Application of gene cluster in detection of photobacterium damsela and detection primer probe set

Abstract

The invention belongs to the technical field of marine organisms, and particularly relates to application of a gene cluster in detection of photobacterium damsela and a detection primer probe set. The primer probe group is a complete set of primer combination corresponding to three gene loci, and consists of upstream and downstream primers and probe primers; according to the invention, corresponding RPA (recombinase polymerase amplification) detection primers are designed according to three specific gene loci obtained by screening aiming at the existing known photobacterium damsela, and a test strip RPA detection system and method of the photobacterium damsela are established; the technology has an important value for on-site rapid screening and detection of the photobacterium damsonii involved in aquaculture, import and export trade and bathing beaches, and has a wide market application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of marine biotechnology, and particularly relates to the application of a gene cluster in detecting Photobacterium damselae and a detection primer-probe set. Background Art

[0002] Photobacterium damselae ( Photobacterium damselae ), a halophilic Gram-negative bacterium, is rod-shaped or coccobacillary and intracellular parasitic. Since it was first isolated from the skin ulcers of diseased Pomacentridae fish in 1981, the host range of this bacterium has continued to expand. Currently, it has been confirmed that it can infect various economically important marine fish such as Seriola quinqueradiata ( Seriola quinqueradiata ), Trachinotus ovatus ( Trachinotus ovatus ), Rachycentron canadum ( Rachycentron canadum ), Oplegnathus fasciatus ( Oplegnathus fasciatus ), causing ulcer disease, hemorrhagic septicemia and large-scale death. In recent years, the geographical distribution and host diversity of this bacterium have further expanded. Photobacterium damselae has extremely strong cross-border transmission ability and ecological adaptability. More seriously, the pathogenicity of Photobacterium damselae to mammals has also been confirmed, which can cause necrotizing fasciitis, septicemia and urinary tract infections in mice, whales, dolphins and humans. When humans come into contact with seawater or handle infected fish, they may be infected due to wound exposure or ingestion, making it a dual threat in the fields of aquaculture and public health.

[0003] Existing detection technologies face three bottlenecks: traditional methods, defects in molecular detection and obstacles in on-site application, which severely restrict the prevention and control of pathogenic bacteria. Traditional detection relies on bacterial culture and biochemical identification, which takes 3-5 days, has low sensitivity (detection limit > 10³ CFU / mL), cannot achieve early warning, and is highly dependent on laboratory equipment and professional personnel. Although molecular detection shortens the time, conventional PCR and quantitative fluorescence PCR mostly target single genes (such as gyrB, Dly or mcp), and are prone to false positives / false negatives due to gene horizontal transfer or intraspecific variation, such as misjudgment of residual DNA of dead bacteria or missed detection of virulence factor gene mutations. In addition, existing technologies highly rely on precision equipment such as thermal cyclers, with complex operations and high costs, making it difficult to promote at the grass-roots level. In on-site application, problems such as poor portability of equipment and low efficiency of sample pretreatment are particularly prominent. The nucleic acid amplification method has high theoretical sensitivity, but in practice, the detection limit often decreases due to insufficient sampling capture rate or interference from environmental inhibitors; traditional enrichment methods require time-consuming cultivation and are difficult to cope with sudden outbreaks. Taking aquaculture as an example, existing technologies cannot meet the rapid screening needs in scenarios such as ports and farms, resulting in an increased risk of pathogen spread.

[0004] To address the above problems, the development of highly sensitive and portable detection technologies based on multiple gene targets has become a key breakthrough direction, which can avoid the limitations of single targets and improve specificity. Such innovative technologies provide efficient solutions for the precise prevention and control of aquatic diseases, reducing economic losses, and ensuring public health safety. Summary of the Invention

[0005] In view of the disadvantages of the existing technology, the present invention provides an application of a gene cluster in detecting Photobacterium damselae subsp. piscicida.

[0006] The present invention also provides a primer-probe set for detecting Photobacterium damselae subsp. piscicida based on the gene cluster (HflD-McP-Pl8F).

[0007] The technical solution adopted by the present invention to achieve the above object is as follows: The present invention provides an application of a gene cluster HflD-McP-Pl8F in rapidly detecting Photobacterium damselae subsp. piscicida. In the gene cluster, the sequence of HflD is shown as SEQ ID NO.1; the sequence of McP is shown as SEQ ID NO.2; the sequence of Pl8F is shown as SEQ ID NO.3.

