Application of SNP (Single Nucleotide Polymorphism) marker of KIAA0825 gene
Through the detection of the SNP marker of the KIAA0825 gene, especially the detection of the chrZ:1905252 locus, the problems of long generation intervals and high cost in traditional goose fat liver breeding were solved, and the identification and breeding of early high-yield fat liver traits were achieved, and the weight and economic benefits of foie gras were improved.
Patent Information
- Application Number
- CN202510785102.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-07-22
AI Technical Summary
Traditional goose fat liver breeding technology has long generation intervals, high economic investment and high artificial dependence, making it difficult to achieve efficient and early identification and breeding of high-yield fat liver traits.
The SNP marker of the KIAA0825 gene, especially the chrZ:1905252 locus, was used to identify high-yield fat liver traits by detecting genotype CC, and PCR and Sanger sequencing were used to achieve early identification and selection.
It significantly shortens the variety improvement cycle, saves breeding costs, increases fat liver yield, increases economic benefits, and achieves efficient rapid identification and breeding of high-yield fat liver traits.
Smart Images

Figure CN120350140A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic breeding, and specifically relates to the application of SNP markers of the KIAA0825 gene. Background Art
[0002] In the production of goose foie gras, the liver weight, as a core production trait, is directly related to the breeding economic benefits, and is also a key quantitative index for measuring the effectiveness of variety breeding. The genetic basis plays a decisive role in the liver fat deposition ability. Existing studies have shown that the foie gras trait is regulated by a multi-gene network, and the genetic diversity caused by nucleotide variation is an important genetic mechanism for the difference in foie gras performance among populations. Among many gene mutation types, single nucleotide polymorphism (SNP), as the most widely distributed genetic marker in the genome, can perform quality control and analysis on the data through whole-genome resequencing technology, and perform association analysis on specific SNP loci and the phenotypic data of foie gras weight, so as to screen out functional molecular markers related to foie gras weight, providing a theoretical basis for establishing a precise breeding system.
[0003] In view of the technical bottlenecks of traditional goose foie gras breeding techniques, such as long generation interval, high economic input and high dependence on labor, it is necessary to develop an early precise breeding system based on specific molecular markers and its detection strategy. Summary of the Invention
[0004] The purpose of the present invention is to provide the application of SNP markers of the KIAA0825 gene. By identifying genetic marker loci closely associated with the foie gras trait, it is possible to quickly identify high-yield individuals in the early stage of growth and development, effectively shorten the variety improvement cycle and significantly save feeding management resources.
[0005] To achieve the purpose of the present invention, in the first aspect, the present invention provides any one of the following applications of SNP markers of the KIAA0825 gene, including:
[0006] (1) For the breeding of high-yield goose foie gras traits;
[0007] (2) For the early prediction of goose individuals with high-yield goose foie gras traits;
[0008] (3) For the rapid identification of the goose individuals with high-yield goose foie gras traits in the early stage of growth and development;
[0009] Among them, the chrZ:1905252 site of the KIAA0825 gene has polymorphism, and the genotype CC of this site corresponds to the high-yield goose foie gras trait.
[0010] Furthermore, the primers of the SNP markers of the KIAA0825 gene are as shown in SEQ ID NO.1 and SEQ ID NO.2.
[0011] In a second aspect, the present invention provides a method for breeding geese with high-yield fatty liver traits, wherein the locus of the KIAA0825 gene of the goose in the above application is sequenced, the genotype of the locus is detected, and the goose individuals with genotype CC are selected for breeding.
[0012] In a third aspect, the present invention provides a method for breeding a goose variety with high-yield fatty liver traits, comprising the above-mentioned breeding method, breeding the geese retained for breeding, and the offspring can still obtain higher liver production performance.
[0013] In a fourth aspect, the present invention provides a method for screening geese with high-yield fatty liver traits. In the early stage of growth and development, the site of the KIAA0825 gene of the goose in the above application is sequenced, the genotype of the site is detected, and the goose individuals with genotype CC are selected.
