Primer group for amplifying SNP (Single Nucleotide Polymorphism) molecular marker and application of SNP molecular marker in identifying high-adult cow conception rate character of dairy cow

By identifying SNP molecular marker sites in dairy cows and designing primer groups, the problem of low fetal rate of cows is solved, the pregnancy rate and reproductive efficiency of dairy cows is improved, the breeding cost is reduced, and the pasture income is increased.

CN120350142AInactive Publication Date: 2025-07-22INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI

Patent Information

Application Number
CN202510854694.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-25
Publication Date
2025-07-22
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Among the existing breeding management technologies, the fetus has low fetal rate and high physiological stress sensitivity during the embryo implantation window period, resulting in a high early embryo loss rate and insufficient nutritional regulation accuracy, which affects the reproductive efficiency and economic benefits of dairy cow herds.

Method used

By identifying SNP molecular markers in dairy cow populations, especially the polymorphic site T/C located at 144694232 bp of chromosome X, PCR amplification technology was used to detect cow genotypes, screen individuals with high adult cows' pregnancy rate, and design primer groups for genotype identification to improve the pregnancy rate of cow population.

Benefits of technology

It has increased the fetal rate of adult cows in dairy herds, reduced the cost of treatment, improved the economic benefits of the ranch, and achieved efficient molecular design breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350142A_ABST
    Figure CN120350142A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of dairy cow breeding markers, and relates to a primer group for amplifying an SNP molecular marker and application of the SNP molecular marker in identification of high-adult cow conception rate traits of dairy cows. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the polymorphic site is located at the 217th site of the sequence as shown in SEQ ID NO.1, and the polymorphism is T or C. The primer group as shown in SEQ ID NO.2 and SEQ ID NO.3 can be used for detection through PCR (Polymerase Chain Reaction) amplification. According to the identification result of the SNP molecular marker, breeders can select favorable genotype individuals for breeding, so that the conception rate character of the adult cows of a dairy cow group is improved, the conception rate of the adult cows of the dairy cow group is increased, and the economic benefit of a pasture is increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of dairy cattle breeding markers, and relates to a primer set for amplifying SNP molecular markers and the application of SNP molecular markers in identifying the trait of high conception rate of adult dairy cows. Background Art

[0002] Disclosing the information of this background art section is only intended to increase the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] In intensive livestock production, the reproductive efficiency of cows is a core factor affecting the economic benefits of pastures and industrial upgrading. Among them, the conception rate of cows, as a key indicator, directly determines the population iteration cycle (the fluctuation range of calving interval reaches ±18 days) and the production capacity release efficiency. However, the existing reproductive management technologies still face the following bottlenecks: 1. Defects in estrus synchronization regulation technology: There are redundant operations in traditional hormone induction programs. When the hormone dose error exceeds ±15%, the ovulation synchronization deviation is as high as 32%, resulting in a decrease in the group reproductive efficiency. 2. Insufficient stability of embryo development: During the embryo implantation window period from 0 to 16 days after breeding, the physiological stress sensitivity of cows is too high, causing the early embryo loss rate to exceed 65%, significantly reducing the conception success rate. 3. Lack of precision in nutritional regulation: The spatio-temporal mismatch between the dynamic requirements of the reproductive axis and nutritional supply leads to seasonal fluctuations in the conception rate, with a range of 22%, restricting the stable improvement of reproductive efficiency.

