTGGCATT-GATTTGTGTTCCGTGGTATG; XG-LF-4: GTGAATATGTGATGGGC.

2. The composition for specifically amplifying Ips nitidus Eggers according to claim 1, wherein: The primer concentration ratio in the primer set is XG-F3-4: XG-B3-4: XG-FIP-4: XG-BIP-4: XG-LF-4 = 1:1:8:8:

4.

3. A kit for specifically amplifying Ips nitidus Eggers, characterized in that: A composition for specifically amplifying *Xylosandrus germanus* as described in claim 1 or 2.

4. The kit for specifically amplifying Xylosandrus germanus according to claim 3, wherein: The kit reaction includes strand displacement reaction, specifically including the following: At the beginning of the reaction, heat to denature and unwind the template DNA; The F3 primer first binds to the F3c region of the template DNA. Under the action of DNA polymerase with strand displacement activity, DNA synthesis starts from the 3'-end of the F3 primer and extends to the binding region of the FIP primer, synthesizing a new DNA strand and displacing the original complementary strand at the same time; On the displaced single-stranded DNA, the F1c region of the FIP primer binds to the F1 region of the template, and the B1c region of the BIP primer binds to the B1 region of the template. Then, starting from these two binding sites, DNA synthesis is carried out under the action of DNA polymerase to form a single-stranded DNA with a dumbbell structure.

5. The kit for specifically amplifying Ips nitidus Eggers according to claim 4, characterized in that: It also includes cyclic amplification, specifically including the following: The single-stranded DNA with a dumbbell structure obtained from the strand displacement reaction can be used as the template for subsequent reactions; The F3 primer binds to the F3c region on the template again, triggering a new round of strand displacement synthesis, generating more dumbbell-structured DNA; At the same time, the loop primer LF can bind to the corresponding loop region on the single-stranded DNA with a dumbbell structure, initiating rapid DNA synthesis and further accelerating the amplification reaction; Repeating this cycle, exponential amplification of the target gene is achieved.

6. A detection method for specifically amplifying Xylosandrus germanus, characterized in that: Including the following steps: Step 1: Extract the DNA of the sample to be tested, mix it with the composition for specifically amplifying *Xylosandrus germanus* as described in claim 1 or 2 and the fluorescence premix, mix well, perform instantaneous centrifugation, and dispense it into PCR tubes; Step 2: Amplify the mixture in the PCR tubes obtained in Step 1 at a constant temperature of 63.5 °C for 60 minutes and monitor the fluorescence signal.

7. The detection method for specifically amplifying Ips nitidus according to claim 6, wherein: The fluorescent premix includes DNA polymerase, nucleic acid fluorescent dye, dNTPs, Mg + .

Citation Information

Patent Citations

  • A gene barcoding detection kit and method for *Betula* species.

    CN111187844B