[0008] The present invention also provides a primer-probe set for detecting Photobacterium damselae subsp. piscicida based on the gene cluster HflD-McP-Pl8F. The primer-probe set is specifically as follows: HflD-F (SEQ ID NO.4): TAAACTCTCTGGCAGTCGAGACAGTATGGCTCAAT; HflD-R (SEQ ID NO.5): biotin-TAATAGGTCGCGCACCTTATGCTGAACTTGAGGAA; HflD-Probe (SEQ ID NO.6): FAM-AATTACTTGAAGAGCAAATGCTGAGCAATAT / idSp / GCGAGTGTGTATTTAG-SpC3 McP -F (SEQ ID NO.7): AAATCGCCTCTCTGAACAGACCCAACAAGGGATCC; McP -R (SEQ ID NO.8): biotin-ATATCGTCACATCCTCCAGCGTAGCGTGCCTGTTG; McP -Probe (SEQ ID NO.9): FAM-TAACTAATGCAGCAACATCGGGTATTCGTGA / idSp / TGGATTCAAATACGAA-SpC3; Pl8F-F (SEQ ID NO.10): ATACTCGGATCGGACATTGGAATGAGATAGGAACA; Pl8F-R (SEQ ID NO.11): biotin-TATTAGCCGCAATCACATTATCATCTTTAGAACGA; Pl8F-Probe (SEQ ID NO.12): FAM-AACAATCCGACATTCAGTCGATCATGATTCT / idSp / ACGCATACGTTGTGCT-SpC3; Wherein, biotin represents biotin labeling; FAM represents fluorescein labeling; SpC3 represents Spacer C3 modification; idSp represents a gap.

[0009] The present invention also provides the application of the above primer-probe set in the preparation of a kit for rapid detection of Photobacterium damselae, including the following steps: (1) Performing a nucleic acid isothermal amplification reaction on the extracted and purified DNA using PRA reagent; (2) Analyzing the RPA amplification product using a colloidal gold lateral flow immunochromatographic test strip and reading the result of the test strip.

[0010] Preferably, the specific process of the nucleic acid isothermal amplification reaction is: 15 μL of hydrolysis buffer, 1.0 μL of upstream primer 10 μM, 1.0 μL of downstream primer 10 μM, 0.3 μL of probe primer 10 μM, 2 μL of DNA template, 5.5 μL of ddH2O, and 1.2 μL of magnesium acetate 280 mM, and incubating at a constant temperature of 37°C for 15 min.

[0011] Preferably, in step (2), the specific process is: adding 5 μL of the RPA amplification product to 95 μL of diluent for dilution, and then dropping the diluted RPA amplification product onto the sample application end of the colloidal gold lateral flow immunochromatographic test strip and reading the result of the test strip.

[0012] Preferably, after reading the result of the test strip, the determination condition is: a sample with positive control lines on all three test strips and also positive test lines is determined as a positive sample; a sample with positive control lines on all three test strips and negative test lines is determined as a negative sample.

[0013] The gene clusters provided by the present invention: HflP, high-frequency lysogenization protein; Pl8F, polysaccharide lyase family 8 protein; McP, methyl-accepting chemotaxis protein.

[0014] By screening a conserved and highly specific multi-gene cluster (HflD-McP-Pl8F), the present invention circumvents the biological errors of single-gene detection and improves the accuracy of results; adopts the recombinase polymerase amplification (RPA) technology to complete nucleic acid amplification within 15 minutes under the constant temperature condition of 37-42 °C, getting rid of the dependence on precision temperature control equipment; combines with a colloidal gold lateral flow chromatography test strip (LFD) to directly interpret the results with the naked eye, realizing "zero equipment" on-site detection. The present invention can not only fill the technical gap of on-site rapid detection, but also has great practical significance for reducing the large-scale outbreak of Photobacterium damselae subsp. piscicida in aquaculture, ensuring the safety of aquatic trade and improving the public health emergency response ability.

[0015] The present invention designs a set of primers and probes according to the specific regions of three genes, aiming to achieve accurate detection of Photobacterium damselae subsp. piscicida. At the same time, a test strip is used to indicate the results of isothermal amplification detection, so as to reduce the dependence on instrument equipment to a greater extent and be better applied to on-site rapid detection.

[0016] The sensitivity and specificity of the test strip RPA detection method of the present invention were tested. The results show that the sensitivity of using the test strip RPA of the present invention to detect Photobacterium damselae subsp. piscicida is 5×10¹ CFU / mL, and it has a wide detection range, and samples within at least 5×10 8 -5×10 1 range can be detected. The specific detection results show that using this method can well distinguish Photobacterium damselae subsp. piscicida from other vibrio types. Therefore, it shows that the test strip RPA detection method of the present invention has good specificity and universality.

[0017] Compared with the prior art, the beneficial technical effects of the present invention are as follows: 1. The designed set of RPA isothermal amplification primers of the present invention have strong specificity and high sensitivity.

[0018] 2. For Photobacterium damselae subsp. piscicida, the present invention systematically screens three genes with stable and specific expression, designs specific primers and probes for the three genes, and interprets the detection results of the three-gene cluster at the same time, greatly improving the accuracy of detection.