[0014] Furthermore, the primers used in the detection process are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0015] The present invention has the following beneficial effects:
[0016] 1. The molecular genetic marker and its detection method of the present invention are relatively simple, and only a small amount of blood needs to be collected to identify and select high-yield fat liver geese at an early stage, which has the advantages of convenience, high throughput, labor saving, and can save breeding costs. If a Landes goose matching line is cultivated, the number of individuals per generation in the breeding group can be reduced by 500, and 1-2 breeding generations can be reduced. If the feeding cost of a Landes goose is calculated at 300 yuan / goose, the cost can be directly saved by 300,000 yuan (500 geese × 2 generations × 300 yuan / goose = 300,000 yuan).
[0017] 2. The application of the present invention has high practicality. In the production of goose fat liver, taking this group as an example, when no genotype selection is performed, the average liver weight is 900g, and after genotype selection (CC type), the average liver weight is 1146g, that is, the average liver weight can be increased by 246g after selection. According to the market price of 200 yuan / kg, the income of each goose can be increased by 49.2 yuan. If 20,000 geese are fed in each batch, the income can be increased by 984,000 yuan.
[0018] 3. The method for selecting and breeding geese with high-yield fatty liver traits and the method for breeding goose varieties with high-yield fatty liver traits of the present invention can efficiently select and breed geese with high-yield fatty liver traits, thereby increasing the yield of goose fatty liver.
[0019] 4. The method for screening high-yield foie gras traits of the present invention can realize the rapid identification of high-yield goose individuals in the early stage of growth and development, effectively shorten the breed improvement cycle and significantly save feeding and management resources. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1Schematic diagram for result interpretation of the detection method of the SNP genetic marker (chrZ:1905252) in Example 1. Among them, a is the TT genotype, b is the CC genotype, and c is the TC genotype. Detailed implementation manners
[0021] The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and specific implementation manners. However, those skilled in the art will understand that the following described embodiments are some embodiments of the present invention, rather than all embodiments, and are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. The experimental methods used in the following embodiments are all conventional methods unless otherwise specified.
[0022] The high-yield fat liver trait in the present invention means that after geese are force-fed with high-energy feed (such as corn, grease, etc.) for 20 - 30 days, the weight of the goose liver obtained after slaughter, freezing, and liver extraction is relatively high.
[0023] Any of the following applications of the SNP marker of the KIAA0825 gene, including:
[0024] (1) For breeding geese with high-yield fat liver traits;
[0025] (2) For early prediction of goose individuals with high-yield fat liver traits;
[0026] (3) For rapid identification of goose individuals with high-yield fat liver traits in the early stage of growth and development;
[0027] Among them, the chrZ:1905252 locus of the KIAA0825 gene (at the 1905252bp of the goose Z chromosome, reference genome: https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_040182565.1 / ) has polymorphism. The genotype CC of the locus corresponds to the high-yield fat liver trait, and the genotype TT or genotype TC of the locus corresponds to the low-yield fat liver trait. The primers of the SNP marker of the KIAA0825 gene are shown as SEQ ID NO.1 and SEQ ID NO.2.
[0028] SEQ ID NO.1: CAGCGACAGGAGGATTTTGTG;
[0029] SEQ ID NO.2: CCTCACCTGCATTCTTTGGGA.
[0030] Example 1
[0031] 1. Screening of genetic markers
[0032] 1) Phenotypic determination: The liver weights of 600 force-fed Landes geese for 26 days were recorded respectively. Blood samples of the 30 geese with the largest liver weight and the 30 geese with the smallest liver weight were selected for whole-genome resequencing.