[0004] Although the whole-genome selection technology has identified 5 key QTL loci such as ETV5, and epigenomic studies have also revealed that the contribution rate of DNA methylation to the regulation of FSHR gene expression reaches 23%, more than 30% of the gene interaction mechanisms in the reproductive endocrine network are still unclear, and a quantitative model of the environment-gene interaction (such as the epigenetic silencing of HSP70 caused by heat stress) has not been established, hindering the development of precision regulation technologies. Summary of the Invention

[0005] In order to solve the deficiencies of the prior art, the object of the present invention is to provide a primer set for amplifying SNP molecular markers and the application of SNP molecular markers in identifying the trait of high conception rate of adult dairy cows. The present invention conducts genotype identification in a dairy cattle population through a Bovine SNP50 chip and finds that there is 1 SNP (chrX:g.144694232T>C); through the association analysis of the dairy cattle population genotype and the genomic estimated breeding value of the trait of adult dairy cow conception rate, it is proved that this SNP locus is significantly correlated with the trait of adult dairy cow conception rate.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows: First aspect, an application of an SNP molecular marker in identifying the trait of high conception rate of adult female dairy cows. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the polymorphic site is located at the 217th position of the sequence shown in SEQ ID NO.1, with the polymorphism being T or C.

[0007] The polymorphic site of the SNP molecular marker described in the present invention is located at the 144694232 bp of the bovine chromosome X sequence (the bovine reference genome version is UMD3.1, the Assembly accession of NCBI is GCF_000003055.6, and the chromosome number is AC 000187.1).

[0008] The present invention provides a gene related to the trait of conception rate of adult female dairy cows through PCR method, and identifies 1 SNP locus through BovineSNP50 chip. In the Holstein cattle population, the genotype of this SNP is associated with the genomic breeding value of the trait of conception rate of adult female cows in this population. The analysis results show that this SNP molecular marker is significantly correlated with the conception rate of adult female dairy cows. The above SNP molecular marker can accurately predict the trait of conception rate of adult female dairy cows under different genetic backgrounds, and can be used to identify dairy cows with high conception rate of adult female cows, improving the efficiency of molecular design breeding. And according to the identification result of the above SNP locus, breeders can select individuals with favorable genotypes for breeding, thereby improving the trait of conception rate of adult female cows in the dairy cow population, increasing the conception rate of adult female cows in the dairy cow population, reducing the treatment cost, and improving the economic benefits of the ranch.

[0009] The SNP molecular marker can be detected by PCR amplification or by Sanger sequencing method. When using the Sanger sequencing method, the substance detected by Sanger sequencing can achieve it.

[0010] To better detect the SNP molecular marker, in the second aspect of the present invention, a primer set for amplifying the SNP molecular marker is provided, and its nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively.

[0011] The present invention uses the dairy cow genome as a template and amplifies the SNP molecular marker through the provided primer set.

[0012] Third aspect, a detection kit, including the primer set described in the second aspect of the present invention.

[0013] In some embodiments, it further includes sampling tools and / or reagents for PCR amplification. Specifically, the reagents for PCR amplification include but are not limited to DNA polymerase, PCR reaction buffer solution, probe, dNTP, Mg 2+, water, etc. More specifically, the reagents for PCR amplification can be provided by individually packaging each component, or can be provided as a premix after mixing.

[0014] In a fourth aspect, a primer set as described in the second aspect of the present invention or a detection kit as described in the third aspect of the present invention is used in any one of the following (1)-(4); (1) Application in detecting or assisting in detecting the conception rate of adult dairy cows; (2) Application in screening or identifying superior strains with high conception rate of adult dairy cows; (3) Application in molecular marker-assisted breeding of the conception rate of adult dairy cows; (4) Application in improving germplasm resources of the conception rate of adult dairy cows.

[0015] In some embodiments, it includes the following steps: using the genomic DNA of the female cow as a template, amplifying to obtain the SNP molecular marker shown in SEQ ID NO.1 through the primer set, taking the 217th position of the SNP molecular marker as the polymorphic site, and detecting the polymorphism of the polymorphic site. Research shows that the polymorphism of the SNP molecular marker of the female cow is C or T. Judge the conception rate of the adult female cow according to the polymorphism. When the polymorphism is T, the conception rate of the adult female cow is high.