[0019] 3. The detection method of the present invention combines the RPA isothermal amplification technology with a colloidal gold immunochromatography test strip, which can realize the rapid detection of Photobacterium damselae subsp. piscicida, and can detect the indicated positive samples at the lowest (5×10 1CFU / mL). The specificity test results of the detection method of the present invention are good, and the repeatability test has good stability, providing a new on-site detection method with low cost and no special equipment for the effective detection of Photobacterium damselae subsp. piscicida.

[0020] 4. The present invention can be used as a rapid on-site screening and detection method for the environmental monitoring of seawater bathing beaches or Photobacterium damselae subsp. piscicida in aquatic products, and can also be applied to the epidemiological investigation and research of Photobacterium damselae subsp. piscicida infection, with important value and market application prospects. Description of the Drawings

[0021] Figure 1 It is the detection sensitivity result of the test strip RPA. Among them, D is the detection sensitivity result of HflD, E is the detection sensitivity result of Pl8F, and F is the detection sensitivity result of McP; Figure 2 It is the detection specificity and universality result of the test strip RPA. Among them, D is the detection specificity and universality result of HflD, E is the detection specificity and universality result of Pl8F, and F is the detection specificity and universality result of McP. Detailed Embodiments

[0022] The technical solutions of the present invention will be further explained and illustrated below through specific embodiments.

[0023] The Photobacterium damselae subsp. piscicida used in the present invention ( Photobacterium damselae ) was self-collected from Qingdao, Shandong Province, China on July 1, 2015.

[0024] Example 1: Establishment of the test strip RPA detection method for the rapid on-site detection of Photobacterium damselae subsp. piscicida 1. Design of RPA upstream and downstream primers and probe primers Download the nucleic acid sequences corresponding to three specific genes (HflD - McP - Pl8F) of Photobacterium damselae subsp. piscicida from GenBank of NCBI, design and manually adjust them, and screen a set of primers and probes in order to be able to detect Photobacterium damselae subsp. piscicida with high specificity and high sensitivity. The primer and probe sequences finally optimized and designed in the present invention are shown in Table 1 below.

[0025] Table 1

[0026] 2. Extraction of clinical sample DNA The Photobacterium damselae subsp. piscicida strains used in the present invention were collected and preserved by this laboratory. Use the TIANamp Bacterial DNA Kit (DP302, Tiangen) kit to extract and prepare the DNA positive samples of this strain, and finally elute with 50 μL of nuclease-free ultrapure water. Synchronously prepare the extraction of Vibrio vulnificus (V. vulnificus ), Vibrio alginolyticus ( V. alginolyticus ), Vibrio campbellii ( V. campbellii ), Vibrio parahaemolyticus ( V. parahaemolyticus ), Vibrio harveyi ( V. harveyi ), Vibrio splendidus ( V. splendidus ), Vibrio kanaloae ( V. kanaloae ), Edwardsiella tarda ( E. tarda ), etc., 8 common marine pathogenic bacteria were used as negative controls. The extracted DNA was stored at -20 °C for subsequent use.

[0027] 3. Optimization of amplification conditions for strip RPA test Amplification was carried out using the extracted and purified total DNA sample of the tissue as a template. The experimental system is as follows: 15 μL of rehydration buffer (TwistDx nfo Kit, Cambridge, United Kingdom), 1.0 μL of upstream primer (10 μM), 1.0 μL of downstream primer (10 μM), 0.3 μL of probe primer (10 μM), 2 μL of DNA template, 5.5 μL of ddH2O, and 1.2 μL of magnesium acetate (280 mM).

[0028] Among them, the sequences of the pair of primers and a probe are as follows: Upstream primer: 5’-TAAACTCTCTGGCAGTCGAGACAGTATGGCTCAAT-3’; Downstream primer: 5’-biotin- TAATAGGTCGCGCACCTTATGCTGAACTTGAGGAA-3’; Probe primer: 5’FAM-AATTACTTGAAGAGCAAATGCTGAGCAATAT / idSp / GCGAGTGTGTATTTAG-SpC3-3’.

[0029] The reaction conditions were 37 °C and the reaction time was 15 min. After completion, a lateral flow chromatography strip (TS101, GenDx) was used to detect the results.

[0030] In the present invention, six sets of primer combinations synthesized by HlfD, McP, and Pl8F (as shown in Table 2) were evaluated using this system. The evaluation results showed that one set of primers, and the combination after manual adjustment (as shown in Table 1) could produce the strongest amplification signal. Therefore, this set of primer combinations was applied to the present invention.

[0031] Table 2

[0032] Judgment of the detection results of the test strip RPA test: Under specific conditions (37 °C, 15 min), for a sample, if the control lines on all three test strips are positive and the test lines are also all positive, the sample is judged as a positive sample; if the control lines on all three test strips are positive while the test lines are all negative, the sample is a negative sample.