[0033] 2) Screening of candidate loci: The raw data was quality-controlled before information analysis, and the filtered data was aligned to the goose reference genome. According to the goose genome annotation information, the selected loci under selection were mapped to genes. The genes in the selected regions were subjected to GO and KEGG enrichment analysis using the Microbial Informatics - Online Bioinformatics Analysis and Visualization Cloud Platform. ChrZ:1905252 under the adipolysis regulation pathway of adipocytes was screened as a candidate locus.
[0034] 3) Sequencing and determination of mutation types: The results showed that there was a mutation from T to C at this locus ( Figure 1 ).
[0035] 4) Determination of the association between the genotype of this genetic marker and fatty liver traits: In this population, there were 3 genotypes at this locus: TT, TC, and CC. The frequencies of the three genotypes in the high-yield liver group were 0.3, 0.4, and 0.3, and the allele frequencies of T:C were 0.5:0.5; in the low-yield liver group, the frequencies of the three genotypes were 0.5, 0.4, and 0.1, and the allele frequencies of T:C were 0.7:0.3. Among the individuals with the CC genotype, 75% of the individuals were high-yield individuals.
[0036] 2. Detection method of this genetic marker
[0037] 1) Blood collection: 1 mL of venous blood was collected from each goose to be tested.
[0038] 2) Extraction of blood DNA group: A blood DNA extraction kit was used to extract the DNA of blood samples.
[0039] 3) PCR and product quality inspection: Specific primers designed were used for PCR amplification with the extracted DNA. The amplification products should have a single band and be used for subsequent sequencing after passing the quality inspection by agarose gel electrophoresis.
[0040] 4) Product sequencing and determination of mutation types: By Sanger sequencing, the base information at the 297th bp of the amplification product was read. The results showed that there was a mutation from T to C at this locus ( Figure 1 b).
[0041] 5) Result determination: Among the SNP polymorphism sites of the KIAA0825 gene, the fatty liver weight of individuals with the CC genotype was significantly higher than that of the TT type. The KIAA0825 gene can be selected for individuals with the CC genotype to be used as breeding stock (Table 1).
[0042] Table 1
[0043]
[0044] Table 1 shows the statistical analysis of the relationship between the genotype of this locus in the population and the weight of goose fatty liver, that is, the determination of the relationship between the genotype of this genetic marker and the liver production weight. Geese with the CC genotype have high fatty liver production traits, and geese with the TT genotype have low fatty liver production traits. The results show that individuals with the CC genotype have higher goose liver production. This indicates that the genetic marker and its detection method in the present invention can effectively select high-fatty-liver geese at an early stage.
[0045] Example 2
[0046] The method for screening geese with high-fatty-liver traits in this example can select geese with high liver production performance before force-feeding.
[0047] 1. Goose selection and blood sample collection: Select 200 healthy Landes goslings with similar sizes for normal feeding. At 1 day old, 0.1 mL of venous blood is collected from each goose.
[0048] 2. Blood DNA extraction: Use the FastPure Blood DNA Isolation Mini Kit V2 (product number: DC111-01) DNA extraction kit from Nanjing Novoprotein Scientific Co., Ltd. to extract DNA from the blood of each goose.
[0049] 3. PCR and product quality inspection: Customize primers according to the primer sequences in Table 2, and perform PCR amplification according to the PCR reaction system in Table 3 and the PCR reaction program in Table 4; the amplified products are inspected by agarose gel electrophoresis, and the bands are single.
[0050] Table 2 PCR primer information
[0051]
[0052] Table 3 PCR reaction system
[0053]
[0054] Table 4 PCR reaction program
[0055]
[0056] 4. Product sequencing: Send 40 μL of the PCR product to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing, and read the base information at the 297th bp of the amplified product. The results show that 37 are of the TT genotype and 32 are of the CC genotype.
