SNP (Single Nucleotide Polymorphism) molecular marker related to carcass skin color character of spotted-brown chicken and application of SNP molecular marker
By discovering the T>G mutation of the SNP site intron region of the chicken SCARB2 gene, and designing specific primers for PCR amplification, the high cost and inefficiency problem of chicken carcass skin color selection was solved, and early selection and efficient breeding were achieved.
Patent Information
- Application Number
- CN202510738541.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-06-04
AI Technical Summary
In the prior art, the skin color selection of chicken carcasses depends on post-slaughter determination, which consumes a lot of manpower and costs, and is inefficient, making it difficult to achieve efficient skin color trait breeding.
By discovering the SNP site T>G mutation in the intron region of the SCARB2 gene in chromosome 4, specific amplification primers were designed for PCR amplification, and the skin color traits of the chicken carcass were selected early according to the genotype, and SNP molecular markers were used to assist breeding.
It has achieved early selection of skin color traits in chicken carcass, saved production costs, improved breeding efficiency, and accurately identified skin color traits and promoted genetic progress.
Smart Images

Figure CN120350138A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of genetic breeding, and in particular to a SNP molecular marker associated with the skin color trait of an Ephedra chicken carcass and an application thereof. Background Art
[0002] With the rise of the chilled chicken market, chicken skin color has become a key indicator for measuring meat quality and freshness. Uniform and bright skin color can increase the popularity of chicken, and chickens with yellowish skin color are more popular with consumers. The yellow phenotype of chicken skin is mainly due to the deposition of carotenoids in the body. Carotenoids are a class of 40-carbon lipophilic pigments. The accumulation of carotenoids in the body causes the chicken skin to appear yellow. At present, the selection and breeding of chicken carcass skin color mainly relies on the determination of skin color after slaughter. However, this traditional method is not only labor-intensive and costly, but also cumbersome, which greatly restricts the efficient development of the selection and breeding work. The use of molecular markers is expected to break through this dilemma. By screening molecular markers related to chicken skin color, it is possible to accurately select and breed its skin color traits in the live stage of chickens, which can not only greatly reduce the workload and cost, but also effectively promote the smooth progress of the selection and breeding of chicken skin color traits.
[0003] Scavenger receptors (SRs) are a family of cell surface receptors with complex structures and diverse functions. Studies have shown that SRs family members play an important role in the cellular uptake and transport of carotenoids, especially members of the B subfamily (such as SCARB1 and CD36), which have been widely confirmed to be involved in this process. For example, SCARB1 can significantly promote the cellular uptake of carotenoids and may be a key regulator of carotenoid-based coloration of bird feathers; CD36 also mediates the transport of carotenoids in various tissues. In addition, studies have found that SCARB2 also has the ability to bind and transport carotenoids, and its affinity for macular lutein carotenoids is comparable to that of SCARB1 and CD36. SCARB2 is highly expressed in retinal pigment epithelial cells, and its functional loss leads to a significant reduction in intracellular lutein accumulation, suggesting that it may coordinate with other members of the SRs family to regulate the metabolic distribution of carotenoids.
[0004] However, no studies have reported a direct association between the SCARB2 gene and skin yellowness or other skin color traits. Single nucleotide polymorphism (SNP) molecular markers, as a molecular breeding method for livestock and poultry, can establish a molecular marker-based assisted selection system by analyzing the association mechanism between SNPs of the SCARB2 gene and chicken carcass skin color, providing new ways and methods for the selection of chicken skin color traits. Summary of the invention
[0005] The object of the present invention is to provide an SNP molecular marker related to the skin color trait of the slaughtered body of the partridge chicken and its application, so as to solve the problems existing in the above-mentioned prior art. The molecular marker provided by the present invention can realize the early selection of the skin color trait of the slaughtered body of the chicken, save production costs and accelerate genetic progress.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides an application of an SNP locus related to the skin color trait of the slaughtered body of the partridge chicken in identifying the skin color trait of the slaughtered body of the partridge chicken. The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus. The genotypes of the SNP locus include TT, GG and TG genotypes;
[0008] The skin color trait of the slaughtered body refers to the yellowness values of the skin on the chest, back and legs;
[0009] The yellowness values of the skin on the chest, back and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype.