[0033] 4. Sensitivity detection Using the plate counting method, first perform quantitative analysis on Photobacterium damselae subsp. piscicida in the positive sample. The DNA samples of Photobacterium damselae subsp. piscicida after quantification are respectively diluted by 10-fold gradients (5×10 8 -5×10 1 ) as the templates for the detection sensitivity of the test strip RPA. Three groups of gene primers are respectively used for the RPA amplification detection of the test strip. The reaction system and conditions are as described in item 3 above. The results are as Figure 1 shown in D, E, and F in. It can be seen from the sensitivity detection results that the primer combinations of HflD, Pl8F, and McP can show positive bands for the samples of Photobacterium damselae subsp. piscicida with a quantity level of 5×10 1 CFU / mL and above, and the threshold range for judging positive samples by the three groups of primers is defined as 5×10 1 CFU / mL and above.

[0034] 5. Specificity and universality detection Using the nucleic acid of the confirmed Photobacterium damselae subsp. piscicida sample as the amplification template for the positive sample, and the nucleic acids of the other 8 common vibrio samples as the amplification templates for the negative samples, with water as the blank control. Three groups of gene primer combinations are used for RPA amplification, and the results are judged in combination with test strip chromatography. The reaction system and conditions are as described in item 3 above.

[0035] The results are as Figure 2 shown in D, E, and F in. The three groups of gene primer combinations can specifically detect the positive samples of Photobacterium damselae subsp. piscicida, and there are no amplification bands at the test lines of the negative samples.

Claims

1. Use of a gene cluster in detecting Photobacterium damselae, characterized in that, The gene cluster is HflD-McP-Pl8F; among them, the sequence of HflD is as shown in SEQ ID NO.1; the sequence of McP is as shown in SEQ ID NO.2; the sequence of Pl8F is as shown in SEQ ID NO.

3.

2. A primer-probe set for detecting Photobacterium damselae based on the gene cluster HflD-McP-Pl8F, characterized in that, The primer-probe set is specifically: HflD-F: TAAACTCTCTGGCAGTCGAGACAGTATGGCTCAAT; HflD-R: biotin-TAATAGGTCGCGCACCTTATGCTGAACTTGAGGAA; HflD-Probe: FAM-AATTACTTGAAGAGCAAATGCTGAGCAATAT / idSp / GCGAGTGTGTATTTAG-SpC3; McP -F: AAATCGCCTCTCTGAACAGACCCAACAAGGGATCC; McP -R: biotin-ATATCGTCACATCCTCCAGCGTAGCGTGCCTGTTG; McP -Probe: FAM-TAACTAATGCAGCAACATCGGGTATTCGTGA / idSp / TGGATTCAAATACGAA-SpC3; Pl8F-F: ATACTCGGATCGGACATTGGAATGAGATAGGAACA; Pl8F-R: biotin- TATTAGCCGCAATCACATTATCATCTTTAGAACGA; Pl8F-Probe: FAM-AACAATCCGACATTCAGTCGATCATGATTCT / idSp / ACGCATACGTTGTGCT-SpC3; Among them, biotin represents biotin labeling; FAM represents fluorescein labeling; SpC3 represents Spacer C3 modification; idSp represents a gap.

3. Use of a primer-probe set as described in claim 2 in the preparation of a kit for rapid detection of Photobacterium damselae, characterized in that, It includes the following steps: (1) Perform a nucleic acid isothermal amplification reaction on the extracted and purified DNA using PRA reagent; (2) Analyze the RPA amplification product using a colloidal gold lateral flow immunochromatographic test strip and read the result of the test strip.

4. The application according to claim 3, wherein The specific process of the nucleic acid isothermal amplification reaction is: 15 μL of hydrolysis buffer, 1.0 μL of upstream primer 10 μM, 1.0 μL of downstream primer 10 μM, 0.3 μL of probe primer 10 μM, 2 μL of DNA template, 5.5 μL of ddH2O, and 1.2 μL of magnesium acetate 280 mM, and incubate at a constant temperature of 37°C for 15 min.

5. The application according to claim 4, characterized in that In step (2), the specific process is: Add 5 μL of the RPA amplification product to 95 μL of diluent for dilution, and then add the diluted RPA amplification product dropwise to the sample addition end of the colloidal gold lateral flow immunochromatographic test strip, and read the result of the test strip.

6. The application according to any one of claims 3-5, characterized in that, After reading the results of the test strips, the judgment criteria are as follows: Samples in which the control lines on all three test strips are positive and the test lines are also all positive are judged as positive samples; Samples in which the control lines on all three test strips are positive while the test lines are all negative are negative samples.

Images