[0057] 5. Raise geese in the normal feeding manner until they reach 70 days of age, and then perform force-feeding for 26 days according to the conventional force-feeding method. The main force-feeding raw materials are corn, vegetable oil, and vitamins. After the force-feeding is completed, bleed the geese by cutting their necks and slaughter them. Immerse the carcasses in water at 60 - 70 °C, pluck the feathers by hand, drain the water, and transfer them to a 4 °C cold storage for freezing for 12 h. Then, open the abdominal cavity of the geese, carefully take out the livers, avoid damage, weigh the livers, and the results are shown in Table 5.
[0058] Table 5
[0059] Genotype Foie gras weight (g) TT 752 CC 1103
[0060] The results show that through the present invention, the average weight of the goose livers of the CC genotype is 1103 g, and the average weight of the goose livers of the TT genotype is 752 g. Compared with the TT genotype, the weight of the fatty livers of the CC genotype is significantly increased.
[0061] Example 3
[0062] Select individuals with the CC genotype and TT genotype of the KIAA0825 gene for breeding purposes, raise them to 240 days of age, breed the male and female geese with the CC genotype, collect the breeding eggs, and incubate them to obtain 42 offspring with the CC genotype. At the same time, breed the male and female geese with the TT genotype, collect the breeding eggs, and after hatching, obtain 38 offspring.
[0063] Collect the blood of the offspring goslings, extract DNA and perform PCR detection, and verify the genotypes of the offspring after sequencing (according to the method in Example 2). Randomly select 30 goslings with the CC genotype and 30 goslings with the TT genotype respectively, raise them to 70 days of age, and then perform force-feeding, slaughtering, and liver weighing according to the conventional force-feeding method for 26 days. The results are shown in Table 6.
[0064] The results show that compared with the offspring of the TT genotype, the weight of the fatty livers of the offspring of the CC genotype is still significantly increased.
[0065] Table 6
[0066] Offspring genotype Foie gras weight (g) TT 732 CC 1075
[0067] Although the present invention has been described in detail with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.
Claims
1. Any of the following applications of the SNP markers of the KIAA0825 gene, characterized in that, Comprising: (1) For the breeding of geese with high-yield fatty liver traits; (2) For the early prediction of geese individuals with high-yield fatty liver traits; (3) For the rapid identification of the geese individuals with high-yield fatty liver traits in the early stage of growth and development; Among them, the chrZ:1905252 locus of the KIAA0825 gene has polymorphism, and the genotype CC of this locus corresponds to the high-yield fatty liver trait.
2. The application according to claim 1, wherein The primers of the SNP marker of the KIAA0825 gene are as shown in SEQ ID NO.1 and SEQ ID NO.
2.
3. A breeding method for high-yield fat liver traits in geese, characterized in that, Sequencing the locus of the KIAA0825 gene of the geese in the application described in claim 1, detecting the genotype of this locus, and selecting the geese individuals with genotype CC for breeding use.
4. A method for cultivating a goose strain with high-yield fat liver traits, characterized in that, Including the breeding method described in claim 3, breeding the selected geese, and the offspring can still obtain high liver production performance.
5. A method for screening geese with high-yield fatty liver traits, characterized in that, In the early stage of growth and development, sequencing the locus of the KIAA0825 gene of the geese in the application described in claim 1 or 2, detecting the genotype of this locus, and selecting the geese individuals with genotype CC.
6. The method according to claim 5, characterized in that, The primers used in the detection process are as shown in SEQ ID NO.1 and SEQ ID NO.2.
Citation Information
Patent Citations
Detection kit for foie gras production performance of Landaise and application of detection kit
CN103333968A
Molecular marker for weight gain of goose fat livers after force-feeding of Landaise geese as well as application thereof
CN107604059A
Liver-purpose geese fatty liver weight assistant selection marker and assistant selection method by molecular marker
CN108866209A
Assisted selection marker for abdominal fat weight and carcass weight of goose bred for liver, and method for assisting selection with molecular marker
CN109022593A
Auxiliary selective marker of abdominal fat weight of fatty-liver geese and molecular marker assisted selection method
CN109082475A