[0016] In a fifth aspect, a method for screening or identifying superior strains with high conception rate of adult dairy cows includes the following steps: Extracting genomic DNA of the dairy cow to be tested; Using the genomic DNA of the dairy cow to be tested as a template, and performing a PCR amplification reaction with the primer set as described in the second aspect of the present invention to obtain an amplification product; Detecting the amplification product. If the base at the 217bp position in the amplification product sequence is T, the dairy cow to be tested belongs to the superior strain of dairy cows with a high conception rate of adult female cows.

[0017] In some embodiments, the amplification program of the PCR amplification is: 94-96°C for 4.5-5.5 min; 94-96°C for 28-32 s, 58-60°C for 28-32 s, 71-73°C for 0.9-1.1 min, cycling 35 times; 71-73°C for 4.5-5.5 min.

[0018] In a sixth aspect, a method for dairy cow assisted breeding includes the following steps: Using the dairy cow individuals with superior genotypes obtained by the method as described in the fifth aspect of the present invention as parents for breeding.

[0019] In a seventh aspect, a method for identifying dairy cows with a high conception rate of adult female cows includes the following steps: Detect the genotypes of SNP molecular markers related to the conception rate of dairy cows in their adult stage; the polymorphic site of the SNP molecular marker is located at the 144694232nd bp of the X chromosome sequence of the UMD3.1 reference genome, and the polymorphism is C or T; The polymorphic site of the SNP molecular marker is T, corresponding to a high conception rate of adult cows.

[0020] In some embodiments, using the genomic DNA of the dairy cow to be tested as a template, PCR amplification is carried out with primers having sequences as shown in SEQ ID NOs. 2-3, and the genotypes of the PCR amplification products are detected.

[0021] Specifically, the amplification program for the PCR amplification is: 94-96°C for 4.5-5.5 min; 94-96°C for 28-32 s, 58-60°C for 28-32 s, 71-73°C for 0.9-1.1 min, with 35 cycles; 71-73°C for 4.5-5.5 min.

[0022] The beneficial effects of the present invention are as follows: The present invention discloses for the first time an SNP molecular marker related to the conception rate of dairy cows in their adult stage. Its nucleotide sequence is as shown in SEQ ID NO.1, the polymorphic site is located at the 217th position of the sequence shown in SEQ ID NO.1, and the polymorphism is C or T. It can improve the conception rate of dairy cows in their adult stage, and can be used as a marker for identifying the trait of high conception rate of dairy cows in their adult stage and for assisted breeding. It can be used to screen parental individuals with a higher conception rate of adult cows, effectively increase the service life of cows, save treatment costs, reduce breeding costs, and increase the income of the ranch. In addition, the related detection reagents for the above molecular markers can also be developed into products related to the breeding of Chinese Holstein cows.

[0023] The present invention utilizes the information of 1 SNP locus in cattle, and uses related molecular biology techniques to identify the genotype of dairy cows at this locus, so as to achieve early selection of genotype individuals with a high conception rate of adult cows. The present invention has identified 1 SNP locus, detected the genotype of individual dairy cows at this locus through related molecular biology techniques, and through the association analysis with the estimated breeding value of the trait of the conception rate of dairy cows in their adult stage, selected favorable genotype individuals for breeding, which can increase the frequency of the genotype with a high conception rate of adult cows in the dairy cow population, thereby improving the reproductive rate of the dairy cow population, reducing breeding costs, and increasing the economic benefits of the ranch, providing a new method for improving the conception rate of dairy cows in their adult stage. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0025] Figure 1 This is the result diagram of SNP marker sites determined by using the Illumina BovineSNP50 chip in Example 1 of the present invention. Detailed implementation manners

[0026] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0027] The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions.

[0028] Example 1 The following will make a detailed description of the molecular marker and application affecting the conception rate of adult dairy cows of the present invention. The specific scheme is as follows: 1. Screening SNPs (1) Collect blood or hair follicle samples of 2,500 Chinese Holstein cows in 4 large-scale farms Collect Chinese Holstein cow samples in 4 pastures across the country. The locations of the pastures and the number of samples collected from each pasture are shown in Table 1.