[0010] The present invention also provides an application of a primer pair for amplifying the gene fragment where the SNP locus related to the skin color trait of the slaughtered body of the partridge chicken is located in identifying the skin color trait of the slaughtered body of the partridge chicken. The primer pair consists of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2;
[0011] The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus. The genotypes of the SNP locus include TT, GG and TG genotypes;
[0012] The skin color trait of the slaughtered body refers to the yellowness values of the skin on the chest, back and legs;
[0013] The yellowness values of the skin on the chest, back and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype.
[0014] The present invention also provides a method for identifying the skin color trait of the slaughtered body of the partridge chicken, including the following steps:
[0015] Using the genomic DNA of the chicken to be tested as a template, performing PCR amplification with the primer pair to obtain an amplification product;
[0016] Sequencing the amplification product, detecting the genotype of the corresponding SNP locus, and judging the skin color trait of the chicken to be tested according to the detected genotype;
[0017] The skin color trait of the slaughtered body refers to the yellowness values of the skin on the chest, back and legs;
[0018] The primer pair is used for amplifying the gene fragment where the SNP locus related to the skin color trait of the slaughtered meat-type yellow chicken carcass, and is composed of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2; the SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus, and the genotypes include TT, GG, and TG genotypes;
[0019] Among them, the yellow color values of the skin on the chest, back, and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype.
[0020] Optionally, the reaction system for the PCR amplification is: 7.5 μL of PCR Mix, 0.3 μL of each of the upstream and downstream primers, 1.5 μL of DNA template, and 5.4 μL of ultrapure water.
[0021] Optionally, the reaction program for the PCR amplification is: pre-denaturation at 95 °C for 3 min; denaturation at 94 °C for 25 s, annealing at 59 °C for 25 s, extension at 72 °C for 1 min, for 34 cycles; final extension at 72 °C for 5 min; preservation at 4 °C.
[0022] The present invention also provides the application of the primer pair for amplifying the gene fragment where the SNP locus related to the skin color trait of the slaughtered meat-type yellow chicken carcass in the breeding of the skin color trait of the slaughtered meat-type yellow chicken carcass. The primer pair is composed of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2;
[0023] The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a C>T mutation at this locus, and the genotypes include CC, TT, and CT genotypes;
[0024] The skin color trait of the carcass refers to the yellow color values of the skin on the chest, back, and legs;
[0025] The yellow color values of the skin on the chest, back, and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype.
[0026] The present invention also provides the application of an SNP locus related to the skin color trait of the slaughtered meat-type yellow chicken carcass in the breeding of the skin color trait of the slaughtered meat-type yellow chicken carcass. The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus, and the genotypes include TT, GG, and TG genotypes;
[0027] The skin color trait of the carcass refers to the yellow color values of the skin on the chest, back, and legs;
[0028] The yellow color values of the skin on the chest, back, and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype.
[0029] The present invention discloses the following technical effects:
[0030] In the intron region of the SCARB2 gene on chicken chromosome 4, the present invention discovered a SNP locus at position 49442841, where there is a T>G mutation. The genotypes include TT, TG, and GG genotypes. By performing an association analysis between this locus and the skin color trait of chicken carcasses, it was found that this locus is significantly correlated with the yellow color values of the skin on the chest, back, and legs. Among them, the yellow color values of the skin on the chest, back, and legs of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype. This indicates that this SNP locus can accurately identify the skin color trait of chicken carcasses and can be used as an important genetic marker for early screening of the skin color trait during chicken breeding.