[0029] Table 1. Locations of pastures where samples are collected and the number of samples collected

[0030] (2) Use the Illumina BovineSNP50 chip to determine the genotypes of the collected samples. The determination of genotypes was performed by Neogen Bio-Tech (Shanghai) Co., Ltd., and a total of 47,843 SNP marker site genotypes were obtained.

[0031] (3) Estimate the genomic breeding value of the conception rate of adult cows for each individual according to the genotype. The genomic estimated breeding value was performed by Neogen Bio-Tech (Shanghai) Co., Ltd.

[0032] (4) Use the GEMMA software to perform a genome-wide association analysis on the genomic breeding value of the conception rate of adult cows based on the genotype data. The analysis model uses a mixed linear model, and the pasture and cow age are used as covariates. The FDR method is used for multiple test corrections. The association analysis results show that the most significant 1 SNP locus (or polymorphic locus) is located on bovine chromosome X, at position 144,694,232 (chrX:g.144694232T>C), as Figure 1 shown, and the significance P value is 6.38E-11.

[0033] The nucleotide sequence of the SNP molecular marker containing this SNP locus is: GTGACTCCTAAGGGATACACAGTGTCTTTTTCATTTTTTCTTTTTTAATTAGAGTACAATTGATTTACAATATTGTGCTACCTTTAGATATATAGCATAGTGATTTCTTTTTGGTGTGTGTATGTT T TTCTTAAGAGAATTTTGTTTTCAAATGAGGAAAATATTCTGGGACTAGAGAGTCATGGTACAACTCTGTGCGTGTATGGGAAAAGCCACTGAATCGCACACTTGGAAAGGATAAATGTAACAGCACATGAATGATATCTCAATAAAGCTATTATACAGAAACAAAAACCCAAGAGTGCAGAGGGGACGGGAGTTAAAAGTGGCACCACGCA, as shown in SEQ ID NO.1.

[0034] Among them, the underlined parts are SNP sites.

[0035] 2. Identification of the dominant genotype Among the 2,500 Chinese Holstein cows collected, 1,811 individuals with the TT homozygous genotype were identified, and the mean genomic estimated breeding value of the conception rate of adult cows was 0.9448; 803 individuals with the TC genotype were identified, and the mean genomic estimated breeding value of the conception rate of adult cows was 0.5749; 90 individuals with the CC genotype were identified, and the mean genomic estimated breeding value of the conception rate of adult cows was 0.02. In genomic genetic evaluation, the higher the genomic estimated breeding value of the conception rate of adult cows, the better. Therefore, the TT genotype is the dominant genotype.

[0036] 3. Sequence amplification (1)Collection of bovine tail vein blood Select cows with high and low conception rates of adult cows as experimental materials, and collect the tail vein blood of the cows.

[0037] (2)Genomic DNA extraction Take 500 μL of whole blood, add 500 μL of STE lysis buffer, sequentially add 50 μL of 10% SDS and 5 μL of Proteinase K (20 mg / mL), and lyse at 56 °C for 3 h until the lysate becomes clear. Add an equal volume of saturated phenol (250 μL) and a mixture of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1) (250 μL), gently shake for 20 min, and centrifuge at 12000 rpm for 10 min. Take the supernatant and repeat the above steps until there is no protein layer between the aqueous and organic phases. Take the supernatant, add a mixture of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1) of the same volume, gently shake for 20 min, and centrifuge at 12000 rpm for 10 min. Take the supernatant, add 1 / 10 volume of 3 M NaAc (pH 5.2) and 2 volumes of cold absolute ethanol, shake well, let stand at -20 °C for 20 min, and centrifuge at 12500 rpm for 20 min. Precipitate the nucleic acid at the bottom of the tube. Discard the supernatant, wash the precipitate with 70% (volume fraction) ethanol. Collect the precipitate and air-dry it until all the ethanol has evaporated. Add 20 μL of TE (containing RNase A) to dissolve the DNA, let stand at 37 °C for about 30 min, and then store at 4 °C. Detect the DNA sample by 1% agarose gel electrophoresis and detect the concentration and purity by ultraviolet spectrophotometer.