[0031] The present invention designed and synthesized a pair of specific amplification primers based on this SNP locus for amplifying the gene fragment containing this locus. By determining the genotypes of this SNP locus according to the amplification results, early selection of the skin color trait of chicken carcasses can be carried out, which can save production costs and accelerate genetic progress. This method enables molecular marker-assisted selection to be better applied in chicken breeding and has great economic application value. Description of the Drawings
[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0033] Figure 1 It is a gel electrophoresis diagram of the amplification product. Among them, M is the Marker, and 1-4 are the amplification products of 4 randomly selected samples out of 410 samples.
[0034] Figure 2 It is a genotype typing diagram of the SNP locus of the SCARB2 gene. Detailed Embodiments
[0035] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0036] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0037] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0038] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.
[0039] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0040] Examples
[0041] 1. Animal samples
[0042] The experimental chickens to be tested were pure lines of 77-day-old yellow-feathered chickens (provided by Guangzhou Jiangfeng Industrial Co., Ltd.), with a number of 410, and were fed with corn-soybean meal type feed that meets the international formula standard. Blood was collected at the time of slaughter and stored in 1.5 mL sterile centrifuge tubes containing 2% EDTA anticoagulant, and stored at -80 °C for use as a sample for blood DNA extraction.
[0043] After slaughter, the chickens were de-feathered, and the moisture on the surface of the chicken skin was dried before measurement. The yellowness values of the chest, back, shoulder and leg skin were measured using a color difference meter, and the average value was taken after repeating the measurement 3 times for each part.
[0044] 2. Primer design
[0045] According to the reported chicken SCARB2 gene sequence (Gene ID: 422638), with the reference genome being GRCg7b, primer design was carried out using NCBI Primer-BLAST, and the primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd., Guangzhou Branch;
[0046] The sequences of the upstream primer (F-SCARB2) and the downstream primer (R-SCARB2) are shown as follows (primer sequence 5’→3’):
[0047] F-SCARB2: 5’-TAGGCTGAAATCCCGTGTCG-3’, SEQ ID NO.1;
[0048] R-SCARB2: 5'-GCGGCGCTTTGGATTAGTTG-3', SEQ ID NO.2.
[0049] Perform PCR amplification on the sample to be tested using the above primers (amplification length is 931 bp).
[0050] 3. Extract genomic DNA from the blood of the chicken to be tested
[0051] Genomic DNA of all individuals was extracted according to the instructions of the NRBC Blood DNA Kit (OMEGA, D3571020000E30X009). After detecting the concentration and purity of the extracted DNA, it was stored in a -20°C freezer for subsequent PCR amplification.
[0052] 4. SNP detection and genotyping
[0053] Use the primers designed and synthesized in "2. Primer design" to perform PCR amplification on blood DNA to test the specificity of the primers. The results are as Figure 1 shown. The same unique bright band was obtained in all samples involved in the detection, proving that the designed primers can specifically amplify the chicken SCARB2 gene.
[0054] Using the blood genomic DNA of 410 Shendan chickens as templates, perform PCR amplification of the chicken SCARB2 gene using the above primers following the following reaction system: 7.5 μL of PCR Mix, 0.3 μL of each upstream and downstream primer, 1.5 μL of DNA template, and 5.4 μL of ultrapure water.
[0055] Reaction program: Pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 59°C for 25 s, extension at 72°C for 1 min, 34 cycles; final extension at 72°C for 5 min; store at 4°C.
[0056] The PCR products were sent to Tsingke Biological Company for Sanger sequencing. The sequencing results showed that there was a mutation site g.49442841T>G in the intron 4 sequence of the chicken SCARB2 gene, and the nucleotide sequence of the amplification product was as shown in SEQ ID NO.3.