[0038] (3)Primer Design According to the bovine gene sequence, design a pair of specific primers. Among them, The forward primer is 5F (SEQ ID NO.2): 5’-GTGACTCCTAAGGGATACACAGT-3’; The reverse primer is 3R (SEQ ID NO.3): 5’-TGCGTGGTGCCACTTTTAAC-3’.

[0039] (4)Composite Polymerase Chain Reaction Use these primers for PCR amplification. The reaction system is as follows: 1 μL of 10× Buffer, 0.8 μL of 2.5 mM dNTP, 0.6 μL of 2.5 mM MgCl2, 0.1 μL of forward primer (10 μM), 0.5 μL of reverse primer (10 μM), 0.1 μL of Taq enzyme (5 U / μL), 0.5 μL of template, 0.7 μL of LCGreen saturated fluorescent dye, and add H2O to make up to 10 μL.

[0040] The amplification reaction is completed on an Applied Biosystem PCR system. The reaction conditions are as follows:

[0041] The genotypes of the PCR products were determined by Sanger sequencing.

[0042] Individuals in the core dairy cattle herd were selected, and the genotypes of the loci were detected using the above-mentioned molecular biology-related techniques. Individuals with favorable genotypes were selected for breeding, which could improve the conception rate trait of adult female dairy cattle in the herd, reduce breeding costs, increase breeding income, and lay a foundation for cultivating excellent new dairy cattle strains with high adult female conception rates.

[0043] Example 2 The Sanger sequencing method was used to detect the genotype and allele frequency distribution of the SNP locus provided in Example 1 in the Chinese Holstein cattle population. The results are shown in Table 2, which includes Chinese Holstein cattle from multiple pastures. The detection results showed that there were 3 genotypes in the Chinese Holstein dairy cattle population; in all the detected populations, the TT gene frequency was 57.6%, the TC genotype frequency was 29.6%, the CC genotype frequency was 12.8%, and the TT genotype was the dominant genotype (see Table 2).

[0044] Table 2 Distribution results in the Chinese Holstein cattle population

[0045] Table 2 note: The above population materials are all Chinese Holstein cattle populations, among which: Population 1 is the Chinese Holstein cattle population in a pasture in Gansu, Population 2 is the Chinese Holstein cattle population in a pasture in Hebei, and Population 3 is the Chinese Holstein cattle population in a pasture in Shandong.

[0046] To determine whether this genotype is related to the conception rate of adult female cattle, 1000 Chinese Holstein cattle were selected for the association analysis of genotype and genomic estimated breeding value of adult female conception rate. The average genomic breeding value of TT genotype individuals was 0.8874, the average genomic breeding value of CT genotype individuals was 0.5845, and the average genomic breeding value of CC genotype individuals was 0.0345. The PLINK v1.90 software was used to analyze the correlation between different genotypes and the conception rate trait of adult female dairy cattle. The results showed that there was a significant correlation between the genotype and the genomic breeding value (P value was 7E-4).

[0047] The experimental results of this embodiment can show that by detecting whether the SNP locus provided in Embodiment 1 is of the TT genotype, it can be used to detect or assist in detecting the conception rate of adult female dairy cows. Furthermore, the primer set for this SNP locus can also be used to detect or assist in detecting the conception rate of adult female dairy cows. Based on the result that this SNP locus and its amplification primer set can be used to detect or assist in detecting the conception rate of adult female dairy cows, it can be further used to screen or identify superior strains with high conception rate of adult female dairy cows, and according to the screening or identification of superior strains with high conception rate of adult female dairy cows, the application of this SNP locus and its amplification primer set in molecular marker-assisted breeding of conception rate of adult female dairy cows and the application in germplasm resource improvement of conception rate of adult female dairy cows can be realized.