[0057] SEQ ID NO.3:
[0058] TAGGCTGAAATCCCGTGTCGCCTGGAGAAGGCAGCACCCTGTGTGGAGTGCATCCTGGCCCTTTTCCTCCACTCGCCCCGATCCCCTCGTGCCTCTGCACAGGCACAGGGAAATCTGGGACGTCTCTTTGCATCGTCCCGGTGCCGGTACCTGCCAAAGCTGCCATCCACCCTCCAGCACCTCCCCTGCACAGTGAGGGTTCCCTTAAGTAAATCTGCACTTAGAAGTAGGAGCCAAGAGCTTTTTCCTT K CCTCTCTGGAGTTTAAGAAATTCAGCTTCCCCACCGCAGAAGATCTGTGATGTGCCACGTTTAACTTTCCCGTGTTGCAACTTCTTTCTTTCAGAGCACTGAAGAAGAAAGGTCCCCGCTCATCAGGACATAGTAATAGATCTTCTTAAATACGTGAGCTTGGAGAATAAATCATTAGAGCTTACCTAATGTCAGCTACCACTACCCAGTGTTGTCCACTGTGGAGAAACAGTCGTGTCAAGTGTAACGTTCAAAGATGGAAGAGAATCTGCACTGTCGTCAGGGGAGGAGACTTTTCTTAGCAGCTAAGTTACAACTACAAAACTACATTTTAAAACTGCTCGAGATCCCGCTTTTTTCAGCCCTGCACTCTCTTGTACCTGCACTGACACTCAGAGACGATCATAACCACTTTACCGGTGAAAATAAAATGGCCTGATTCGTTACAGAAACGACGGGTAACATTTGCAAATGGCCTTAGGAGCGTGGGCTGCAAAGAACCCTTGTAGAGATGCAGCAGGTTCCTGCGTCACTCACACACCTGCCGGTTTCCCGTAGCCTCACTGTTGTGGTTTCTGTAAAGTACTGCGCTGCTTACTGCCGGTTTGCACTGACTGTTTGTTATTAAAGTCATCGGTCCTTCCACAGACCGGATCTGTACAACTAATCCAAAGCGCCGC (Note: The bold and underlined position in the sequence is the SNP site, which is located at the 251st position of the sequence shown in SEQ ID NO.3, with a T>G mutation).
[0059] The sequencing results were analyzed for sequence peak diagrams to determine potential SNP sites, and the sequencing data of each sample were aligned for genotyping. The results are as Figure 2 shown. There is a T>G mutation at this site, and the genotypes include CC genotype, TG genotype, and GG genotype.
[0060] After sequencing the amplification products of the genomic DNA of 410 individual Silky fowls, the genotypes of each sequencing result were analyzed. All 410 individuals were successfully genotyped, and then statistical analysis was performed on each genotype to obtain the genotype frequency and allele frequency at this site. The statistical results of the gene and genotype frequencies at this SNP mutation site are shown in Table 1.
[0061] Table 1 Gene and genotype frequencies of the SCARB2 gene mutation site g.49442841T>G
[0062]
[0063] 5. Association analysis between the SCARB2 mutation site and the skin color trait of chicken carcasses
[0064] The SPSS (Version 22.0) software was used to perform an association analysis between the SNPs genotype and the phenotype of the carcass skin color trait based on the mixed linear model. The mixed linear model used is as follows:
[0065] Y = μ + G + S + L + e
[0066] Y: Phenotypic value of the skin yellowness trait, μ: Overall mean, G: Fixed effect of genotype, S: Fixed effect of sex, L: Fixed effect of strain, e: Random residual. The Bonferroni method was used for the correction of multiple comparisons.
[0067] The percentage of phenotypic variance explained (PVE) was calculated using the following formula:
[0068]
[0069] β: Effect value, MAF: Minor allele frequency, se: Standard error, N: Sample size.
[0070] The results of the association analysis are shown in Table 2. The SNP site g.49442841T>G is significantly associated with the skin yellowness values of the chest, back, shoulder, and leg of chickens (P<0.05). The B value represents the yellow-blue color of an object: a positive value indicates yellow, a negative value indicates blue, and the higher the B value, the higher the yellowness. The B values of the chest, back, and leg of individuals with the TT genotype are significantly higher than those of individuals with the TG genotype. This SNP site can be used as an auxiliary selection and molecular genetic breeding marker for improving the skin yellowness of chickens.
[0071] Table 2 Association analysis of the SCARB2 gene mutation site g.49442841T>G with the carcass skin color trait in chickens
[0072]
[0073] Note: Different lowercase letters with the same superscript in the same row indicate significant differences (P<0.05), and the same letters with the same superscript indicate no significant differences. PVE represents the SNP resolution percentage.
[0074] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of an SNP locus related to the skin color trait of the slaughtered body of yellow - brown chickens in identifying the skin color trait of the slaughtered body of yellow - brown chickens, characterized in that, The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus. The genotypes of the SNP locus include TT, GG, and TG genotypes; The carcass skin color trait refers to the yellow color values of the skin on the chest, back, and legs; The yellow color values of the skin on the chest, back, and legs of TT genotype individuals are significantly higher than those of TG genotype individuals.
2. Use of a primer pair for amplifying a gene fragment where an SNP locus related to the skin color trait of the slaughtered meat of yellow chicken is located in the identification of the skin color trait of the slaughtered meat of yellow chicken, characterized in that, The primer pair consists of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2; The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus. The genotypes of the SNP locus include TT, GG, and TG genotypes; The carcass skin color trait refers to the yellow color values of the skin on the chest, back, and legs; The yellow color values of the skin on the chest, back, and legs of TT genotype individuals are significantly higher than those of TG genotype individuals.
3. A method for identifying the skin color trait of the dressed body of yellow - feather chickens, characterized in that, It includes the following steps: Using the genomic DNA of the chicken to be tested as a template, perform PCR amplification with the primer pair to obtain an amplification product; Sequence the amplification product, detect the genotype of the corresponding SNP locus, and judge the carcass skin color trait of the chicken to be tested according to the detected genotype; The carcass skin color trait refers to the yellow color values of the skin on the chest, back, and legs; The primer pair is used to amplify the gene fragment where the SNP locus related to the carcass skin color trait of the partridge chicken is located, and consists of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2; the SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus, and the genotypes include TT, GG, and TG genotypes; Among them, the yellow color values of the skin on the chest, back, and legs of TT genotype individuals are significantly higher than those of TG genotype individuals.
4. The method according to claim 3, wherein The reaction system for the PCR amplification is: 7.5 μL of PCR Mix, 0.3 μL of each of the upstream and downstream primers, 1.5 μL of DNA template, and 5.4 μL of ultrapure water.
5. The method according to claim 3, wherein The reaction program for the PCR amplification is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 s, annealing at 59°C for 25 s, extension at 72°C for 1 min, 34 cycles; final extension at 72°C for 5 min; preservation at 4°C.
6. Use of a primer pair for amplifying a gene fragment containing an SNP locus related to the skin color trait of slaughtered yellow chickens in the breeding of the skin color trait of slaughtered yellow chickens, characterized in that, The primer pair consists of an upstream primer shown in SEQ ID NO.1 and a downstream primer shown in SEQ ID NO.2; The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a C>T mutation at this locus, and the genotypes include CC, TT, and CT genotypes; The carcass skin color trait refers to the yellow color values of the skin on the chest, back, and legs; The yellow color values of the skin on the chest, back, and legs of TT genotype individuals are significantly higher than those of TG genotype individuals.
7. Use of an SNP locus related to the skin color trait of the slaughtered body of yellow - brown chickens in the breeding of the skin color trait of the slaughtered body of yellow - brown chickens, characterized in that, The SNP locus is located at the 251st position of the nucleotide sequence shown in SEQ ID NO.3, and there is a T>G mutation at this locus, and the genotypes include TT, GG, and TG genotypes; The carcass skin color trait refers to the yellow color values of the skin on the chest, back, and legs; The yellow color values of the skin on the chest, back, and legs of TT genotype individuals are significantly higher than those of TG genotype individuals.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to chicken carcass skin color traits and application of SNP molecular marker
CN114736973A
Chicken skin color and carcass character related CDK5 gene molecular marker and application
CN115820870A
Chicken skin yellowness related LncEDCH1 gene molecular marker and application thereof
CN116814801A
CYP2C18 gene molecular marker related to chicken carcass skin color traits and application of CYP2C18 gene molecular marker
CN118006795A