[0048] In summary, the present invention has identified 1 SNP locus, detected the genotype of individual dairy cows at this locus through molecular biology-related techniques, and through the association analysis with the genomic estimated breeding value of the conception rate trait of adult female dairy cows, selected individuals with favorable genotypes for breeding, which can increase the frequency of the superior genotype of the conception rate of adult female cows at this locus, thereby increasing the conception rate of adult female cows in the dairy cow population, improving the reproductive efficiency, reducing the breeding cost, increasing the breeding benefit, and providing a new method for the genetic improvement of the conception rate of adult female dairy cows.

[0049] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of an SNP molecular marker in identifying the trait of high conception rate of adult dairy cows. The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.

1. The polymorphic site is located at the 217th position of the sequence shown as SEQ ID NO.1, and the polymorphism is T or C.

2. A primer set for amplifying SNP molecular markers, characterized in that, Their nucleotide sequences are shown as SEQ ID NO.2 and SEQ ID NO.3 respectively.

3. A detection kit, characterized in that, Comprising the primer group described in claim 2.

4. The detection kit according to claim 3, characterized in that, Also comprising a sampling tool and / or reagents for PCR amplification.

5. Use of the primer group described in claim 2 or the detection kit described in claim 3 or 4 in any one of the following (1)-(4); (1) Use in detecting or assisting in detecting the conception rate of adult dairy cows; (2) Use in screening or identifying superior strains with high conception rate of adult dairy cows; (3) Use in molecular marker-assisted breeding for the conception rate of adult dairy cows; (4) Use in improving the germplasm resources of the conception rate of adult dairy cows.

6. The application according to claim 5, characterized in that Comprising the following steps: Using the female cow genome as a template, amplifying to obtain the SNP molecular marker shown as SEQ ID NO.1 through the primer group, and using the 217th position of the SNP molecular marker as the polymorphic site to detect the polymorphism of the polymorphic site.

7. A method for screening or identifying superior strains with high conception rates in dairy cows, characterized in that, Comprising the following steps: Extracting the genomic DNA of the dairy cow to be tested; Using the genomic DNA of the dairy cow to be tested as a template, and using the primer group described in claim 2 to perform a PCR amplification reaction to obtain an amplification product; Detecting the amplification product. If the base at the 217bp position in the amplification product sequence is T, the dairy cow to be tested belongs to the superior strain of dairy cows with a high conception rate of adult cows.

8. The method according to claim 7, characterized in that, The amplification program of the PCR amplification is: 94-96°C for 4.5-5.5 min; 94-96°C for 28-32 s, 58-60°C for 28-32 s, 71-73°C for 0.9-1.1 min, cycling 35 times; 71-73°C for 4.5-5.5 min.

9. A method for assisted breeding of dairy cows, characterized in that, Comprising the following steps: Using the dairy cow individuals with the superior genotype obtained by the method described in claim 7 or 8 as parents for breeding.

10. A method for identifying dairy cows with high conception rates in high-producing adult cows, characterized in that, Comprising the following steps: Detecting the genotype of the SNP molecular marker related to the conception rate of adult dairy cows; the polymorphic site of the SNP molecular marker is located at the 144694232bp position of the X chromosome sequence of the UMD3.1 reference genome, and the polymorphism is C or T; The polymorphic site of the SNP molecular marker is T, corresponding to a high conception rate of adult dairy cows.

Citation Information

Patent Citations

  • Molecular marker of holstein cattle heat resistant stress breeding and use thereof

    CN101423872A

  • Application of SNP molecular marker in identification of high-reproductive-performance dairy cows and assisted breeding

    CN113684206A

  • Composition for forming resist underlayer film and patterning process

    KR1020240173612A

Cited By

  • Application of GUSB gene SNP molecular marker in evaluation of reproduction traits of young cows

    CN121065364A